0s autopkgtest [10:25:18]: starting date and time: 2025-11-01 10:25:18+0000 0s autopkgtest [10:25:18]: git checkout: 508d4a25 a-v-ssh wait_for_ssh: demote "ssh connection failed" to a debug message 0s autopkgtest [10:25:18]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.s3f1akcr/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,localhost,localdomain,internal,login.ubuntu.com,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:scipy --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=scipy/1.16.3-1 -- lxd -r lxd-armhf-10.145.243.232 lxd-armhf-10.145.243.232:autopkgtest/ubuntu/resolute/armhf 20s autopkgtest [10:25:38]: testbed dpkg architecture: armhf 22s autopkgtest [10:25:40]: testbed apt version: 3.1.6ubuntu2 26s autopkgtest [10:25:44]: @@@@@@@@@@@@@@@@@@@@ test bed setup 28s autopkgtest [10:25:46]: testbed release detected to be: None 35s autopkgtest [10:25:53]: updating testbed package index (apt update) 37s Get:1 http://ftpmaster.internal/ubuntu resolute-proposed InRelease [87.8 kB] 38s Get:2 http://ftpmaster.internal/ubuntu resolute InRelease [87.8 kB] 38s Get:3 http://ftpmaster.internal/ubuntu resolute-updates InRelease [87.8 kB] 38s Get:4 http://ftpmaster.internal/ubuntu resolute-security InRelease [87.8 kB] 38s Get:5 http://ftpmaster.internal/ubuntu resolute-proposed/main Sources [138 kB] 38s Get:6 http://ftpmaster.internal/ubuntu resolute-proposed/restricted Sources [9848 B] 38s Get:7 http://ftpmaster.internal/ubuntu resolute-proposed/universe Sources [2408 kB] 38s Get:8 http://ftpmaster.internal/ubuntu resolute-proposed/multiverse Sources [50.0 kB] 38s Get:9 http://ftpmaster.internal/ubuntu resolute-proposed/main armhf Packages [196 kB] 38s Get:10 http://ftpmaster.internal/ubuntu resolute-proposed/restricted armhf Packages [940 B] 38s Get:11 http://ftpmaster.internal/ubuntu resolute-proposed/universe armhf Packages [1696 kB] 38s Get:12 http://ftpmaster.internal/ubuntu resolute-proposed/multiverse armhf Packages [29.0 kB] 38s Get:13 http://ftpmaster.internal/ubuntu resolute/main Sources [1414 kB] 39s Get:14 http://ftpmaster.internal/ubuntu resolute/restricted Sources [12.5 kB] 39s Get:15 http://ftpmaster.internal/ubuntu resolute/universe Sources [21.1 MB] 41s Get:16 http://ftpmaster.internal/ubuntu resolute/multiverse Sources [311 kB] 41s Get:17 http://ftpmaster.internal/ubuntu resolute/main armhf Packages [1374 kB] 41s Get:18 http://ftpmaster.internal/ubuntu resolute/restricted armhf Packages [1232 B] 41s Get:19 http://ftpmaster.internal/ubuntu resolute/universe armhf Packages [15.3 MB] 43s Get:20 http://ftpmaster.internal/ubuntu resolute/multiverse armhf Packages [183 kB] 44s Fetched 44.5 MB in 7s (6262 kB/s) 46s Reading package lists... 51s autopkgtest [10:26:09]: upgrading testbed (apt dist-upgrade and autopurge) 53s Reading package lists... 53s Building dependency tree... 53s Reading state information... 54s Calculating upgrade... 54s The following NEW packages will be installed: 54s python3.14-gdbm 54s The following packages will be upgraded: 54s apparmor apt base-files bind9-dnsutils bind9-host bind9-libs binutils 54s binutils-arm-linux-gnueabihf binutils-common bsdextrautils bsdutils 54s cloud-init cloud-init-base distro-info-data dpkg dpkg-dev eject fdisk 54s gcc-15-base gir1.2-girepository-2.0 gir1.2-glib-2.0 gnu-coreutils grep 54s libapparmor1 libapt-pkg7.0 libatomic1 libaudit-common libaudit1 libbinutils 54s libblkid1 libbrotli1 libcap-ng0 libctf-nobfd0 libctf0 libdpkg-perl 54s libdrm-common libdrm2 libelf1t64 libfdisk1 libfribidi0 libgcc-s1 54s libgirepository-1.0-1 libglib2.0-0t64 libglib2.0-data libgpg-error-l10n 54s libgpg-error0 libhogweed6t64 libjson-c5 liblastlog2-2 libmount1 54s libnettle8t64 libnewt0.52 libnftables1 libnl-3-200 libnl-route-3-200 54s libp11-kit0 libpython3.13-minimal libpython3.13-stdlib librtmp1 libseccomp2 54s libselinux1 libsemanage-common libsemanage2 libsepol2 libsframe2 54s libsmartcols1 libstdc++6 libuchardet0 libuuid1 libxml2-16 login 54s lto-disabled-list mount nano nftables publicsuffix python-apt-common 54s python3-apt python3-bcrypt python3-blinker python3-cffi-backend python3-dbus 54s python3-gdbm python3-inflect python3-jwt python3-lazr.uri python3-markupsafe 54s python3-more-itertools python3-oauthlib python3-openssl python3-pyparsing 54s python3-yaml python3-zipp python3.13 python3.13-gdbm python3.13-minimal 54s sensible-utils sudo-rs tzdata ubuntu-pro-client ubuntu-pro-client-l10n 54s usb.ids util-linux uuid-runtime whiptail 54s 105 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 54s Need to get 28.4 MB of archives. 54s After this operation, 1137 kB of additional disk space will be used. 54s Get:1 http://ftpmaster.internal/ubuntu resolute/main armhf base-files armhf 14ubuntu4 [75.4 kB] 55s Get:2 http://ftpmaster.internal/ubuntu resolute/main armhf libatomic1 armhf 15.2.0-7ubuntu1 [7818 B] 55s Get:3 http://ftpmaster.internal/ubuntu resolute/main armhf gcc-15-base armhf 15.2.0-7ubuntu1 [58.4 kB] 55s Get:4 http://ftpmaster.internal/ubuntu resolute/main armhf libgcc-s1 armhf 15.2.0-7ubuntu1 [40.5 kB] 55s Get:5 http://ftpmaster.internal/ubuntu resolute/main armhf libstdc++6 armhf 15.2.0-7ubuntu1 [731 kB] 56s Get:6 http://ftpmaster.internal/ubuntu resolute/main armhf libapt-pkg7.0 armhf 3.1.11 [1157 kB] 57s Get:7 http://ftpmaster.internal/ubuntu resolute/main armhf dpkg armhf 1.22.21ubuntu4 [1245 kB] 58s Get:8 http://ftpmaster.internal/ubuntu resolute/main armhf grep armhf 3.12-1 [165 kB] 58s Get:9 http://ftpmaster.internal/ubuntu resolute/main armhf eject armhf 2.41.2-4ubuntu1 [65.9 kB] 58s Get:10 http://ftpmaster.internal/ubuntu resolute/main armhf fdisk armhf 2.41.2-4ubuntu1 [164 kB] 58s Get:11 http://ftpmaster.internal/ubuntu resolute/main armhf libblkid1 armhf 2.41.2-4ubuntu1 [174 kB] 58s Get:12 http://ftpmaster.internal/ubuntu resolute/main armhf libmount1 armhf 2.41.2-4ubuntu1 [206 kB] 58s Get:13 http://ftpmaster.internal/ubuntu resolute/main armhf libsmartcols1 armhf 2.41.2-4ubuntu1 [143 kB] 58s Get:14 http://ftpmaster.internal/ubuntu resolute/main armhf mount armhf 2.41.2-4ubuntu1 [166 kB] 58s Get:15 http://ftpmaster.internal/ubuntu resolute/main armhf uuid-runtime armhf 2.41.2-4ubuntu1 [67.6 kB] 59s Get:16 http://ftpmaster.internal/ubuntu resolute/main armhf libuuid1 armhf 2.41.2-4ubuntu1 [43.8 kB] 59s Get:17 http://ftpmaster.internal/ubuntu resolute/main armhf libfdisk1 armhf 2.41.2-4ubuntu1 [222 kB] 59s Get:18 http://ftpmaster.internal/ubuntu resolute/main armhf bsdutils armhf 1:2.41.2-4ubuntu1 [98.2 kB] 59s Get:19 http://ftpmaster.internal/ubuntu resolute/main armhf util-linux armhf 2.41.2-4ubuntu1 [1146 kB] 60s Get:20 http://ftpmaster.internal/ubuntu resolute/main armhf bsdextrautils armhf 2.41.2-4ubuntu1 [101 kB] 60s Get:21 http://ftpmaster.internal/ubuntu resolute/main armhf libselinux1 armhf 3.8.1-1build2 [81.3 kB] 60s Get:22 http://ftpmaster.internal/ubuntu resolute/main armhf libseccomp2 armhf 2.6.0-2ubuntu3 [53.5 kB] 60s Get:23 http://ftpmaster.internal/ubuntu resolute/main armhf apt armhf 3.1.11 [1434 kB] 61s Get:24 http://ftpmaster.internal/ubuntu resolute/main armhf gnu-coreutils armhf 9.7-3ubuntu1 [1209 kB] 62s Get:25 http://ftpmaster.internal/ubuntu resolute/main armhf libaudit-common all 1:4.0.5-1build2 [6596 B] 62s Get:26 http://ftpmaster.internal/ubuntu resolute/main armhf libcap-ng0 armhf 0.8.5-4build3 [14.0 kB] 62s Get:27 http://ftpmaster.internal/ubuntu resolute/main armhf libaudit1 armhf 1:4.0.5-1build2 [51.7 kB] 62s Get:28 http://ftpmaster.internal/ubuntu resolute/main armhf login armhf 1:4.16.0-2+really2.41.2-4ubuntu1 [109 kB] 62s Get:29 http://ftpmaster.internal/ubuntu resolute/main armhf python3.13 armhf 3.13.9-1 [753 kB] 63s Get:30 http://ftpmaster.internal/ubuntu resolute/main armhf python3.13-minimal armhf 3.13.9-1 [2058 kB] 64s Get:31 http://ftpmaster.internal/ubuntu resolute/main armhf libpython3.13-stdlib armhf 3.13.9-1 [1957 kB] 66s Get:32 http://ftpmaster.internal/ubuntu resolute/main armhf libpython3.13-minimal armhf 3.13.9-1 [873 kB] 66s Get:33 http://ftpmaster.internal/ubuntu resolute/main armhf tzdata all 2025b-5ubuntu1 [198 kB] 66s Get:34 http://ftpmaster.internal/ubuntu resolute/main armhf liblastlog2-2 armhf 2.41.2-4ubuntu1 [34.6 kB] 66s Get:35 http://ftpmaster.internal/ubuntu resolute/main armhf libsemanage-common all 3.8.1-1build1 [7916 B] 66s Get:36 http://ftpmaster.internal/ubuntu resolute/main armhf libsepol2 armhf 3.9-2 [286 kB] 67s Get:37 http://ftpmaster.internal/ubuntu resolute/main armhf libsemanage2 armhf 3.8.1-1build1 [89.2 kB] 67s Get:38 http://ftpmaster.internal/ubuntu resolute/main armhf libgpg-error-l10n all 1.56-2 [9066 B] 67s Get:39 http://ftpmaster.internal/ubuntu resolute/main armhf libgpg-error0 armhf 1.56-2 [69.2 kB] 67s Get:40 http://ftpmaster.internal/ubuntu resolute/main armhf sensible-utils all 0.0.26 [27.0 kB] 67s Get:41 http://ftpmaster.internal/ubuntu resolute/main armhf distro-info-data all 0.68 [7378 B] 67s Get:42 http://ftpmaster.internal/ubuntu resolute/main armhf gir1.2-girepository-2.0 armhf 1.86.0-6 [25.3 kB] 67s Get:43 http://ftpmaster.internal/ubuntu resolute/main armhf gir1.2-glib-2.0 armhf 2.86.1-1 [182 kB] 67s Get:44 http://ftpmaster.internal/ubuntu resolute/main armhf libglib2.0-0t64 armhf 2.86.1-1 [1482 kB] 68s Get:45 http://ftpmaster.internal/ubuntu resolute/main armhf libgirepository-1.0-1 armhf 1.86.0-6 [111 kB] 68s Get:46 http://ftpmaster.internal/ubuntu resolute/main armhf libapparmor1 armhf 5.0.0~alpha1-0ubuntu8.1 [52.9 kB] 68s Get:47 http://ftpmaster.internal/ubuntu resolute/main armhf libelf1t64 armhf 0.193-3 [50.9 kB] 68s Get:48 http://ftpmaster.internal/ubuntu resolute/main armhf libfribidi0 armhf 1.0.16-3 [24.1 kB] 68s Get:49 http://ftpmaster.internal/ubuntu resolute/main armhf libglib2.0-data all 2.86.1-1 [56.7 kB] 68s Get:50 http://ftpmaster.internal/ubuntu resolute/main armhf libnettle8t64 armhf 3.10.2-1 [189 kB] 68s Get:51 http://ftpmaster.internal/ubuntu resolute/main armhf libhogweed6t64 armhf 3.10.2-1 [188 kB] 68s Get:52 http://ftpmaster.internal/ubuntu resolute/main armhf libjson-c5 armhf 0.18+ds-1.1 [33.3 kB] 68s Get:53 http://ftpmaster.internal/ubuntu resolute/main armhf libnewt0.52 armhf 0.52.25-1ubuntu2 [39.9 kB] 68s Get:54 http://ftpmaster.internal/ubuntu resolute/main armhf libp11-kit0 armhf 0.25.9-2 [265 kB] 68s Get:55 http://ftpmaster.internal/ubuntu resolute/main armhf libxml2-16 armhf 2.14.5+dfsg-0.2build1 [527 kB] 68s Get:56 http://ftpmaster.internal/ubuntu resolute/main armhf python-apt-common all 3.0.0ubuntu2 [21.7 kB] 69s Get:57 http://ftpmaster.internal/ubuntu resolute/main armhf python3-apt armhf 3.0.0ubuntu2 [189 kB] 69s Get:58 http://ftpmaster.internal/ubuntu resolute/main armhf python3-cffi-backend armhf 2.0.0-2 [99.1 kB] 69s Get:59 http://ftpmaster.internal/ubuntu resolute/main armhf python3-dbus armhf 1.4.0-1build1 [113 kB] 69s Get:60 http://ftpmaster.internal/ubuntu resolute/main armhf python3-yaml armhf 6.0.2-2 [181 kB] 69s Get:61 http://ftpmaster.internal/ubuntu resolute/main armhf sudo-rs armhf 0.2.8-1ubuntu5.1 [548 kB] 69s Get:62 http://ftpmaster.internal/ubuntu resolute/main armhf ubuntu-pro-client-l10n armhf 37.1ubuntu0 [19.8 kB] 69s Get:63 http://ftpmaster.internal/ubuntu resolute/main armhf ubuntu-pro-client armhf 37.1ubuntu0 [260 kB] 69s Get:64 http://ftpmaster.internal/ubuntu resolute/main armhf whiptail armhf 0.52.25-1ubuntu2 [17.1 kB] 69s Get:65 http://ftpmaster.internal/ubuntu resolute/main armhf apparmor armhf 5.0.0~alpha1-0ubuntu8.1 [631 kB] 70s Get:66 http://ftpmaster.internal/ubuntu resolute/main armhf bind9-dnsutils armhf 1:9.20.11-1ubuntu3 [156 kB] 70s Get:67 http://ftpmaster.internal/ubuntu resolute/main armhf bind9-host armhf 1:9.20.11-1ubuntu3 [46.5 kB] 70s Get:68 http://ftpmaster.internal/ubuntu resolute/main armhf bind9-libs armhf 1:9.20.11-1ubuntu3 [1202 kB] 71s Get:69 http://ftpmaster.internal/ubuntu resolute/main armhf libdrm-common all 2.4.127-1ubuntu1 [9716 B] 71s Get:70 http://ftpmaster.internal/ubuntu resolute/main armhf libdrm2 armhf 2.4.127-1ubuntu1 [37.8 kB] 71s Get:71 http://ftpmaster.internal/ubuntu resolute/main armhf nftables armhf 1.1.5-2 [73.2 kB] 71s Get:72 http://ftpmaster.internal/ubuntu resolute/main armhf libnftables1 armhf 1.1.5-2 [329 kB] 71s Get:73 http://ftpmaster.internal/ubuntu resolute/main armhf libnl-route-3-200 armhf 3.11.0-2 [173 kB] 71s Get:74 http://ftpmaster.internal/ubuntu resolute/main armhf libnl-3-200 armhf 3.11.0-2 [51.2 kB] 71s Get:75 http://ftpmaster.internal/ubuntu resolute/main armhf libuchardet0 armhf 0.0.8-2 [74.1 kB] 71s Get:76 http://ftpmaster.internal/ubuntu resolute/main armhf nano armhf 8.6-1 [279 kB] 71s Get:77 http://ftpmaster.internal/ubuntu resolute/main armhf publicsuffix all 20251016.1743-0.1 [136 kB] 71s Get:78 http://ftpmaster.internal/ubuntu resolute/main armhf python3.13-gdbm armhf 3.13.9-1 [30.9 kB] 72s Get:79 http://ftpmaster.internal/ubuntu resolute/main armhf python3.14-gdbm armhf 3.14.0-4 [31.3 kB] 72s Get:80 http://ftpmaster.internal/ubuntu resolute/main armhf python3-gdbm armhf 3.13.9-1 [8884 B] 72s Get:81 http://ftpmaster.internal/ubuntu resolute/main armhf usb.ids all 2025.09.15-1 [224 kB] 72s Get:82 http://ftpmaster.internal/ubuntu resolute/main armhf libctf0 armhf 2.45-8ubuntu1 [75.7 kB] 72s Get:83 http://ftpmaster.internal/ubuntu resolute/main armhf libctf-nobfd0 armhf 2.45-8ubuntu1 [78.9 kB] 72s Get:84 http://ftpmaster.internal/ubuntu resolute/main armhf binutils-arm-linux-gnueabihf armhf 2.45-8ubuntu1 [1022 kB] 72s Get:85 http://ftpmaster.internal/ubuntu resolute/main armhf libbinutils armhf 2.45-8ubuntu1 [411 kB] 72s Get:86 http://ftpmaster.internal/ubuntu resolute/main armhf binutils armhf 2.45-8ubuntu1 [3234 B] 72s Get:87 http://ftpmaster.internal/ubuntu resolute/main armhf binutils-common armhf 2.45-8ubuntu1 [221 kB] 73s Get:88 http://ftpmaster.internal/ubuntu resolute/main armhf libsframe2 armhf 2.45-8ubuntu1 [13.3 kB] 73s Get:89 http://ftpmaster.internal/ubuntu resolute/main armhf cloud-init-base all 25.4~1gcb12e00e-0ubuntu1 [625 kB] 73s Get:90 http://ftpmaster.internal/ubuntu resolute/main armhf cloud-init all 25.4~1gcb12e00e-0ubuntu1 [2114 B] 73s Get:91 http://ftpmaster.internal/ubuntu resolute/main armhf python3-blinker all 1.9.0-2 [10.8 kB] 73s Get:92 http://ftpmaster.internal/ubuntu resolute/main armhf python3-jwt all 2.10.1-3 [21.1 kB] 73s Get:93 http://ftpmaster.internal/ubuntu resolute/main armhf python3-oauthlib all 3.3.1-1 [93.5 kB] 73s Get:94 http://ftpmaster.internal/ubuntu resolute/main armhf dpkg-dev all 1.22.21ubuntu4 [1088 kB] 74s Get:95 http://ftpmaster.internal/ubuntu resolute/main armhf libdpkg-perl all 1.22.21ubuntu4 [280 kB] 74s Get:96 http://ftpmaster.internal/ubuntu resolute/main armhf lto-disabled-list all 71 [12.5 kB] 74s Get:97 http://ftpmaster.internal/ubuntu resolute/main armhf libbrotli1 armhf 1.1.0-2build6 [320 kB] 74s Get:98 http://ftpmaster.internal/ubuntu resolute/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-3 [52.1 kB] 74s Get:99 http://ftpmaster.internal/ubuntu resolute/main armhf python3-more-itertools all 10.8.0-1 [63.5 kB] 74s Get:100 http://ftpmaster.internal/ubuntu resolute/main armhf python3-inflect all 7.5.0-1 [33.9 kB] 75s Get:101 http://ftpmaster.internal/ubuntu resolute/main armhf python3-lazr.uri all 1.0.6-7 [13.8 kB] 75s Get:102 http://ftpmaster.internal/ubuntu resolute/main armhf python3-markupsafe armhf 3.0.3-1 [12.1 kB] 75s Get:103 http://ftpmaster.internal/ubuntu resolute/main armhf python3-openssl all 25.1.0-1 [46.4 kB] 75s Get:104 http://ftpmaster.internal/ubuntu resolute/main armhf python3-pyparsing all 3.1.3-1 [87.0 kB] 75s Get:105 http://ftpmaster.internal/ubuntu resolute/main armhf python3-zipp all 3.23.0-1 [10.4 kB] 75s Get:106 http://ftpmaster.internal/ubuntu resolute/main armhf python3-bcrypt armhf 4.3.0-2 [251 kB] 76s Preconfiguring packages ... 76s Fetched 28.4 MB in 21s (1359 kB/s) 76s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61081 files and directories currently installed.) 76s Preparing to unpack .../base-files_14ubuntu4_armhf.deb ... 76s Unpacking base-files (14ubuntu4) over (14ubuntu3) ... 76s Setting up base-files (14ubuntu4) ... 76s Installing new version of config file /etc/issue ... 76s Installing new version of config file /etc/issue.net ... 76s Installing new version of config file /etc/lsb-release ... 78s motd-news.service is a disabled or a static unit not running, not starting it. 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61081 files and directories currently installed.) 78s Preparing to unpack .../libatomic1_15.2.0-7ubuntu1_armhf.deb ... 78s Unpacking libatomic1:armhf (15.2.0-7ubuntu1) over (15.2.0-4ubuntu4) ... 78s Preparing to unpack .../gcc-15-base_15.2.0-7ubuntu1_armhf.deb ... 78s Unpacking gcc-15-base:armhf (15.2.0-7ubuntu1) over (15.2.0-4ubuntu4) ... 78s Setting up gcc-15-base:armhf (15.2.0-7ubuntu1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61081 files and directories currently installed.) 78s Preparing to unpack .../libgcc-s1_15.2.0-7ubuntu1_armhf.deb ... 78s Unpacking libgcc-s1:armhf (15.2.0-7ubuntu1) over (15.2.0-4ubuntu4) ... 78s Setting up libgcc-s1:armhf (15.2.0-7ubuntu1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61081 files and directories currently installed.) 78s Preparing to unpack .../libstdc++6_15.2.0-7ubuntu1_armhf.deb ... 78s Unpacking libstdc++6:armhf (15.2.0-7ubuntu1) over (15.2.0-4ubuntu4) ... 78s Setting up libstdc++6:armhf (15.2.0-7ubuntu1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61081 files and directories currently installed.) 78s Preparing to unpack .../libapt-pkg7.0_3.1.11_armhf.deb ... 78s Unpacking libapt-pkg7.0:armhf (3.1.11) over (3.1.6ubuntu2) ... 78s Setting up libapt-pkg7.0:armhf (3.1.11) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 78s Preparing to unpack .../dpkg_1.22.21ubuntu4_armhf.deb ... 78s Unpacking dpkg (1.22.21ubuntu4) over (1.22.21ubuntu3) ... 79s Setting up dpkg (1.22.21ubuntu4) ... 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 79s Preparing to unpack .../archives/grep_3.12-1_armhf.deb ... 79s Unpacking grep (3.12-1) over (3.11-4build1) ... 79s Setting up grep (3.12-1) ... 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 79s Preparing to unpack .../eject_2.41.2-4ubuntu1_armhf.deb ... 79s Unpacking eject (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 79s Preparing to unpack .../fdisk_2.41.2-4ubuntu1_armhf.deb ... 79s Unpacking fdisk (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 79s Preparing to unpack .../libblkid1_2.41.2-4ubuntu1_armhf.deb ... 79s Unpacking libblkid1:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 79s Setting up libblkid1:armhf (2.41.2-4ubuntu1) ... 80s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 80s Preparing to unpack .../libmount1_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking libmount1:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Setting up libmount1:armhf (2.41.2-4ubuntu1) ... 80s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 80s Preparing to unpack .../libsmartcols1_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking libsmartcols1:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Setting up libsmartcols1:armhf (2.41.2-4ubuntu1) ... 80s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 80s Preparing to unpack .../mount_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking mount (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Preparing to unpack .../uuid-runtime_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking uuid-runtime (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Preparing to unpack .../libuuid1_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking libuuid1:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Setting up libuuid1:armhf (2.41.2-4ubuntu1) ... 80s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61082 files and directories currently installed.) 80s Preparing to unpack .../libfdisk1_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking libfdisk1:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Preparing to unpack .../bsdutils_1%3a2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking bsdutils (1:2.41.2-4ubuntu1) over (1:2.41-4ubuntu4) ... 80s Setting up bsdutils (1:2.41.2-4ubuntu1) ... 80s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61079 files and directories currently installed.) 80s Preparing to unpack .../util-linux_2.41.2-4ubuntu1_armhf.deb ... 80s Unpacking util-linux (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 80s Setting up util-linux (2.41.2-4ubuntu1) ... 81s fstrim.service is a disabled or a static unit not running, not starting it. 81s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61050 files and directories currently installed.) 81s Preparing to unpack .../bsdextrautils_2.41.2-4ubuntu1_armhf.deb ... 81s Unpacking bsdextrautils (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 81s Preparing to unpack .../libselinux1_3.8.1-1build2_armhf.deb ... 81s Unpacking libselinux1:armhf (3.8.1-1build2) over (3.8.1-1build1) ... 81s Setting up libselinux1:armhf (3.8.1-1build2) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61053 files and directories currently installed.) 82s Preparing to unpack .../libseccomp2_2.6.0-2ubuntu3_armhf.deb ... 82s Unpacking libseccomp2:armhf (2.6.0-2ubuntu3) over (2.6.0-2ubuntu2) ... 82s Setting up libseccomp2:armhf (2.6.0-2ubuntu3) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61053 files and directories currently installed.) 82s Preparing to unpack .../archives/apt_3.1.11_armhf.deb ... 82s Unpacking apt (3.1.11) over (3.1.6ubuntu2) ... 82s Setting up apt (3.1.11) ... 82s Installing new version of config file /etc/apt/apt.conf.d/01-vendor-ubuntu ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61054 files and directories currently installed.) 83s Preparing to unpack .../gnu-coreutils_9.7-3ubuntu1_armhf.deb ... 83s Unpacking gnu-coreutils (9.7-3ubuntu1) over (9.5-1ubuntu4) ... 83s Setting up gnu-coreutils (9.7-3ubuntu1) ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61049 files and directories currently installed.) 83s Preparing to unpack .../libaudit-common_1%3a4.0.5-1build2_all.deb ... 83s Unpacking libaudit-common (1:4.0.5-1build2) over (1:4.0.5-1build1) ... 83s Setting up libaudit-common (1:4.0.5-1build2) ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61049 files and directories currently installed.) 83s Preparing to unpack .../libcap-ng0_0.8.5-4build3_armhf.deb ... 83s Unpacking libcap-ng0:armhf (0.8.5-4build3) over (0.8.5-4build2) ... 83s Setting up libcap-ng0:armhf (0.8.5-4build3) ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61049 files and directories currently installed.) 83s Preparing to unpack .../libaudit1_1%3a4.0.5-1build2_armhf.deb ... 83s Unpacking libaudit1:armhf (1:4.0.5-1build2) over (1:4.0.5-1build1) ... 83s Setting up libaudit1:armhf (1:4.0.5-1build2) ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61049 files and directories currently installed.) 83s Preparing to unpack .../0-login_1%3a4.16.0-2+really2.41.2-4ubuntu1_armhf.deb ... 83s Unpacking login (1:4.16.0-2+really2.41.2-4ubuntu1) over (1:4.16.0-2+really2.41-4ubuntu4) ... 84s Preparing to unpack .../1-python3.13_3.13.9-1_armhf.deb ... 84s Unpacking python3.13 (3.13.9-1) over (3.13.7-1) ... 84s Preparing to unpack .../2-python3.13-minimal_3.13.9-1_armhf.deb ... 84s Unpacking python3.13-minimal (3.13.9-1) over (3.13.7-1) ... 84s Preparing to unpack .../3-libpython3.13-stdlib_3.13.9-1_armhf.deb ... 84s Unpacking libpython3.13-stdlib:armhf (3.13.9-1) over (3.13.7-1) ... 84s Preparing to unpack .../4-libpython3.13-minimal_3.13.9-1_armhf.deb ... 84s Unpacking libpython3.13-minimal:armhf (3.13.9-1) over (3.13.7-1) ... 84s Preparing to unpack .../5-tzdata_2025b-5ubuntu1_all.deb ... 84s Unpacking tzdata (2025b-5ubuntu1) over (2025b-3ubuntu1) ... 85s Preparing to unpack .../6-liblastlog2-2_2.41.2-4ubuntu1_armhf.deb ... 85s Unpacking liblastlog2-2:armhf (2.41.2-4ubuntu1) over (2.41-4ubuntu4) ... 85s Setting up liblastlog2-2:armhf (2.41.2-4ubuntu1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61041 files and directories currently installed.) 85s Preparing to unpack .../libsemanage-common_3.8.1-1build1_all.deb ... 85s Unpacking libsemanage-common (3.8.1-1build1) over (3.8.1-1) ... 85s Setting up libsemanage-common (3.8.1-1build1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61041 files and directories currently installed.) 85s Preparing to unpack .../libsepol2_3.9-2_armhf.deb ... 85s Unpacking libsepol2:armhf (3.9-2) over (3.8.1-1) ... 85s Setting up libsepol2:armhf (3.9-2) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61041 files and directories currently installed.) 85s Preparing to unpack .../libsemanage2_3.8.1-1build1_armhf.deb ... 85s Unpacking libsemanage2:armhf (3.8.1-1build1) over (3.8.1-1) ... 85s Setting up libsemanage2:armhf (3.8.1-1build1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61041 files and directories currently installed.) 85s Preparing to unpack .../libgpg-error-l10n_1.56-2_all.deb ... 85s Unpacking libgpg-error-l10n (1.56-2) over (1.51-4) ... 85s Preparing to unpack .../libgpg-error0_1.56-2_armhf.deb ... 85s Unpacking libgpg-error0:armhf (1.56-2) over (1.51-4) ... 85s Setting up libgpg-error0:armhf (1.56-2) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61041 files and directories currently installed.) 85s Preparing to unpack .../00-sensible-utils_0.0.26_all.deb ... 85s Unpacking sensible-utils (0.0.26) over (0.0.25) ... 85s Preparing to unpack .../01-distro-info-data_0.68_all.deb ... 85s Unpacking distro-info-data (0.68) over (0.66) ... 85s Preparing to unpack .../02-gir1.2-girepository-2.0_1.86.0-6_armhf.deb ... 85s Unpacking gir1.2-girepository-2.0:armhf (1.86.0-6) over (1.84.0-1) ... 85s Preparing to unpack .../03-gir1.2-glib-2.0_2.86.1-1_armhf.deb ... 85s Unpacking gir1.2-glib-2.0:armhf (2.86.1-1) over (2.86.0-2) ... 85s Preparing to unpack .../04-libglib2.0-0t64_2.86.1-1_armhf.deb ... 85s Unpacking libglib2.0-0t64:armhf (2.86.1-1) over (2.86.0-2) ... 86s Preparing to unpack .../05-libgirepository-1.0-1_1.86.0-6_armhf.deb ... 86s Unpacking libgirepository-1.0-1:armhf (1.86.0-6) over (1.84.0-1) ... 86s Preparing to unpack .../06-libapparmor1_5.0.0~alpha1-0ubuntu8.1_armhf.deb ... 86s Unpacking libapparmor1:armhf (5.0.0~alpha1-0ubuntu8.1) over (5.0.0~alpha1-0ubuntu8) ... 86s Preparing to unpack .../07-libelf1t64_0.193-3_armhf.deb ... 86s Unpacking libelf1t64:armhf (0.193-3) over (0.193-1) ... 86s Preparing to unpack .../08-libfribidi0_1.0.16-3_armhf.deb ... 86s Unpacking libfribidi0:armhf (1.0.16-3) over (1.0.16-1) ... 86s Preparing to unpack .../09-libglib2.0-data_2.86.1-1_all.deb ... 86s Unpacking libglib2.0-data (2.86.1-1) over (2.86.0-2) ... 86s Preparing to unpack .../10-libnettle8t64_3.10.2-1_armhf.deb ... 86s Unpacking libnettle8t64:armhf (3.10.2-1) over (3.10.1-1) ... 86s Preparing to unpack .../11-libhogweed6t64_3.10.2-1_armhf.deb ... 86s Unpacking libhogweed6t64:armhf (3.10.2-1) over (3.10.1-1) ... 86s Preparing to unpack .../12-libjson-c5_0.18+ds-1.1_armhf.deb ... 86s Unpacking libjson-c5:armhf (0.18+ds-1.1) over (0.18+ds-1) ... 86s Preparing to unpack .../13-libnewt0.52_0.52.25-1ubuntu2_armhf.deb ... 86s Unpacking libnewt0.52:armhf (0.52.25-1ubuntu2) over (0.52.25-1ubuntu1) ... 86s Preparing to unpack .../14-libp11-kit0_0.25.9-2_armhf.deb ... 86s Unpacking libp11-kit0:armhf (0.25.9-2) over (0.25.5-3ubuntu1) ... 86s Preparing to unpack .../15-libxml2-16_2.14.5+dfsg-0.2build1_armhf.deb ... 86s Unpacking libxml2-16:armhf (2.14.5+dfsg-0.2build1) over (2.14.5+dfsg-0.2) ... 86s Preparing to unpack .../16-python-apt-common_3.0.0ubuntu2_all.deb ... 86s Unpacking python-apt-common (3.0.0ubuntu2) over (3.0.0ubuntu1) ... 86s Preparing to unpack .../17-python3-apt_3.0.0ubuntu2_armhf.deb ... 87s Unpacking python3-apt (3.0.0ubuntu2) over (3.0.0ubuntu1) ... 87s Preparing to unpack .../18-python3-cffi-backend_2.0.0-2_armhf.deb ... 87s Unpacking python3-cffi-backend:armhf (2.0.0-2) over (1.17.1-3) ... 87s Preparing to unpack .../19-python3-dbus_1.4.0-1build1_armhf.deb ... 87s Unpacking python3-dbus (1.4.0-1build1) over (1.4.0-1) ... 87s Preparing to unpack .../20-python3-yaml_6.0.2-2_armhf.deb ... 87s Unpacking python3-yaml (6.0.2-2) over (6.0.2-1build2) ... 87s Preparing to unpack .../21-sudo-rs_0.2.8-1ubuntu5.1_armhf.deb ... 87s Unpacking sudo-rs (0.2.8-1ubuntu5.1) over (0.2.8-1ubuntu5) ... 87s Preparing to unpack .../22-ubuntu-pro-client-l10n_37.1ubuntu0_armhf.deb ... 87s Unpacking ubuntu-pro-client-l10n (37.1ubuntu0) over (37ubuntu0) ... 87s Preparing to unpack .../23-ubuntu-pro-client_37.1ubuntu0_armhf.deb ... 87s Unpacking ubuntu-pro-client (37.1ubuntu0) over (37ubuntu0) ... 87s Preparing to unpack .../24-whiptail_0.52.25-1ubuntu2_armhf.deb ... 87s Unpacking whiptail (0.52.25-1ubuntu2) over (0.52.25-1ubuntu1) ... 88s Preparing to unpack .../25-apparmor_5.0.0~alpha1-0ubuntu8.1_armhf.deb ... 89s Unpacking apparmor (5.0.0~alpha1-0ubuntu8.1) over (5.0.0~alpha1-0ubuntu8) ... 90s Preparing to unpack .../26-bind9-dnsutils_1%3a9.20.11-1ubuntu3_armhf.deb ... 90s Unpacking bind9-dnsutils (1:9.20.11-1ubuntu3) over (1:9.20.11-1ubuntu2) ... 90s Preparing to unpack .../27-bind9-host_1%3a9.20.11-1ubuntu3_armhf.deb ... 90s Unpacking bind9-host (1:9.20.11-1ubuntu3) over (1:9.20.11-1ubuntu2) ... 90s Preparing to unpack .../28-bind9-libs_1%3a9.20.11-1ubuntu3_armhf.deb ... 90s Unpacking bind9-libs:armhf (1:9.20.11-1ubuntu3) over (1:9.20.11-1ubuntu2) ... 91s Preparing to unpack .../29-libdrm-common_2.4.127-1ubuntu1_all.deb ... 91s Unpacking libdrm-common (2.4.127-1ubuntu1) over (2.4.125-1) ... 91s Preparing to unpack .../30-libdrm2_2.4.127-1ubuntu1_armhf.deb ... 91s Unpacking libdrm2:armhf (2.4.127-1ubuntu1) over (2.4.125-1) ... 91s Preparing to unpack .../31-nftables_1.1.5-2_armhf.deb ... 91s Unpacking nftables (1.1.5-2) over (1.1.5-1) ... 91s Preparing to unpack .../32-libnftables1_1.1.5-2_armhf.deb ... 91s Unpacking libnftables1:armhf (1.1.5-2) over (1.1.5-1) ... 91s Preparing to unpack .../33-libnl-route-3-200_3.11.0-2_armhf.deb ... 91s Unpacking libnl-route-3-200:armhf (3.11.0-2) over (3.7.0-2build1) ... 91s Preparing to unpack .../34-libnl-3-200_3.11.0-2_armhf.deb ... 91s Unpacking libnl-3-200:armhf (3.11.0-2) over (3.7.0-2build1) ... 91s Preparing to unpack .../35-libuchardet0_0.0.8-2_armhf.deb ... 91s Unpacking libuchardet0:armhf (0.0.8-2) over (0.0.8-1build1) ... 91s Preparing to unpack .../36-nano_8.6-1_armhf.deb ... 91s Unpacking nano (8.6-1) over (8.4-1) ... 91s Preparing to unpack .../37-publicsuffix_20251016.1743-0.1_all.deb ... 91s Unpacking publicsuffix (20251016.1743-0.1) over (20250328.1952-0.1) ... 91s Preparing to unpack .../38-python3.13-gdbm_3.13.9-1_armhf.deb ... 91s Unpacking python3.13-gdbm (3.13.9-1) over (3.13.7-1) ... 91s Selecting previously unselected package python3.14-gdbm. 91s Preparing to unpack .../39-python3.14-gdbm_3.14.0-4_armhf.deb ... 91s Unpacking python3.14-gdbm (3.14.0-4) ... 91s Preparing to unpack .../40-python3-gdbm_3.13.9-1_armhf.deb ... 91s Unpacking python3-gdbm:armhf (3.13.9-1) over (3.13.5-1) ... 91s Preparing to unpack .../41-usb.ids_2025.09.15-1_all.deb ... 91s Unpacking usb.ids (2025.09.15-1) over (2025.07.26-1) ... 91s Preparing to unpack .../42-libctf0_2.45-8ubuntu1_armhf.deb ... 91s Unpacking libctf0:armhf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 91s Preparing to unpack .../43-libctf-nobfd0_2.45-8ubuntu1_armhf.deb ... 91s Unpacking libctf-nobfd0:armhf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 91s Preparing to unpack .../44-binutils-arm-linux-gnueabihf_2.45-8ubuntu1_armhf.deb ... 91s Unpacking binutils-arm-linux-gnueabihf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 92s Preparing to unpack .../45-libbinutils_2.45-8ubuntu1_armhf.deb ... 92s Unpacking libbinutils:armhf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 92s Preparing to unpack .../46-binutils_2.45-8ubuntu1_armhf.deb ... 92s Unpacking binutils (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 92s Preparing to unpack .../47-binutils-common_2.45-8ubuntu1_armhf.deb ... 92s Unpacking binutils-common:armhf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 92s Preparing to unpack .../48-libsframe2_2.45-8ubuntu1_armhf.deb ... 92s Unpacking libsframe2:armhf (2.45-8ubuntu1) over (2.45-7ubuntu1) ... 92s Preparing to unpack .../49-cloud-init-base_25.4~1gcb12e00e-0ubuntu1_all.deb ... 92s Unpacking cloud-init-base (25.4~1gcb12e00e-0ubuntu1) over (25.3~2g890873f5-0ubuntu2) ... 93s Preparing to unpack .../50-cloud-init_25.4~1gcb12e00e-0ubuntu1_all.deb ... 93s Unpacking cloud-init (25.4~1gcb12e00e-0ubuntu1) over (25.3~2g890873f5-0ubuntu2) ... 93s Preparing to unpack .../51-python3-blinker_1.9.0-2_all.deb ... 93s Unpacking python3-blinker (1.9.0-2) over (1.9.0-1) ... 93s Preparing to unpack .../52-python3-jwt_2.10.1-3_all.deb ... 93s Unpacking python3-jwt (2.10.1-3) over (2.10.1-2) ... 93s Preparing to unpack .../53-python3-oauthlib_3.3.1-1_all.deb ... 93s Unpacking python3-oauthlib (3.3.1-1) over (3.2.2-3) ... 93s Preparing to unpack .../54-dpkg-dev_1.22.21ubuntu4_all.deb ... 93s Unpacking dpkg-dev (1.22.21ubuntu4) over (1.22.21ubuntu3) ... 93s Preparing to unpack .../55-libdpkg-perl_1.22.21ubuntu4_all.deb ... 93s Unpacking libdpkg-perl (1.22.21ubuntu4) over (1.22.21ubuntu3) ... 94s Preparing to unpack .../56-lto-disabled-list_71_all.deb ... 94s Unpacking lto-disabled-list (71) over (69) ... 94s Preparing to unpack .../57-libbrotli1_1.1.0-2build6_armhf.deb ... 94s Unpacking libbrotli1:armhf (1.1.0-2build6) over (1.1.0-2build5) ... 94s Preparing to unpack .../58-librtmp1_2.4+20151223.gitfa8646d.1-3_armhf.deb ... 94s Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-3) over (2.4+20151223.gitfa8646d.1-2build8) ... 94s Preparing to unpack .../59-python3-more-itertools_10.8.0-1_all.deb ... 94s Unpacking python3-more-itertools (10.8.0-1) over (10.7.0-1) ... 94s Preparing to unpack .../60-python3-inflect_7.5.0-1_all.deb ... 94s Unpacking python3-inflect (7.5.0-1) over (7.3.1-2) ... 94s Preparing to unpack .../61-python3-lazr.uri_1.0.6-7_all.deb ... 94s Unpacking python3-lazr.uri (1.0.6-7) over (1.0.6-6) ... 94s Preparing to unpack .../62-python3-markupsafe_3.0.3-1_armhf.deb ... 94s Unpacking python3-markupsafe (3.0.3-1) over (2.1.5-1build4) ... 95s Preparing to unpack .../63-python3-openssl_25.1.0-1_all.deb ... 95s Unpacking python3-openssl (25.1.0-1) over (25.0.0-1) ... 95s Preparing to unpack .../64-python3-pyparsing_3.1.3-1_all.deb ... 95s Unpacking python3-pyparsing (3.1.3-1) over (3.1.2-1) ... 95s Preparing to unpack .../65-python3-zipp_3.23.0-1_all.deb ... 95s Unpacking python3-zipp (3.23.0-1) over (3.21.0-1) ... 95s Preparing to unpack .../66-python3-bcrypt_4.3.0-2_armhf.deb ... 95s Unpacking python3-bcrypt (4.3.0-2) over (4.2.0-2.1build1) ... 95s Setting up python3-more-itertools (10.8.0-1) ... 96s Setting up lto-disabled-list (71) ... 96s Setting up libapparmor1:armhf (5.0.0~alpha1-0ubuntu8.1) ... 96s Setting up libnewt0.52:armhf (0.52.25-1ubuntu2) ... 96s Setting up libnftables1:armhf (1.1.5-2) ... 96s Setting up nftables (1.1.5-2) ... 96s Setting up bsdextrautils (2.41.2-4ubuntu1) ... 96s Setting up python3-jwt (2.10.1-3) ... 96s Setting up distro-info-data (0.68) ... 96s Setting up libxml2-16:armhf (2.14.5+dfsg-0.2build1) ... 96s Setting up libsframe2:armhf (2.45-8ubuntu1) ... 96s Setting up python3-openssl (25.1.0-1) ... 97s Setting up python3-bcrypt (4.3.0-2) ... 97s Setting up libbrotli1:armhf (1.1.0-2build6) ... 97s Setting up binutils-common:armhf (2.45-8ubuntu1) ... 97s Setting up libctf-nobfd0:armhf (2.45-8ubuntu1) ... 97s Setting up python3-yaml (6.0.2-2) ... 97s Setting up python3-lazr.uri (1.0.6-7) ... 97s Setting up python3-zipp (3.23.0-1) ... 97s Setting up python3-markupsafe (3.0.3-1) ... 97s Setting up libelf1t64:armhf (0.193-3) ... 97s Setting up tzdata (2025b-5ubuntu1) ... 97s 97s Current default time zone: 'Etc/UTC' 97s Local time is now: Sat Nov 1 10:26:55 UTC 2025. 97s Universal Time is now: Sat Nov 1 10:26:55 UTC 2025. 97s Run 'dpkg-reconfigure tzdata' if you wish to change it. 97s 97s Setting up eject (2.41.2-4ubuntu1) ... 97s Setting up libpython3.13-minimal:armhf (3.13.9-1) ... 97s Setting up apparmor (5.0.0~alpha1-0ubuntu8.1) ... 98s Installing new version of config file /etc/apparmor.d/fusermount3 ... 98s apparmor_parser: Unable to replace "lsb_release". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 98s 98s apparmor_parser: Unable to replace "kmod". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 98s 98s apparmor_parser: Unable to replace "nvidia_modprobe". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 98s 99s Reloading AppArmor profiles 99s /sbin/apparmor_parser: Unable to replace "1password". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "Discord". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "MongoDB Compass". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "balena-etcher". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "brave". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "buildah". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "cam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ch-run". /sbin/apparmor_parser: Unable to replace "bwrap". /sbin/apparmor_parser: Unable to replace "ch-checkns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "chrome". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "chromium". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "vscode". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "bfdd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "crun". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "babeld". /sbin/apparmor_parser: Unable to replace "devhelp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "bgpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "evolution". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "element-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "alsamixer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "epiphany". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "flatpak". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "firefox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "foliate". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "geary". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "github-desktop". /sbin/apparmor_parser: Unable to replace "goldendict". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "dnstracer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "fabricd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "eigrpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "fusermount3". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "dig". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "hostname". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "iotop-c". /sbin/apparmor_parser: Unable to replace "kchmviewer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "keybase". /sbin/apparmor_parser: Unable to replace "isisd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "libcamerify". /sbin/apparmor_parser: Unable to replace "lc-compliance". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "gs". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ipa_verify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "linux-sandbox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "loupe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "john". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "Xorg". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "irssi". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-attach". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-create". /sbin/apparmor_parser: Unable to replace "lsusb". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-destroy". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-execute". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-stop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-usernsexec". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lxc-unshare". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ldpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "mmdebstrap". /sbin/apparmor_parser: Unable to replace "msedge". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lsblk". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "lsb_release". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "notepadqq". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "linux-boot-prober". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "mosquitto". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "obsidian". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "opam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "mbsync". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "opera". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "compressor". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "locale". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "nhrpd". /sbin/apparmor_parser: Unable to replace "nslookup". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "notify-send". /sbin/apparmor_parser: Unable to replace "pageedit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ospf6d". /sbin/apparmor_parser: Unable to replace "kmod". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "nvidia_modprobe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "pathd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ospfd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "os-prober". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "podman". /sbin/apparmor_parser: Unable to replace "pbrd". /sbin/apparmor_parser: Unable to replace "polypane". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "privacybrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "qcam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "qmapshack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "nc.openbsd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "qutebrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "pim6d". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "plasmashell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "rootlesskit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "rssguard". /sbin/apparmor_parser: Unable to replace "rpm". /sbin/apparmor_parser: Unable to replace "pimd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ip". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "openvpn". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "runc". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-abort". /sbin/apparmor_parser: Unable to replace "sbuild". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "qpdf". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-adduser". /sbin/apparmor_parser: Unable to replace "ripd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ripngd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-apt". /sbin/apparmor_parser: Unable to replace "sbuild-clean". /sbin/apparmor_parser: Unable to replace "sbuild-checkpackages". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-createchroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-destroychroot". /sbin/apparmor_parser: Unable to replace "sbuild-distupgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-unhold". /sbin/apparmor_parser: Unable to replace "sbuild-hold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "scide". /sbin/apparmor_parser: Unable to replace "sbuild-update". /sbin/apparmor_parser: Unable to replace "slack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "signal-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-shell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "sbuild-upgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "stress-ng". /sbin/apparmor_parser: Unable to replace "slirp4netns". /sbin/apparmor_parser: Unable to replace "steam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "systemd-coredump". /sbin/apparmor_parser: Unable to replace "surfshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "thunderbird". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "proftpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "trinity". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ssh-keyscan". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "tup". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "staticd". /sbin/apparmor_parser: Unable to replace "tuxedo-control-center". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "tinyproxy". /sbin/apparmor_parser: Unable to replace "systemd-detect-virt". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "unprivileged_userns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "userbindmount". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "mx-extract". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "rygel". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_apt_news". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 99s /sbin/apparmor_parser: Unable to replace "unix-chkpwd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 99s 100s /sbin/apparmor_parser: Unable to replace "/usr/bin/man". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "uwsgi-core". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "vdens". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "virtiofsd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "vivaldi-bin". /sbin/apparmor_parser: Unable to replace "/usr/sbin/chronyd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "vpnns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "wg". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "vrrpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "rsyslogd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "dumpcap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "tshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "wpcom". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "wike". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "who". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "tcpdump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "znc". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "ip". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "wg-quick". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "cmds". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "tnftp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "transmission-cli". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "apt_methods". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 100s 100s Error: At least one profile failed to load 100s Setting up python3-inflect (7.5.0-1) ... 100s Setting up libnettle8t64:armhf (3.10.2-1) ... 100s Setting up libglib2.0-data (2.86.1-1) ... 100s Setting up python3-pyparsing (3.1.3-1) ... 100s Setting up python3.14-gdbm (3.14.0-4) ... 100s Setting up libfribidi0:armhf (1.0.16-3) ... 100s Setting up libp11-kit0:armhf (0.25.9-2) ... 100s Setting up libatomic1:armhf (15.2.0-7ubuntu1) ... 100s Setting up usb.ids (2025.09.15-1) ... 100s Setting up libdpkg-perl (1.22.21ubuntu4) ... 100s Setting up libfdisk1:armhf (2.41.2-4ubuntu1) ... 100s Setting up nano (8.6-1) ... 100s Installing new version of config file /etc/nanorc ... 100s Setting up whiptail (0.52.25-1ubuntu2) ... 100s Setting up python-apt-common (3.0.0ubuntu2) ... 100s Setting up libhogweed6t64:armhf (3.10.2-1) ... 100s Setting up mount (2.41.2-4ubuntu1) ... 100s Setting up sensible-utils (0.0.26) ... 100s Setting up uuid-runtime (2.41.2-4ubuntu1) ... 101s uuidd.service is a disabled or a static unit not running, not starting it. 101s Setting up libuchardet0:armhf (0.0.8-2) ... 101s Setting up libnl-3-200:armhf (3.11.0-2) ... 101s Setting up python3.13-minimal (3.13.9-1) ... 103s Setting up libbinutils:armhf (2.45-8ubuntu1) ... 103s Setting up libgpg-error-l10n (1.56-2) ... 103s Setting up libdrm-common (2.4.127-1ubuntu1) ... 103s Setting up libpython3.13-stdlib:armhf (3.13.9-1) ... 103s Setting up libjson-c5:armhf (0.18+ds-1.1) ... 103s Setting up publicsuffix (20251016.1743-0.1) ... 103s Setting up sudo-rs (0.2.8-1ubuntu5.1) ... 103s Setting up python3-cffi-backend:armhf (2.0.0-2) ... 103s Setting up python3.13-gdbm (3.13.9-1) ... 103s Setting up login (1:4.16.0-2+really2.41.2-4ubuntu1) ... 103s Setting up python3-blinker (1.9.0-2) ... 103s Setting up libctf0:armhf (2.45-8ubuntu1) ... 103s Setting up bind9-libs:armhf (1:9.20.11-1ubuntu3) ... 103s Setting up python3.13 (3.13.9-1) ... 103s Setting up python3-gdbm:armhf (3.13.9-1) ... 103s Setting up python3-apt (3.0.0ubuntu2) ... 103s Setting up fdisk (2.41.2-4ubuntu1) ... 103s Setting up libnl-route-3-200:armhf (3.11.0-2) ... 103s Setting up libglib2.0-0t64:armhf (2.86.1-1) ... 103s No schema files found: doing nothing. 103s Setting up python3-oauthlib (3.3.1-1) ... 104s Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-3) ... 104s Setting up gir1.2-glib-2.0:armhf (2.86.1-1) ... 104s Setting up libdrm2:armhf (2.4.127-1ubuntu1) ... 104s Setting up libgirepository-1.0-1:armhf (1.86.0-6) ... 104s Setting up bind9-host (1:9.20.11-1ubuntu3) ... 104s Setting up binutils-arm-linux-gnueabihf (2.45-8ubuntu1) ... 104s Setting up ubuntu-pro-client (37.1ubuntu0) ... 104s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 104s 104s apparmor_parser: Unable to replace "apt_methods". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 104s 104s apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 104s 105s Setting up ubuntu-pro-client-l10n (37.1ubuntu0) ... 105s Setting up python3-dbus (1.4.0-1build1) ... 105s Setting up binutils (2.45-8ubuntu1) ... 105s Setting up cloud-init-base (25.4~1gcb12e00e-0ubuntu1) ... 106s Encountered debconf setting for cloud-init-base/datasources. 107s Setting up dpkg-dev (1.22.21ubuntu4) ... 107s Setting up gir1.2-girepository-2.0:armhf (1.86.0-6) ... 107s Setting up bind9-dnsutils (1:9.20.11-1ubuntu3) ... 108s Setting up cloud-init (25.4~1gcb12e00e-0ubuntu1) ... 108s Processing triggers for rsyslog (8.2504.0-1ubuntu2) ... 109s Processing triggers for systemd (257.9-0ubuntu2) ... 109s Processing triggers for man-db (2.13.1-1) ... 111s Processing triggers for plymouth-theme-ubuntu-text (24.004.60+git20250831.4a3c171d-0ubuntu1) ... 111s Processing triggers for procps (2:4.0.4-8ubuntu3) ... 111s Processing triggers for install-info (7.1.1-1ubuntu1) ... 111s Processing triggers for libc-bin (2.42-0ubuntu3) ... 114s Reading package lists... 115s Building dependency tree... 115s Reading state information... 115s Solving dependencies... 117s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 119s autopkgtest [10:27:17]: rebooting testbed after setup commands that affected boot 158s autopkgtest [10:27:56]: testbed running kernel: Linux 6.8.0-86-generic #87~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Mon Sep 29 09:26:46 UTC 2 182s autopkgtest [10:28:20]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 196s Get:1 http://ftpmaster.internal/ubuntu resolute/universe presto 0.7.2-2 (dsc) [2258 B] 196s Get:2 http://ftpmaster.internal/ubuntu resolute/universe presto 0.7.2-2 (tar) [362 kB] 196s Get:3 http://ftpmaster.internal/ubuntu resolute/universe presto 0.7.2-2 (diff) [21.8 kB] 196s gpgv: Signature made Mon Dec 9 21:07:49 2024 UTC 196s gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 196s gpgv: issuer "tille@debian.org" 196s gpgv: Can't check signature: No public key 196s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-2.dsc: no acceptable signature found 196s autopkgtest [10:28:34]: testing package presto version 0.7.2-2 198s autopkgtest [10:28:36]: build not needed 201s autopkgtest [10:28:39]: test pybuild-autopkgtest: preparing testbed 202s Reading package lists... 203s Building dependency tree... 203s Reading state information... 203s Solving dependencies... 203s The following NEW packages will be installed: 203s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-15 203s cpp-15-arm-linux-gnueabihf cpp-arm-linux-gnueabihf debhelper debugedit 203s dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config 203s fonts-urw-base35 g++ g++-15 g++-15-arm-linux-gnueabihf 203s g++-arm-linux-gnueabihf gcc gcc-15 gcc-15-arm-linux-gnueabihf 203s gcc-arm-linux-gnueabihf gettext intltool-debian libarchive-zip-perl libasan8 203s libblas3 libc-dev-bin libc6-dev libcairo2 libcc1-0 libcrypt-dev 203s libdebhelper-perl libdeflate0 libdw1t64 libfile-stripnondeterminism-perl 203s libfontconfig1 libfontenc1 libfreetype6 libgcc-15-dev libgfortran5 libgomp1 203s libgraphite2-3 libharfbuzz0b libimagequant0 libisl23 libjbig0 libjpeg-turbo8 203s libjpeg8 liblapack3 liblcms2-2 liblerc4 libmbedcrypto16 libmbedtls21 203s libmbedx509-7 libmpc3 libopenjp2-7 libpixman-1-0 libqhull-r8.0 libraqm0 203s libsharpyuv0 libstdc++-15-dev libtiff6 libtool libubsan1 libwebp7 203s libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 203s linux-libc-dev m4 ncbi-blast+ ncbi-data po-debconf presto 203s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 203s python3-charset-normalizer python3-dateutil python3-decorator 203s python3-freetype python3-numpy python3-numpy-dev python3-packaging 203s python3-pandas python3-pandas-lib python3-pil python3-presto python3-pytz 203s python3-reportlab python3-rlpycairo python3-scipy rpcsvc-proto sgml-base 203s w3c-sgml-lib x11-common xfonts-encodings xfonts-utils xml-core 203s 0 upgraded, 107 newly installed, 0 to remove and 0 not upgraded. 203s Need to get 133 MB of archives. 203s After this operation, 463 MB of additional disk space will be used. 203s Get:1 http://ftpmaster.internal/ubuntu resolute/main armhf python3-numpy-dev armhf 1:2.2.4+ds-1ubuntu1 [141 kB] 204s Get:2 http://ftpmaster.internal/ubuntu resolute/main armhf libblas3 armhf 3.12.1-6build1 [133 kB] 204s Get:3 http://ftpmaster.internal/ubuntu resolute/main armhf libgfortran5 armhf 15.2.0-7ubuntu1 [334 kB] 204s Get:4 http://ftpmaster.internal/ubuntu resolute/main armhf liblapack3 armhf 3.12.1-6build1 [2091 kB] 206s Get:5 http://ftpmaster.internal/ubuntu resolute/main armhf python3-numpy armhf 1:2.2.4+ds-1ubuntu1 [3724 kB] 209s Get:6 http://ftpmaster.internal/ubuntu resolute/main armhf m4 armhf 1.4.20-2 [212 kB] 209s Get:7 http://ftpmaster.internal/ubuntu resolute/main armhf autoconf all 2.72-3.1ubuntu1 [384 kB] 209s Get:8 http://ftpmaster.internal/ubuntu resolute/main armhf autotools-dev all 20240727.1 [43.4 kB] 209s Get:9 http://ftpmaster.internal/ubuntu resolute/main armhf automake all 1:1.17-4ubuntu1 [572 kB] 210s Get:10 http://ftpmaster.internal/ubuntu resolute/main armhf autopoint all 0.23.1-2build2 [619 kB] 210s Get:11 http://ftpmaster.internal/ubuntu resolute/main armhf libc-dev-bin armhf 2.42-0ubuntu3 [21.8 kB] 210s Get:12 http://ftpmaster.internal/ubuntu resolute/main armhf linux-libc-dev armhf 6.17.0-5.5 [1771 kB] 211s Get:13 http://ftpmaster.internal/ubuntu resolute/main armhf libcrypt-dev armhf 1:4.4.38-1build1 [120 kB] 211s Get:14 http://ftpmaster.internal/ubuntu resolute/main armhf rpcsvc-proto armhf 1.4.3-1 [62.3 kB] 211s Get:15 http://ftpmaster.internal/ubuntu resolute/main armhf libc6-dev armhf 2.42-0ubuntu3 [1416 kB] 212s Get:16 http://ftpmaster.internal/ubuntu resolute/main armhf libisl23 armhf 0.27-1 [546 kB] 213s Get:17 http://ftpmaster.internal/ubuntu resolute/main armhf libmpc3 armhf 1.3.1-1build3 [47.2 kB] 213s Get:18 http://ftpmaster.internal/ubuntu resolute/main armhf cpp-15-arm-linux-gnueabihf armhf 15.2.0-7ubuntu1 [10.1 MB] 217s Get:19 http://ftpmaster.internal/ubuntu resolute/main armhf cpp-15 armhf 15.2.0-7ubuntu1 [1030 B] 217s Get:20 http://ftpmaster.internal/ubuntu resolute/main armhf cpp-arm-linux-gnueabihf armhf 4:15.2.0-4ubuntu1 [5756 B] 217s Get:21 http://ftpmaster.internal/ubuntu resolute/main armhf cpp armhf 4:15.2.0-4ubuntu1 [22.4 kB] 217s Get:22 http://ftpmaster.internal/ubuntu resolute/main armhf libcc1-0 armhf 15.2.0-7ubuntu1 [43.5 kB] 217s Get:23 http://ftpmaster.internal/ubuntu resolute/main armhf libgomp1 armhf 15.2.0-7ubuntu1 [129 kB] 217s Get:24 http://ftpmaster.internal/ubuntu resolute/main armhf libasan8 armhf 15.2.0-7ubuntu1 [2950 kB] 218s Get:25 http://ftpmaster.internal/ubuntu resolute/main armhf libubsan1 armhf 15.2.0-7ubuntu1 [1187 kB] 219s Get:26 http://ftpmaster.internal/ubuntu resolute/main armhf libgcc-15-dev armhf 15.2.0-7ubuntu1 [898 kB] 219s Get:27 http://ftpmaster.internal/ubuntu resolute/main armhf gcc-15-arm-linux-gnueabihf armhf 15.2.0-7ubuntu1 [19.5 MB] 225s Get:28 http://ftpmaster.internal/ubuntu resolute/main armhf gcc-15 armhf 15.2.0-7ubuntu1 [493 kB] 225s Get:29 http://ftpmaster.internal/ubuntu resolute/main armhf gcc-arm-linux-gnueabihf armhf 4:15.2.0-4ubuntu1 [1220 B] 225s Get:30 http://ftpmaster.internal/ubuntu resolute/main armhf gcc armhf 4:15.2.0-4ubuntu1 [5022 B] 225s Get:31 http://ftpmaster.internal/ubuntu resolute/main armhf libstdc++-15-dev armhf 15.2.0-7ubuntu1 [2637 kB] 226s Get:32 http://ftpmaster.internal/ubuntu resolute/main armhf g++-15-arm-linux-gnueabihf armhf 15.2.0-7ubuntu1 [11.4 MB] 229s Get:33 http://ftpmaster.internal/ubuntu resolute/main armhf g++-15 armhf 15.2.0-7ubuntu1 [23.7 kB] 229s Get:34 http://ftpmaster.internal/ubuntu resolute/main armhf g++-arm-linux-gnueabihf armhf 4:15.2.0-4ubuntu1 [968 B] 229s Get:35 http://ftpmaster.internal/ubuntu resolute/main armhf g++ armhf 4:15.2.0-4ubuntu1 [1086 B] 229s Get:36 http://ftpmaster.internal/ubuntu resolute/main armhf build-essential armhf 12.12ubuntu1 [5088 B] 229s Get:37 http://ftpmaster.internal/ubuntu resolute/universe armhf cd-hit armhf 4.8.1-4 [512 kB] 229s Get:38 http://ftpmaster.internal/ubuntu resolute/main armhf libdebhelper-perl all 13.24.2ubuntu1 [95.7 kB] 229s Get:39 http://ftpmaster.internal/ubuntu resolute/main armhf libtool all 2.5.4-4build1 [169 kB] 229s Get:40 http://ftpmaster.internal/ubuntu resolute/main armhf dh-autoreconf all 21 [12.5 kB] 229s Get:41 http://ftpmaster.internal/ubuntu resolute/main armhf libarchive-zip-perl all 1.68-1 [90.2 kB] 229s Get:42 http://ftpmaster.internal/ubuntu resolute/main armhf libfile-stripnondeterminism-perl all 1.15.0-1 [20.5 kB] 229s Get:43 http://ftpmaster.internal/ubuntu resolute/main armhf dh-strip-nondeterminism all 1.15.0-1 [5090 B] 229s Get:44 http://ftpmaster.internal/ubuntu resolute/main armhf libdw1t64 armhf 0.193-3 [253 kB] 229s Get:45 http://ftpmaster.internal/ubuntu resolute/main armhf debugedit armhf 1:5.2-3 [48.9 kB] 229s Get:46 http://ftpmaster.internal/ubuntu resolute/main armhf dwz armhf 0.16-2 [114 kB] 229s Get:47 http://ftpmaster.internal/ubuntu resolute/main armhf gettext armhf 0.23.1-2build2 [1059 kB] 230s Get:48 http://ftpmaster.internal/ubuntu resolute/main armhf intltool-debian all 0.35.0+20060710.6 [23.2 kB] 230s Get:49 http://ftpmaster.internal/ubuntu resolute/main armhf po-debconf all 1.0.21+nmu1 [233 kB] 230s Get:50 http://ftpmaster.internal/ubuntu resolute/main armhf debhelper all 13.24.2ubuntu1 [896 kB] 230s Get:51 http://ftpmaster.internal/ubuntu resolute/universe armhf dh-python all 6.20250414 [119 kB] 230s Get:52 http://ftpmaster.internal/ubuntu resolute/main armhf libfontenc1 armhf 1:1.1.8-1build1 [11.5 kB] 230s Get:53 http://ftpmaster.internal/ubuntu resolute/main armhf libfreetype6 armhf 2.13.3+dfsg-1build1 [334 kB] 230s Get:54 http://ftpmaster.internal/ubuntu resolute/main armhf x11-common all 1:7.7+24ubuntu1 [22.4 kB] 230s Get:55 http://ftpmaster.internal/ubuntu resolute/main armhf xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 230s Get:56 http://ftpmaster.internal/ubuntu resolute/main armhf xfonts-utils armhf 1:7.7+7 [90.6 kB] 230s Get:57 http://ftpmaster.internal/ubuntu resolute/main armhf fonts-urw-base35 all 20200910-8 [11.0 MB] 231s Get:58 http://ftpmaster.internal/ubuntu resolute/main armhf fontconfig-config armhf 2.15.0-2.3ubuntu1 [38.1 kB] 231s Get:59 http://ftpmaster.internal/ubuntu resolute/main armhf libfontconfig1 armhf 2.15.0-2.3ubuntu1 [114 kB] 231s Get:60 http://ftpmaster.internal/ubuntu resolute/main armhf libpixman-1-0 armhf 0.46.4-1 [196 kB] 231s Get:61 http://ftpmaster.internal/ubuntu resolute/main armhf libxcb-render0 armhf 1.17.0-2build1 [15.5 kB] 231s Get:62 http://ftpmaster.internal/ubuntu resolute/main armhf libxcb-shm0 armhf 1.17.0-2build1 [5962 B] 231s Get:63 http://ftpmaster.internal/ubuntu resolute/main armhf libxrender1 armhf 1:0.9.12-1 [16.6 kB] 231s Get:64 http://ftpmaster.internal/ubuntu resolute/main armhf libcairo2 armhf 1.18.4-1build1 [489 kB] 231s Get:65 http://ftpmaster.internal/ubuntu resolute/main armhf libdeflate0 armhf 1.23-2 [38.7 kB] 231s Get:66 http://ftpmaster.internal/ubuntu resolute/main armhf libgraphite2-3 armhf 1.3.14-2ubuntu1 [64.8 kB] 231s Get:67 http://ftpmaster.internal/ubuntu resolute/main armhf libharfbuzz0b armhf 12.1.0-1 [512 kB] 231s Get:68 http://ftpmaster.internal/ubuntu resolute/main armhf libimagequant0 armhf 2.18.0-1build1 [31.1 kB] 231s Get:69 http://ftpmaster.internal/ubuntu resolute/main armhf libjpeg-turbo8 armhf 2.1.5-4ubuntu2 [127 kB] 231s Get:70 http://ftpmaster.internal/ubuntu resolute/main armhf libjpeg8 armhf 8c-2ubuntu11 [2148 B] 231s Get:71 http://ftpmaster.internal/ubuntu resolute/main armhf liblcms2-2 armhf 2.16-2 [137 kB] 231s Get:72 http://ftpmaster.internal/ubuntu resolute/main armhf liblerc4 armhf 4.0.0+ds-5ubuntu1 [160 kB] 231s Get:73 http://ftpmaster.internal/ubuntu resolute/universe armhf libmbedcrypto16 armhf 3.6.2-3ubuntu1 [226 kB] 231s Get:74 http://ftpmaster.internal/ubuntu resolute/universe armhf libmbedx509-7 armhf 3.6.2-3ubuntu1 [30.4 kB] 231s Get:75 http://ftpmaster.internal/ubuntu resolute/universe armhf libmbedtls21 armhf 3.6.2-3ubuntu1 [116 kB] 231s Get:76 http://ftpmaster.internal/ubuntu resolute/universe armhf libqhull-r8.0 armhf 2020.2-6build1 [173 kB] 231s Get:77 http://ftpmaster.internal/ubuntu resolute/main armhf libraqm0 armhf 0.10.3-1 [12.7 kB] 231s Get:78 http://ftpmaster.internal/ubuntu resolute/main armhf libsharpyuv0 armhf 1.5.0-0.1 [16.4 kB] 231s Get:79 http://ftpmaster.internal/ubuntu resolute/main armhf libjbig0 armhf 2.1-6.1ubuntu2 [24.9 kB] 231s Get:80 http://ftpmaster.internal/ubuntu resolute/main armhf libwebp7 armhf 1.5.0-0.1 [188 kB] 231s Get:81 http://ftpmaster.internal/ubuntu resolute/main armhf libtiff6 armhf 4.7.0-3ubuntu3 [188 kB] 231s Get:82 http://ftpmaster.internal/ubuntu resolute/main armhf libwebpdemux2 armhf 1.5.0-0.1 [11.5 kB] 231s Get:83 http://ftpmaster.internal/ubuntu resolute/main armhf libwebpmux3 armhf 1.5.0-0.1 [22.4 kB] 231s Get:84 http://ftpmaster.internal/ubuntu resolute/universe armhf ncbi-data all 6.1.20170106+dfsg2-6 [3969 kB] 232s Get:85 http://ftpmaster.internal/ubuntu resolute/universe armhf ncbi-blast+ armhf 2.16.0+ds-7 [14.8 MB] 232s Get:86 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-charset-normalizer armhf 3.4.2-1 [122 kB] 232s Get:87 http://ftpmaster.internal/ubuntu resolute/main armhf libopenjp2-7 armhf 2.5.3-2.1 [174 kB] 232s Get:88 http://ftpmaster.internal/ubuntu resolute/main armhf python3-pil armhf 11.3.0-1ubuntu2 [465 kB] 232s Get:89 http://ftpmaster.internal/ubuntu resolute/main armhf python3-cairo armhf 1.27.0-2build1 [135 kB] 232s Get:90 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-freetype all 2.5.1-2 [92.2 kB] 232s Get:91 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-rlpycairo all 0.3.0-4 [9332 B] 232s Get:92 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-reportlab all 4.4.4-2 [1147 kB] 232s Get:93 http://ftpmaster.internal/ubuntu resolute/main armhf sgml-base all 1.31+nmu1 [11.0 kB] 232s Get:94 http://ftpmaster.internal/ubuntu resolute/main armhf xml-core all 0.19 [20.3 kB] 232s Get:95 http://ftpmaster.internal/ubuntu resolute/universe armhf w3c-sgml-lib all 1.3-3 [280 kB] 233s Get:96 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-biopython armhf 1.85+dfsg-4 [1692 kB] 233s Get:97 http://ftpmaster.internal/ubuntu resolute/main armhf python3-dateutil all 2.9.0-4 [80.3 kB] 233s Get:98 http://ftpmaster.internal/ubuntu resolute/main armhf python3-pytz all 2025.2-4 [32.3 kB] 233s Get:99 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-pandas-lib armhf 2.3.3+dfsg-1ubuntu1 [8020 kB] 233s Get:100 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-pandas all 2.3.3+dfsg-1ubuntu1 [2948 kB] 233s Get:101 http://ftpmaster.internal/ubuntu resolute/main armhf python3-decorator all 5.2.1-2 [28.1 kB] 233s Get:102 http://ftpmaster.internal/ubuntu resolute-proposed/universe armhf python3-scipy armhf 1.16.3-1 [18.2 MB] 236s Get:103 http://ftpmaster.internal/ubuntu resolute/main armhf python3-packaging all 25.0-1 [52.8 kB] 236s Get:104 http://ftpmaster.internal/ubuntu resolute/universe armhf python3-presto armhf 0.7.2-2 [80.8 kB] 236s Get:105 http://ftpmaster.internal/ubuntu resolute/universe armhf presto all 0.7.2-2 [240 kB] 236s Get:106 http://ftpmaster.internal/ubuntu resolute/universe armhf pybuild-plugin-autopkgtest all 6.20250414 [1746 B] 236s Get:107 http://ftpmaster.internal/ubuntu resolute/main armhf python3-all armhf 3.13.7-1 [884 B] 236s Fetched 133 MB in 32s (4193 kB/s) 236s Selecting previously unselected package python3-numpy-dev:armhf. 236s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61071 files and directories currently installed.) 236s Preparing to unpack .../000-python3-numpy-dev_1%3a2.2.4+ds-1ubuntu1_armhf.deb ... 236s Unpacking python3-numpy-dev:armhf (1:2.2.4+ds-1ubuntu1) ... 236s Selecting previously unselected package libblas3:armhf. 236s Preparing to unpack .../001-libblas3_3.12.1-6build1_armhf.deb ... 236s Unpacking libblas3:armhf (3.12.1-6build1) ... 236s Selecting previously unselected package libgfortran5:armhf. 236s Preparing to unpack .../002-libgfortran5_15.2.0-7ubuntu1_armhf.deb ... 236s Unpacking libgfortran5:armhf (15.2.0-7ubuntu1) ... 236s Selecting previously unselected package liblapack3:armhf. 236s Preparing to unpack .../003-liblapack3_3.12.1-6build1_armhf.deb ... 236s Unpacking liblapack3:armhf (3.12.1-6build1) ... 236s Selecting previously unselected package python3-numpy. 236s Preparing to unpack .../004-python3-numpy_1%3a2.2.4+ds-1ubuntu1_armhf.deb ... 236s Unpacking python3-numpy (1:2.2.4+ds-1ubuntu1) ... 236s Selecting previously unselected package m4. 236s Preparing to unpack .../005-m4_1.4.20-2_armhf.deb ... 236s Unpacking m4 (1.4.20-2) ... 236s Selecting previously unselected package autoconf. 236s Preparing to unpack .../006-autoconf_2.72-3.1ubuntu1_all.deb ... 236s Unpacking autoconf (2.72-3.1ubuntu1) ... 236s Selecting previously unselected package autotools-dev. 236s Preparing to unpack .../007-autotools-dev_20240727.1_all.deb ... 236s Unpacking autotools-dev (20240727.1) ... 236s Selecting previously unselected package automake. 236s Preparing to unpack .../008-automake_1%3a1.17-4ubuntu1_all.deb ... 236s Unpacking automake (1:1.17-4ubuntu1) ... 236s Selecting previously unselected package autopoint. 236s Preparing to unpack .../009-autopoint_0.23.1-2build2_all.deb ... 236s Unpacking autopoint (0.23.1-2build2) ... 236s Selecting previously unselected package libc-dev-bin. 236s Preparing to unpack .../010-libc-dev-bin_2.42-0ubuntu3_armhf.deb ... 236s Unpacking libc-dev-bin (2.42-0ubuntu3) ... 236s Selecting previously unselected package linux-libc-dev:armhf. 236s Preparing to unpack .../011-linux-libc-dev_6.17.0-5.5_armhf.deb ... 236s Unpacking linux-libc-dev:armhf (6.17.0-5.5) ... 236s Selecting previously unselected package libcrypt-dev:armhf. 236s Preparing to unpack .../012-libcrypt-dev_1%3a4.4.38-1build1_armhf.deb ... 236s Unpacking libcrypt-dev:armhf (1:4.4.38-1build1) ... 236s Selecting previously unselected package rpcsvc-proto. 236s Preparing to unpack .../013-rpcsvc-proto_1.4.3-1_armhf.deb ... 236s Unpacking rpcsvc-proto (1.4.3-1) ... 236s Selecting previously unselected package libc6-dev:armhf. 236s Preparing to unpack .../014-libc6-dev_2.42-0ubuntu3_armhf.deb ... 237s Unpacking libc6-dev:armhf (2.42-0ubuntu3) ... 237s Selecting previously unselected package libisl23:armhf. 237s Preparing to unpack .../015-libisl23_0.27-1_armhf.deb ... 237s Unpacking libisl23:armhf (0.27-1) ... 237s Selecting previously unselected package libmpc3:armhf. 237s Preparing to unpack .../016-libmpc3_1.3.1-1build3_armhf.deb ... 237s Unpacking libmpc3:armhf (1.3.1-1build3) ... 237s Selecting previously unselected package cpp-15-arm-linux-gnueabihf. 237s Preparing to unpack .../017-cpp-15-arm-linux-gnueabihf_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking cpp-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package cpp-15. 237s Preparing to unpack .../018-cpp-15_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking cpp-15 (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package cpp-arm-linux-gnueabihf. 237s Preparing to unpack .../019-cpp-arm-linux-gnueabihf_4%3a15.2.0-4ubuntu1_armhf.deb ... 237s Unpacking cpp-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 237s Selecting previously unselected package cpp. 237s Preparing to unpack .../020-cpp_4%3a15.2.0-4ubuntu1_armhf.deb ... 237s Unpacking cpp (4:15.2.0-4ubuntu1) ... 237s Selecting previously unselected package libcc1-0:armhf. 237s Preparing to unpack .../021-libcc1-0_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking libcc1-0:armhf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package libgomp1:armhf. 237s Preparing to unpack .../022-libgomp1_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking libgomp1:armhf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package libasan8:armhf. 237s Preparing to unpack .../023-libasan8_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking libasan8:armhf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package libubsan1:armhf. 237s Preparing to unpack .../024-libubsan1_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking libubsan1:armhf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package libgcc-15-dev:armhf. 237s Preparing to unpack .../025-libgcc-15-dev_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking libgcc-15-dev:armhf (15.2.0-7ubuntu1) ... 237s Selecting previously unselected package gcc-15-arm-linux-gnueabihf. 237s Preparing to unpack .../026-gcc-15-arm-linux-gnueabihf_15.2.0-7ubuntu1_armhf.deb ... 237s Unpacking gcc-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 238s Selecting previously unselected package gcc-15. 238s Preparing to unpack .../027-gcc-15_15.2.0-7ubuntu1_armhf.deb ... 238s Unpacking gcc-15 (15.2.0-7ubuntu1) ... 238s Selecting previously unselected package gcc-arm-linux-gnueabihf. 238s Preparing to unpack .../028-gcc-arm-linux-gnueabihf_4%3a15.2.0-4ubuntu1_armhf.deb ... 238s Unpacking gcc-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 238s Selecting previously unselected package gcc. 238s Preparing to unpack .../029-gcc_4%3a15.2.0-4ubuntu1_armhf.deb ... 238s Unpacking gcc (4:15.2.0-4ubuntu1) ... 238s Selecting previously unselected package libstdc++-15-dev:armhf. 238s Preparing to unpack .../030-libstdc++-15-dev_15.2.0-7ubuntu1_armhf.deb ... 238s Unpacking libstdc++-15-dev:armhf (15.2.0-7ubuntu1) ... 238s Selecting previously unselected package g++-15-arm-linux-gnueabihf. 238s Preparing to unpack .../031-g++-15-arm-linux-gnueabihf_15.2.0-7ubuntu1_armhf.deb ... 238s Unpacking g++-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 240s Selecting previously unselected package g++-15. 240s Preparing to unpack .../032-g++-15_15.2.0-7ubuntu1_armhf.deb ... 240s Unpacking g++-15 (15.2.0-7ubuntu1) ... 240s Selecting previously unselected package g++-arm-linux-gnueabihf. 240s Preparing to unpack .../033-g++-arm-linux-gnueabihf_4%3a15.2.0-4ubuntu1_armhf.deb ... 240s Unpacking g++-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 240s Selecting previously unselected package g++. 240s Preparing to unpack .../034-g++_4%3a15.2.0-4ubuntu1_armhf.deb ... 240s Unpacking g++ (4:15.2.0-4ubuntu1) ... 240s Selecting previously unselected package build-essential. 240s Preparing to unpack .../035-build-essential_12.12ubuntu1_armhf.deb ... 240s Unpacking build-essential (12.12ubuntu1) ... 240s Selecting previously unselected package cd-hit. 240s Preparing to unpack .../036-cd-hit_4.8.1-4_armhf.deb ... 240s Unpacking cd-hit (4.8.1-4) ... 240s Selecting previously unselected package libdebhelper-perl. 240s Preparing to unpack .../037-libdebhelper-perl_13.24.2ubuntu1_all.deb ... 240s Unpacking libdebhelper-perl (13.24.2ubuntu1) ... 240s Selecting previously unselected package libtool. 240s Preparing to unpack .../038-libtool_2.5.4-4build1_all.deb ... 240s Unpacking libtool (2.5.4-4build1) ... 240s Selecting previously unselected package dh-autoreconf. 240s Preparing to unpack .../039-dh-autoreconf_21_all.deb ... 240s Unpacking dh-autoreconf (21) ... 240s Selecting previously unselected package libarchive-zip-perl. 240s Preparing to unpack .../040-libarchive-zip-perl_1.68-1_all.deb ... 240s Unpacking libarchive-zip-perl (1.68-1) ... 240s Selecting previously unselected package libfile-stripnondeterminism-perl. 240s Preparing to unpack .../041-libfile-stripnondeterminism-perl_1.15.0-1_all.deb ... 240s Unpacking libfile-stripnondeterminism-perl (1.15.0-1) ... 240s Selecting previously unselected package dh-strip-nondeterminism. 240s Preparing to unpack .../042-dh-strip-nondeterminism_1.15.0-1_all.deb ... 240s Unpacking dh-strip-nondeterminism (1.15.0-1) ... 240s Selecting previously unselected package libdw1t64:armhf. 240s Preparing to unpack .../043-libdw1t64_0.193-3_armhf.deb ... 240s Unpacking libdw1t64:armhf (0.193-3) ... 240s Selecting previously unselected package debugedit. 240s Preparing to unpack .../044-debugedit_1%3a5.2-3_armhf.deb ... 240s Unpacking debugedit (1:5.2-3) ... 240s Selecting previously unselected package dwz. 240s Preparing to unpack .../045-dwz_0.16-2_armhf.deb ... 240s Unpacking dwz (0.16-2) ... 240s Selecting previously unselected package gettext. 240s Preparing to unpack .../046-gettext_0.23.1-2build2_armhf.deb ... 240s Unpacking gettext (0.23.1-2build2) ... 240s Selecting previously unselected package intltool-debian. 240s Preparing to unpack .../047-intltool-debian_0.35.0+20060710.6_all.deb ... 240s Unpacking intltool-debian (0.35.0+20060710.6) ... 240s Selecting previously unselected package po-debconf. 240s Preparing to unpack .../048-po-debconf_1.0.21+nmu1_all.deb ... 240s Unpacking po-debconf (1.0.21+nmu1) ... 240s Selecting previously unselected package debhelper. 240s Preparing to unpack .../049-debhelper_13.24.2ubuntu1_all.deb ... 240s Unpacking debhelper (13.24.2ubuntu1) ... 240s Selecting previously unselected package dh-python. 240s Preparing to unpack .../050-dh-python_6.20250414_all.deb ... 240s Unpacking dh-python (6.20250414) ... 240s Selecting previously unselected package libfontenc1:armhf. 240s Preparing to unpack .../051-libfontenc1_1%3a1.1.8-1build1_armhf.deb ... 240s Unpacking libfontenc1:armhf (1:1.1.8-1build1) ... 240s Selecting previously unselected package libfreetype6:armhf. 240s Preparing to unpack .../052-libfreetype6_2.13.3+dfsg-1build1_armhf.deb ... 240s Unpacking libfreetype6:armhf (2.13.3+dfsg-1build1) ... 240s Selecting previously unselected package x11-common. 240s Preparing to unpack .../053-x11-common_1%3a7.7+24ubuntu1_all.deb ... 240s Unpacking x11-common (1:7.7+24ubuntu1) ... 240s Selecting previously unselected package xfonts-encodings. 240s Preparing to unpack .../054-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 240s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 240s Selecting previously unselected package xfonts-utils. 240s Preparing to unpack .../055-xfonts-utils_1%3a7.7+7_armhf.deb ... 240s Unpacking xfonts-utils (1:7.7+7) ... 240s Selecting previously unselected package fonts-urw-base35. 240s Preparing to unpack .../056-fonts-urw-base35_20200910-8_all.deb ... 240s Unpacking fonts-urw-base35 (20200910-8) ... 240s Selecting previously unselected package fontconfig-config. 240s Preparing to unpack .../057-fontconfig-config_2.15.0-2.3ubuntu1_armhf.deb ... 240s Unpacking fontconfig-config (2.15.0-2.3ubuntu1) ... 240s Selecting previously unselected package libfontconfig1:armhf. 240s Preparing to unpack .../058-libfontconfig1_2.15.0-2.3ubuntu1_armhf.deb ... 240s Unpacking libfontconfig1:armhf (2.15.0-2.3ubuntu1) ... 240s Selecting previously unselected package libpixman-1-0:armhf. 240s Preparing to unpack .../059-libpixman-1-0_0.46.4-1_armhf.deb ... 240s Unpacking libpixman-1-0:armhf (0.46.4-1) ... 240s Selecting previously unselected package libxcb-render0:armhf. 240s Preparing to unpack .../060-libxcb-render0_1.17.0-2build1_armhf.deb ... 240s Unpacking libxcb-render0:armhf (1.17.0-2build1) ... 240s Selecting previously unselected package libxcb-shm0:armhf. 240s Preparing to unpack .../061-libxcb-shm0_1.17.0-2build1_armhf.deb ... 240s Unpacking libxcb-shm0:armhf (1.17.0-2build1) ... 240s Selecting previously unselected package libxrender1:armhf. 240s Preparing to unpack .../062-libxrender1_1%3a0.9.12-1_armhf.deb ... 240s Unpacking libxrender1:armhf (1:0.9.12-1) ... 240s Selecting previously unselected package libcairo2:armhf. 240s Preparing to unpack .../063-libcairo2_1.18.4-1build1_armhf.deb ... 240s Unpacking libcairo2:armhf (1.18.4-1build1) ... 240s Selecting previously unselected package libdeflate0:armhf. 240s Preparing to unpack .../064-libdeflate0_1.23-2_armhf.deb ... 240s Unpacking libdeflate0:armhf (1.23-2) ... 240s Selecting previously unselected package libgraphite2-3:armhf. 240s Preparing to unpack .../065-libgraphite2-3_1.3.14-2ubuntu1_armhf.deb ... 240s Unpacking libgraphite2-3:armhf (1.3.14-2ubuntu1) ... 240s Selecting previously unselected package libharfbuzz0b:armhf. 240s Preparing to unpack .../066-libharfbuzz0b_12.1.0-1_armhf.deb ... 240s Unpacking libharfbuzz0b:armhf (12.1.0-1) ... 240s Selecting previously unselected package libimagequant0:armhf. 240s Preparing to unpack .../067-libimagequant0_2.18.0-1build1_armhf.deb ... 240s Unpacking libimagequant0:armhf (2.18.0-1build1) ... 240s Selecting previously unselected package libjpeg-turbo8:armhf. 240s Preparing to unpack .../068-libjpeg-turbo8_2.1.5-4ubuntu2_armhf.deb ... 240s Unpacking libjpeg-turbo8:armhf (2.1.5-4ubuntu2) ... 240s Selecting previously unselected package libjpeg8:armhf. 240s Preparing to unpack .../069-libjpeg8_8c-2ubuntu11_armhf.deb ... 240s Unpacking libjpeg8:armhf (8c-2ubuntu11) ... 240s Selecting previously unselected package liblcms2-2:armhf. 240s Preparing to unpack .../070-liblcms2-2_2.16-2_armhf.deb ... 240s Unpacking liblcms2-2:armhf (2.16-2) ... 240s Selecting previously unselected package liblerc4:armhf. 240s Preparing to unpack .../071-liblerc4_4.0.0+ds-5ubuntu1_armhf.deb ... 240s Unpacking liblerc4:armhf (4.0.0+ds-5ubuntu1) ... 240s Selecting previously unselected package libmbedcrypto16:armhf. 241s Preparing to unpack .../072-libmbedcrypto16_3.6.2-3ubuntu1_armhf.deb ... 241s Unpacking libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 241s Selecting previously unselected package libmbedx509-7:armhf. 241s Preparing to unpack .../073-libmbedx509-7_3.6.2-3ubuntu1_armhf.deb ... 241s Unpacking libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 241s Selecting previously unselected package libmbedtls21:armhf. 241s Preparing to unpack .../074-libmbedtls21_3.6.2-3ubuntu1_armhf.deb ... 241s Unpacking libmbedtls21:armhf (3.6.2-3ubuntu1) ... 241s Selecting previously unselected package libqhull-r8.0:armhf. 241s Preparing to unpack .../075-libqhull-r8.0_2020.2-6build1_armhf.deb ... 241s Unpacking libqhull-r8.0:armhf (2020.2-6build1) ... 241s Selecting previously unselected package libraqm0:armhf. 241s Preparing to unpack .../076-libraqm0_0.10.3-1_armhf.deb ... 241s Unpacking libraqm0:armhf (0.10.3-1) ... 241s Selecting previously unselected package libsharpyuv0:armhf. 241s Preparing to unpack .../077-libsharpyuv0_1.5.0-0.1_armhf.deb ... 241s Unpacking libsharpyuv0:armhf (1.5.0-0.1) ... 241s Selecting previously unselected package libjbig0:armhf. 241s Preparing to unpack .../078-libjbig0_2.1-6.1ubuntu2_armhf.deb ... 241s Unpacking libjbig0:armhf (2.1-6.1ubuntu2) ... 241s Selecting previously unselected package libwebp7:armhf. 241s Preparing to unpack .../079-libwebp7_1.5.0-0.1_armhf.deb ... 241s Unpacking libwebp7:armhf (1.5.0-0.1) ... 241s Selecting previously unselected package libtiff6:armhf. 241s Preparing to unpack .../080-libtiff6_4.7.0-3ubuntu3_armhf.deb ... 241s Unpacking libtiff6:armhf (4.7.0-3ubuntu3) ... 241s Selecting previously unselected package libwebpdemux2:armhf. 241s Preparing to unpack .../081-libwebpdemux2_1.5.0-0.1_armhf.deb ... 241s Unpacking libwebpdemux2:armhf (1.5.0-0.1) ... 241s Selecting previously unselected package libwebpmux3:armhf. 241s Preparing to unpack .../082-libwebpmux3_1.5.0-0.1_armhf.deb ... 241s Unpacking libwebpmux3:armhf (1.5.0-0.1) ... 241s Selecting previously unselected package ncbi-data. 241s Preparing to unpack .../083-ncbi-data_6.1.20170106+dfsg2-6_all.deb ... 241s Unpacking ncbi-data (6.1.20170106+dfsg2-6) ... 241s Selecting previously unselected package ncbi-blast+. 241s Preparing to unpack .../084-ncbi-blast+_2.16.0+ds-7_armhf.deb ... 241s Unpacking ncbi-blast+ (2.16.0+ds-7) ... 242s Selecting previously unselected package python3-charset-normalizer. 242s Preparing to unpack .../085-python3-charset-normalizer_3.4.2-1_armhf.deb ... 242s Unpacking python3-charset-normalizer (3.4.2-1) ... 242s Selecting previously unselected package libopenjp2-7:armhf. 242s Preparing to unpack .../086-libopenjp2-7_2.5.3-2.1_armhf.deb ... 242s Unpacking libopenjp2-7:armhf (2.5.3-2.1) ... 242s Selecting previously unselected package python3-pil:armhf. 242s Preparing to unpack .../087-python3-pil_11.3.0-1ubuntu2_armhf.deb ... 242s Unpacking python3-pil:armhf (11.3.0-1ubuntu2) ... 242s Selecting previously unselected package python3-cairo. 242s Preparing to unpack .../088-python3-cairo_1.27.0-2build1_armhf.deb ... 242s Unpacking python3-cairo (1.27.0-2build1) ... 242s Selecting previously unselected package python3-freetype. 242s Preparing to unpack .../089-python3-freetype_2.5.1-2_all.deb ... 242s Unpacking python3-freetype (2.5.1-2) ... 242s Selecting previously unselected package python3-rlpycairo. 242s Preparing to unpack .../090-python3-rlpycairo_0.3.0-4_all.deb ... 242s Unpacking python3-rlpycairo (0.3.0-4) ... 242s Selecting previously unselected package python3-reportlab. 242s Preparing to unpack .../091-python3-reportlab_4.4.4-2_all.deb ... 242s Unpacking python3-reportlab (4.4.4-2) ... 242s Selecting previously unselected package sgml-base. 242s Preparing to unpack .../092-sgml-base_1.31+nmu1_all.deb ... 242s Unpacking sgml-base (1.31+nmu1) ... 242s Selecting previously unselected package xml-core. 242s Preparing to unpack .../093-xml-core_0.19_all.deb ... 242s Unpacking xml-core (0.19) ... 242s Selecting previously unselected package w3c-sgml-lib. 242s Preparing to unpack .../094-w3c-sgml-lib_1.3-3_all.deb ... 242s Unpacking w3c-sgml-lib (1.3-3) ... 242s Selecting previously unselected package python3-biopython. 242s Preparing to unpack .../095-python3-biopython_1.85+dfsg-4_armhf.deb ... 242s Unpacking python3-biopython (1.85+dfsg-4) ... 243s Selecting previously unselected package python3-dateutil. 243s Preparing to unpack .../096-python3-dateutil_2.9.0-4_all.deb ... 243s Unpacking python3-dateutil (2.9.0-4) ... 243s Selecting previously unselected package python3-pytz. 243s Preparing to unpack .../097-python3-pytz_2025.2-4_all.deb ... 243s Unpacking python3-pytz (2025.2-4) ... 243s Selecting previously unselected package python3-pandas-lib:armhf. 243s Preparing to unpack .../098-python3-pandas-lib_2.3.3+dfsg-1ubuntu1_armhf.deb ... 243s Unpacking python3-pandas-lib:armhf (2.3.3+dfsg-1ubuntu1) ... 243s Selecting previously unselected package python3-pandas. 243s Preparing to unpack .../099-python3-pandas_2.3.3+dfsg-1ubuntu1_all.deb ... 243s Unpacking python3-pandas (2.3.3+dfsg-1ubuntu1) ... 243s Selecting previously unselected package python3-decorator. 243s Preparing to unpack .../100-python3-decorator_5.2.1-2_all.deb ... 243s Unpacking python3-decorator (5.2.1-2) ... 244s Selecting previously unselected package python3-scipy. 244s Preparing to unpack .../101-python3-scipy_1.16.3-1_armhf.deb ... 244s Unpacking python3-scipy (1.16.3-1) ... 244s Selecting previously unselected package python3-packaging. 244s Preparing to unpack .../102-python3-packaging_25.0-1_all.deb ... 244s Unpacking python3-packaging (25.0-1) ... 244s Selecting previously unselected package python3-presto. 244s Preparing to unpack .../103-python3-presto_0.7.2-2_armhf.deb ... 244s Unpacking python3-presto (0.7.2-2) ... 244s Selecting previously unselected package presto. 244s Preparing to unpack .../104-presto_0.7.2-2_all.deb ... 244s Unpacking presto (0.7.2-2) ... 244s Selecting previously unselected package pybuild-plugin-autopkgtest. 244s Preparing to unpack .../105-pybuild-plugin-autopkgtest_6.20250414_all.deb ... 244s Unpacking pybuild-plugin-autopkgtest (6.20250414) ... 244s Selecting previously unselected package python3-all. 244s Preparing to unpack .../106-python3-all_3.13.7-1_armhf.deb ... 244s Unpacking python3-all (3.13.7-1) ... 244s Setting up dh-python (6.20250414) ... 245s Setting up libgraphite2-3:armhf (1.3.14-2ubuntu1) ... 245s Setting up liblcms2-2:armhf (2.16-2) ... 245s Setting up ncbi-data (6.1.20170106+dfsg2-6) ... 245s Setting up libpixman-1-0:armhf (0.46.4-1) ... 245s Setting up libsharpyuv0:armhf (1.5.0-0.1) ... 245s Setting up liblerc4:armhf (4.0.0+ds-5ubuntu1) ... 245s Setting up libxrender1:armhf (1:0.9.12-1) ... 245s Setting up libxcb-render0:armhf (1.17.0-2build1) ... 245s Setting up libarchive-zip-perl (1.68-1) ... 245s Setting up python3-charset-normalizer (3.4.2-1) ... 245s Setting up libdebhelper-perl (13.24.2ubuntu1) ... 245s Setting up x11-common (1:7.7+24ubuntu1) ... 245s Setting up libdeflate0:armhf (1.23-2) ... 245s Setting up linux-libc-dev:armhf (6.17.0-5.5) ... 245s Setting up m4 (1.4.20-2) ... 245s Setting up libqhull-r8.0:armhf (2020.2-6build1) ... 245s Setting up python3-all (3.13.7-1) ... 245s Setting up python3-pytz (2025.2-4) ... 245s Setting up libxcb-shm0:armhf (1.17.0-2build1) ... 245s Setting up libgomp1:armhf (15.2.0-7ubuntu1) ... 245s Setting up libjbig0:armhf (2.1-6.1ubuntu2) ... 245s Setting up libdw1t64:armhf (0.193-3) ... 245s Setting up python3-decorator (5.2.1-2) ... 245s Setting up libfontenc1:armhf (1:1.1.8-1build1) ... 245s Setting up autotools-dev (20240727.1) ... 245s Setting up libblas3:armhf (3.12.1-6build1) ... 245s update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode 245s Setting up python3-packaging (25.0-1) ... 246s Setting up rpcsvc-proto (1.4.3-1) ... 246s Setting up libfreetype6:armhf (2.13.3+dfsg-1build1) ... 246s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 246s Setting up libimagequant0:armhf (2.18.0-1build1) ... 246s Setting up libmpc3:armhf (1.3.1-1build3) ... 246s Setting up python3-numpy-dev:armhf (1:2.2.4+ds-1ubuntu1) ... 246s Setting up autopoint (0.23.1-2build2) ... 246s Setting up libjpeg-turbo8:armhf (2.1.5-4ubuntu2) ... 246s Setting up libgfortran5:armhf (15.2.0-7ubuntu1) ... 246s Setting up autoconf (2.72-3.1ubuntu1) ... 246s Setting up libwebp7:armhf (1.5.0-0.1) ... 246s Setting up libubsan1:armhf (15.2.0-7ubuntu1) ... 246s Setting up dwz (0.16-2) ... 246s Setting up libcrypt-dev:armhf (1:4.4.38-1build1) ... 246s Setting up libasan8:armhf (15.2.0-7ubuntu1) ... 246s Setting up debugedit (1:5.2-3) ... 246s Setting up libopenjp2-7:armhf (2.5.3-2.1) ... 246s Setting up libharfbuzz0b:armhf (12.1.0-1) ... 246s Setting up python3-dateutil (2.9.0-4) ... 246s Setting up sgml-base (1.31+nmu1) ... 246s Setting up libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 246s Setting up libisl23:armhf (0.27-1) ... 246s Setting up libc-dev-bin (2.42-0ubuntu3) ... 246s Setting up libwebpmux3:armhf (1.5.0-0.1) ... 246s Setting up cpp-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 246s Setting up libcc1-0:armhf (15.2.0-7ubuntu1) ... 246s Setting up cpp-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 246s Setting up cd-hit (4.8.1-4) ... 246s Setting up libjpeg8:armhf (8c-2ubuntu11) ... 246s Setting up automake (1:1.17-4ubuntu1) ... 246s update-alternatives: using /usr/bin/automake-1.17 to provide /usr/bin/automake (automake) in auto mode 246s Setting up libfile-stripnondeterminism-perl (1.15.0-1) ... 246s Setting up liblapack3:armhf (3.12.1-6build1) ... 246s update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode 246s Setting up gettext (0.23.1-2build2) ... 246s Setting up libgcc-15-dev:armhf (15.2.0-7ubuntu1) ... 246s Setting up gcc-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 246s Setting up libwebpdemux2:armhf (1.5.0-0.1) ... 246s Setting up python3-freetype (2.5.1-2) ... 246s Setting up xfonts-utils (1:7.7+7) ... 246s Setting up intltool-debian (0.35.0+20060710.6) ... 246s Setting up libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 246s Setting up libraqm0:armhf (0.10.3-1) ... 246s Setting up python3-numpy (1:2.2.4+ds-1ubuntu1) ... 249s Setting up libmbedtls21:armhf (3.6.2-3ubuntu1) ... 249s Setting up dh-strip-nondeterminism (1.15.0-1) ... 249s Setting up cpp-15 (15.2.0-7ubuntu1) ... 249s Setting up libtiff6:armhf (4.7.0-3ubuntu3) ... 249s Setting up cpp (4:15.2.0-4ubuntu1) ... 249s Setting up xml-core (0.19) ... 250s Setting up libc6-dev:armhf (2.42-0ubuntu3) ... 250s Setting up gcc-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 250s Setting up python3-scipy (1.16.3-1) ... 254s Setting up po-debconf (1.0.21+nmu1) ... 254s Setting up python3-pandas-lib:armhf (2.3.3+dfsg-1ubuntu1) ... 254s Setting up fonts-urw-base35 (20200910-8) ... 254s Setting up ncbi-blast+ (2.16.0+ds-7) ... 254s Setting up python3-pil:armhf (11.3.0-1ubuntu2) ... 254s Setting up gcc-15 (15.2.0-7ubuntu1) ... 254s Setting up libstdc++-15-dev:armhf (15.2.0-7ubuntu1) ... 254s Setting up python3-pandas (2.3.3+dfsg-1ubuntu1) ... 260s Setting up libtool (2.5.4-4build1) ... 260s Setting up fontconfig-config (2.15.0-2.3ubuntu1) ... 260s Setting up g++-15-arm-linux-gnueabihf (15.2.0-7ubuntu1) ... 260s Setting up gcc (4:15.2.0-4ubuntu1) ... 260s Setting up dh-autoreconf (21) ... 260s Setting up libfontconfig1:armhf (2.15.0-2.3ubuntu1) ... 260s Setting up g++-15 (15.2.0-7ubuntu1) ... 260s Setting up g++-arm-linux-gnueabihf (4:15.2.0-4ubuntu1) ... 260s Setting up debhelper (13.24.2ubuntu1) ... 260s Setting up libcairo2:armhf (1.18.4-1build1) ... 260s Setting up g++ (4:15.2.0-4ubuntu1) ... 260s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 261s Setting up build-essential (12.12ubuntu1) ... 261s Setting up python3-cairo (1.27.0-2build1) ... 261s Setting up pybuild-plugin-autopkgtest (6.20250414) ... 261s Setting up python3-rlpycairo (0.3.0-4) ... 261s Setting up python3-reportlab (4.4.4-2) ... 262s Processing triggers for libc-bin (2.42-0ubuntu3) ... 262s Processing triggers for man-db (2.13.1-1) ... 263s Processing triggers for install-info (7.1.1-1ubuntu1) ... 263s Processing triggers for sgml-base (1.31+nmu1) ... 263s Setting up w3c-sgml-lib (1.3-3) ... 292s Setting up python3-biopython (1.85+dfsg-4) ... 294s Setting up python3-presto (0.7.2-2) ... 294s Setting up presto (0.7.2-2) ... 304s autopkgtest [10:30:22]: test pybuild-autopkgtest: pybuild-autopkgtest 304s autopkgtest [10:30:22]: test pybuild-autopkgtest: [----------------------- 306s pybuild-autopkgtest 307s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.ntuMIw/build.KwH/src/bin /tmp/autopkgtest.ntuMIw/autopkgtest_tmp/build; rm /tmp/autopkgtest.ntuMIw/build.KwH/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 307s I: pybuild base:311: cd /tmp/autopkgtest.ntuMIw/autopkgtest_tmp/build; python3.13 -m unittest discover -v 309s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 309s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 309s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 309s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 309s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 309s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 309s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 309s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 309s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 309s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 309s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok 309s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 309s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 309s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 309s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 309s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 309s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... -> test_collapseAnnotation() 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 309s <- test_collapseAnnotation() 0.000 309s -> test_getCoordKey() 309s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 309s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 309s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 309s <- test_getCoordKey() 0.000 309s -> test_mergeAnnotation() 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 309s <- test_mergeAnnotation() 0.000 309s -> test_renameAnnotation() 309s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 309s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 309s <- test_renameAnnotation() 0.000 309s -> test_calculateSetError() 309s Frequency consensus error> 309s REF> CGGCGTAA 309s SEQ1> CGGCGTAA 309s SEQ2> CCNNGTAA 309s SEQ3> CGGC--TA 309s SEQ4> CGNN--TA 309s SEQ5> CGGC--AA 309s ERROR> 0.250000 309s Quality consensus error> 309s REF> CGGCNNAA 309s SEQ1> CGGCGTAA 309s SEQ2> CCNNGTAA 309s SEQ3> CGGC--TA 309s SEQ4> CGNN--TA 309s SEQ5> CGGC--AA 309s ERROR> 0.233333 309s <- test_calculateSetError() 0.000 309s -> test_deleteSeqPositions() 309s MAX_GAP=0.4> CGGCAA 309s MAX_GAP=0.8> CGGCGTAA 309s <- test_deleteSeqPositions() 0.000 309s -> test_findGapPositions() 309s MAX_GAP=0.4> [4, 5] 309s MAX_GAP=0.8> [] 309s <- test_findGapPositions() 0.000 309s -> test_frequencyConsensus() 309s MIN_FREQ=0.2> CGGCGTAA 309s MIN_FREQ=0.8> CGGCGTNA 309s <- test_frequencyConsensus() 0.000 309s -> test_qualityConsensus() 309s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 309s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 309s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 309s <- test_qualityConsensus() 0.000 309s -> test_checkSeqEqual() 309s DNA Equality> 309s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 309s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 309s EQUAL> True 309s 309s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 309s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 309s EQUAL> False 309s 309s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 309s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 309s EQUAL> True 309s 309s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 309s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 309s EQUAL> False 309s 309s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 309s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 309s EQUAL> True 309s 309s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 309s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 309s EQUAL> True 309s 309s <- test_checkSeqEqual() 0.000 309s -> test_convert454Header() 309s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 309s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 309s <- test_convert454Header() 0.000 309s -> test_convertGenbankHeader() 309s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 309s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 309s <- test_convertGenbankHeader() 0.000 309s -> test_convertGenericHeader() 309s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 309s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 309s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 309s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 309s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 309s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 309s <- test_convertGenericHeader() 0.000 309s -> test_convertIMGTHeader() 309s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 309s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 309s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 309s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 309s OrderedDict({'ID': 'IGHV1-18*01'}) 309s OrderedDict({'ID': 'IGHV1-69*07'}) 309s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 309s OrderedDict({'ID': 'TRAV11*01'}) 309s <- test_convertIMGTHeader() 0.000 309s -> test_convertIlluminaHeader() 309s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 309s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 309s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 309s <- test_convertIlluminaHeader() 0.000 309s -> test_convertSRAHeader() 309s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 309s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 309s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 309s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 309s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 309s <- test_convertSRAHeader() 0.000 309s -> test_calculateDistances() 309s <- test_calculateDistances() 0.002 309s -> test_countMismatches() 309s <- test_countMismatches() 0.002 309s -> test_initializeMismatchDictionary() 309s <- test_initializeMismatchDictionary() 0.000 309s -> test_getFileType() 309s <- test_getFileType() 0.000 309s -> test_extractAlignment() 309s SEQ1> 309s SEQ> CCACGTTTTAGTAATTAATA 309s ALN-SEQ> CCACGTTTTAGT 309s ALN-PR> ----GTTTTAGT 309s PRIMER> GTTTTAGT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ2> 309s SEQ> CCNCGTTTTAGTAATTAATA 309s ALN-SEQ> CCNCGTTTTAGT 309s ALN-PR> ----GTTTTAGT 309s PRIMER> GTTTTAGT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ3> 309s SEQ> GGGCGTTTTAGTAATTAATA 309s ALN-SEQ> GGGCGTTTTAGT 309s ALN-PR> ----GTTTTAGT 309s PRIMER> GTTTTAGT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ4> 309s SEQ> GGNNGTTTTACTAATTAATA 309s ALN-SEQ> GGNNGTTTTACT 309s ALN-PR> ----GTTTTACT 309s PRIMER> GTTTTACT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ5> 309s SEQ> NNGCNNNNNACTAATTAATA 309s ALN-SEQ> NNGCNNNNNACT 309s ALN-PR> ----NNNNNACT 309s PRIMER> NNNNNACT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ6> 309s SEQ> GGGATANNNACTAATTAATA 309s ALN-SEQ> GGGATANNNACT 309s ALN-PR> ----TANNNACT 309s PRIMER> TANNNACT 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ7> 309s SEQ> NNNNNNNNNNNNNNNNNNNN 309s ALN-SEQ> NNNNNNNNNNNN 309s ALN-PR> ----NNNNNNNN 309s PRIMER> NNNNNNNN 309s START> 4 309s END> 12 309s GAPS> 0 309s ERROR> 0.000000 309s 309s <- test_extractAlignment() 0.000 309s -> test_localAlignment() 309s TEST Ns> 309s SEQ1> 309s SEQ> CCACGTTTTAGTAATTAATA 309s ALN-SEQ> CCACGTTTTAGTAATTAATA 309s ALN-PR> -CACGTTTT----------- 309s PRIMER> PR1 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ2> 309s SEQ> CCNCGTTTTAGTAATTAATA 309s ALN-SEQ> CCNCGTTTTAGTAATTAATA 309s ALN-PR> -CACGTTTT----------- 309s PRIMER> PR1 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.125000 309s 309s SEQ3> 309s SEQ> GGGCGTTTTAGTAATTAATA 309s ALN-SEQ> GGGCGTTTTAGTAATTAATA 309s ALN-PR> -GGCGTTTT----------- 309s PRIMER> PR2 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ4> 309s SEQ> GGNNGTTTTACTAATTAATA 309s ALN-SEQ> GGNNGTTTTACTAATTAATA 309s ALN-PR> GGC-GTTTT----------- 309s PRIMER> PR2 309s START> 0 309s END> 9 309s GAPS> 1 309s ERROR> 0.250000 309s 309s SEQ5> 309s SEQ> NNGCNNNNNACTAATTAATA 309s ALN-SEQ> NNGCNNNNNACTAATTAATA 309s ALN-PR> ------------ANATAA-- 309s PRIMER> PR3 309s START> 12 309s END> 18 309s GAPS> 0 309s ERROR> 0.375000 309s 309s SEQ6> 309s SEQ> GGGATANNNACTAATTAATA 309s ALN-SEQ> GGGATANNNACTAATTAATA 309s ALN-PR> -GGANA-------------- 309s PRIMER> PR3 309s START> 1 309s END> 6 309s GAPS> 0 309s ERROR> 0.375000 309s 309s SEQ7> 309s SEQ> NNNNNNNNNNNNNNNNNNNN 309s ALN-SEQ> None 309s ALN-PR> None 309s PRIMER> None 309s START> None 309s END> None 309s GAPS> 0 309s ERROR> 1.000000 309s 309s TEST INDELS> 309s SEQ1> 309s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 309s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 309s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 309s PRIMER> PR1 309s START> 15 309s END> 38 309s GAPS> 0 309s ERROR> 0.083333 309s 309s SEQ2> 309s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 309s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 309s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 309s PRIMER> PR1 309s START> 14 309s END> 38 309s GAPS> 2 309s ERROR> 0.208333 309s 309s SEQ3> 309s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 309s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 309s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 309s PRIMER> PR1 309s START> 15 309s END> 38 309s GAPS> 1 309s ERROR> 0.125000 309s 309s SEQ4> 309s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 309s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 309s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 309s PRIMER> PR2 309s START> 6 309s END> 19 309s GAPS> 1 309s ERROR> 0.250000 309s 309s SEQ5> 309s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 309s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 309s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 309s PRIMER> PR2 309s START> 6 309s END> 18 309s GAPS> 0 309s ERROR> 0.166667 309s 309s SEQ6> 309s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 309s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 309s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 309s PRIMER> PR2 309s START> 0 309s END> 11 309s GAPS> 1 309s ERROR> 0.250000 309s 309s SEQ7> 309s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 309s PRIMER> PR3 309s START> 2 309s END> 15 309s GAPS> 1 309s ERROR> 0.083333 309s 309s SEQ8> 309s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 309s PRIMER> PR3 309s START> 3 309s END> 15 309s GAPS> 1 309s ERROR> 0.166667 309s 309s SEQ9> 309s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 309s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 309s PRIMER> PR3 309s START> 3 309s END> 15 309s GAPS> 1 309s ERROR> 0.333333 309s 309s SEQ10> 309s SEQ> -------------------------------------------------------------- 309s ALN-SEQ> None 309s ALN-PR> None 309s PRIMER> None 309s START> None 309s END> None 309s GAPS> 0 309s ERROR> 1.000000 309s 309s <- test_localAlignment() 0.025 309s -> test_maskSeq() 309s TEST CUT> 309s ID> SEQ|PRIMER=A|BARCODE=CCA 309s SEQ> AGTAATTAATA 309s 309s TEST MASK> 309s ID> SEQ|PRIMER=A|BARCODE=CCA 309s SEQ> NNNNNNAGTAATTAATA 309s 309s TEST TRIM> 309s ID> SEQ|PRIMER=A|BARCODE=CCA 309s SEQ> CGTTTTAGTAATTAATA 309s 309s TEST TAG> 309s ID> SEQ|PRIMER=A|BARCODE=CCA 309s SEQ> CCACGTTTTAGTAATTAATA 309s 309s <- test_maskSeq() 0.001 309s -> test_scoreAlignment() 309s SEQ1> 309s SEQ> CCACGTTTTAGTAATTAATA 309s ALN-SEQ> CCACGTTTT 309s ALN-PR> -CACGTTTT 309s PRIMER> PR1 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ2> 309s SEQ> CCNCGTTTTAGTAATTAATA 309s ALN-SEQ> CCNCGTTTT 309s ALN-PR> -CACGTTTT 309s Pok 309s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 309s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 309s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 309s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 309s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 309s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object. 309s warnings.warn( 309s ok 309s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 309s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 309s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 309s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 309s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok 309s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 309s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 309s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 309s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 309s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 309s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 309s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok 309s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok 309s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 309s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 309s 309s ---------------------------------------------------------------------- 309s Ran 38 tests in 0.061s 309s 309s OK (skipped=6) 309s RIMER> PR1 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.125000 309s 309s SEQ3> 309s SEQ> GGGCGTTTTAGTAATTAATA 309s ALN-SEQ> GGGCGTTTT 309s ALN-PR> -GGCGTTTT 309s PRIMER> PR2 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.000000 309s 309s SEQ4> 309s SEQ> GGNNGTTTTACTAATTAATA 309s ALN-SEQ> GGNNGTTTT 309s ALN-PR> -GGCGTTTT 309s PRIMER> PR2 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.250000 309s 309s SEQ5> 309s SEQ> NNGCNNNNNACTAATTAATA 309s ALN-SEQ> NNGCNNNNN 309s ALN-PR> -GGCGTTTT 309s PRIMER> PR2 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.750000 309s 309s SEQ6> 309s SEQ> GGGATANNNACTAATTAATA 309s ALN-SEQ> GGGATANNN 309s ALN-PR> -GGANATAA 309s PRIMER> PR3 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 0.375000 309s 309s SEQ7> 309s SEQ> NNNNNNNNNNNNNNNNNNNN 309s ALN-SEQ> NNNNNNNNN 309s ALN-PR> -CACGTTTT 309s PRIMER> None 309s START> 1 309s END> 9 309s GAPS> 0 309s ERROR> 1.000000 309s 309s <- test_scoreAlignment() 0.012 309s -> test_calculateSetError() 309s REF> CGGCGTAA 0.4347826086956522 309s REF> NNNNNNNN 1.0 309s <- test_calculateSetError() 0.000 309s -> test_filterQuality() 309s RESULT> True 25 309s RESULT> False 5 309s RESULT> False 0 309s <- test_filterQuality() 0.000 309s -> test_meanQuality() 309s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 309s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 309s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 309s <- test_meanQuality() 0.000 309s -> test_scoreDNA() 309s Default DNA Scores> 309s A==A> 1 309s A==T> 0 309s A==R> 1 309s U==T> 1 309s A==N> 1 309s N==A> 1 309s A==-> 0 309s -==A> 0 309s Symmetric DNA Scores> 309s A==A> 1 309s A==T> 0 309s A==R> 1 309s U==T> 1 309s A==N> 1 309s N==A> 1 309s A==-> 1 309s -==A> 1 309s Asymmetric DNA Scores> 309s A==A> 1 309s A==T> 0 309s A==R> 1 309s U==T> 1 309s A==N> 1 309s N==A> 0 309s A==-> 1 309s -==A> 0 309s <- test_scoreDNA() 0.001 309s -> test_scoreSeqPair() 309s Default DNA Scores> 309s SEQ1> CGGCGTAA 309s SEQ2> CGNNGTAG 309s SCORE> 7 309s WEIGHT> 8 309s ERROR> 0.125000 309s 309s SEQ1> CGGCGTAA 309s SEQ3> CGGC--AA 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ1> CGGCGTAA 309s SEQ4> CGNN--AG 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ1> CGGCGTAA 309s SEQ5> NNNNNNNN 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ6> NNNNNNAA 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ2> CGNNGTAG 309s SEQ3> CGGC--AA 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ2> CGNNGTAG 309s SEQ4> CGNN--AG 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ2> CGNNGTAG 309s SEQ5> NNNNNNNN 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ2> CGNNGTAG 309s SEQ6> NNNNNNAA 309s SCORE> 7 309s WEIGHT> 8 309s ERROR> 0.125000 309s 309s SEQ2> CGNNGTAG 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ2> CGNNGTAG 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ3> CGGC--AA 309s SEQ4> CGNN--AG 309s SCORE> 7 309s WEIGHT> 8 309s ERROR> 0.125000 309s 309s SEQ3> CGGC--AA 309s SEQ5> NNNNNNNN 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ6> NNNNNNAA 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ7> -------- 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ3> CGGC--AA 309s SEQ8> CG------ 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ4> CGNN--AG 309s SEQ5> NNNNNNNN 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ4> CGNN--AG 309s SEQ6> NNNNNNAA 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ4> CGNN--AG 309s SEQ7> -------- 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ4> CGNN--AG 309s SEQ8> CG------ 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ5> NNNNNNNN 309s SEQ6> NNNNNNAA 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ6> NNNNNNAA 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ6> NNNNNNAA 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ7> -------- 309s SEQ8> CG------ 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s Asymmetric DNA Scores> 309s SEQ1> CGGCGTAA 309s SEQ2> CGNNGTAG 309s SCORE> 7 309s WEIGHT> 8 309s ERROR> 0.125000 309s 309s SEQ1> CGGCGTAA 309s SEQ3> CGGC--AA 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ4> CGNN--AG 309s SCORE> 7 309s WEIGHT> 8 309s ERROR> 0.125000 309s 309s SEQ1> CGGCGTAA 309s SEQ5> NNNNNNNN 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ6> NNNNNNAA 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ7> -------- 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ8> CG------ 309s SCORE> 8 309s WEIGHT> 8 309s ERROR> 0.000000 309s 309s SEQ2> CGNNGTAG 309s SEQ3> CGGC--AA 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ2> CGNNGTAG 309s SEQ4> CGNN--AG 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ2> CGNNGTAG 309s SEQ5> NNNNNNNN 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ2> CGNNGTAG 309s SEQ6> NNNNNNAA 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ2> CGNNGTAG 309s SEQ7> -------- 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ2> CGNNGTAG 309s SEQ8> CG------ 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ4> CGNN--AG 309s SCORE> 5 309s WEIGHT> 8 309s ERROR> 0.375000 309s 309s SEQ3> CGGC--AA 309s SEQ5> NNNNNNNN 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ6> NNNNNNAA 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ7> -------- 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ3> CGGC--AA 309s SEQ8> CG------ 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ4> CGNN--AG 309s SEQ5> NNNNNNNN 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ4> CGNN--AG 309s SEQ6> NNNNNNAA 309s SCORE> 3 309s WEIGHT> 8 309s ERROR> 0.625000 309s 309s SEQ4> CGNN--AG 309s SEQ7> -------- 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ4> CGNN--AG 309s SEQ8> CG------ 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ5> NNNNNNNN 309s SEQ6> NNNNNNAA 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ8> CG------ 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ6> NNNNNNAA 309s SEQ7> -------- 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ6> NNNNNNAA 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ7> -------- 309s SEQ8> CG------ 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s Masked DNA Scores> 309s SEQ1> CGGCGTAA 309s SEQ2> CGNNGTAG 309s SCORE> 5 309s WEIGHT> 6 309s ERROR> 0.166667 309s 309s SEQ1> CGGCGTAA 309s SEQ3> CGGC--AA 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s SEQ1> CGGCGTAA 309s SEQ4> CGNN--AG 309s SCORE> 3 309s WEIGHT> 6 309s ERROR> 0.500000 309s 309s SEQ1> CGGCGTAA 309s SEQ5> NNNNNNNN 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ6> NNNNNNAA 309s SCORE> 2 309s WEIGHT> 2 309s ERROR> 0.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 8 309s ERROR> 1.000000 309s 309s SEQ1> CGGCGTAA 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ2> CGNNGTAG 309s SEQ3> CGGC--AA 309s SCORE> 3 309s WEIGHT> 6 309s ERROR> 0.500000 309s 309s SEQ2> CGNNGTAG 309s SEQ4> CGNN--AG 309s SCORE> 4 309s WEIGHT> 6 309s ERROR> 0.333333 309s 309s SEQ2> CGNNGTAG 309s SEQ5> NNNNNNNN 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ2> CGNNGTAG 309s SEQ6> NNNNNNAA 309s SCORE> 1 309s WEIGHT> 2 309s ERROR> 0.500000 309s 309s SEQ2> CGNNGTAG 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 6 309s ERROR> 1.000000 309s 309s SEQ2> CGNNGTAG 309s SEQ8> CG------ 309s SCORE> 2 309s WEIGHT> 6 309s ERROR> 0.666667 309s 309s SEQ3> CGGC--AA 309s SEQ4> CGNN--AG 309s SCORE> 5 309s WEIGHT> 6 309s ERROR> 0.166667 309s 309s SEQ3> CGGC--AA 309s SEQ5> NNNNNNNN 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ3> CGGC--AA 309s SEQ6> NNNNNNAA 309s SCORE> 2 309s WEIGHT> 2 309s ERROR> 0.000000 309s 309s SEQ3> CGGC--AA 309s SEQ7> -------- 309s SCORE> 2 309s WEIGHT> 8 309s ERROR> 0.750000 309s 309s SEQ3> CGGC--AA 309s SEQ8> CG------ 309s SCORE> 4 309s WEIGHT> 8 309s ERROR> 0.500000 309s 309s SEQ4> CGNN--AG 309s SEQ5> NNNNNNNN 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ4> CGNN--AG 309s SEQ6> NNNNNNAA 309s SCORE> 1 309s WEIGHT> 2 309s ERROR> 0.500000 309s 309s SEQ4> CGNN--AG 309s SEQ7> -------- 309s SCORE> 2 309s WEIGHT> 6 309s ERROR> 0.666667 309s 309s SEQ4> CGNN--AG 309s SEQ8> CG------ 309s SCORE> 4 309s WEIGHT> 6 309s ERROR> 0.333333 309s 309s SEQ5> NNNNNNNN 309s SEQ6> NNNNNNAA 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ5> NNNNNNNN 309s SEQ8> CG------ 309s SCORE> 0 309s WEIGHT> 0 309s ERROR> 1.000000 309s 309s SEQ6> NNNNNNAA 309s SEQ7> -------- 309s SCORE> 0 309s WEIGHT> 2 309s ERROR> 1.000000 309s 309s SEQ6> NNNNNNAA 309s SEQ8> CG------ 309s SCORE> 0 309s WEIGHT> 2 309s ERROR> 1.000000 309s 309s SEQ7> -------- 309s SEQ8> CG------ 309s SCORE> 6 309s WEIGHT> 8 309s ERROR> 0.250000 309s 309s <- test_scoreSeqPair() 0.009 309s -> test_weightDNA() 309s DNA Weight> 309s SEQ1> 8 309s SEQ2> 6 309s SEQ3> 8 309s SEQ4> 6 309s SEQ5> 0 309s SEQ6> 2 309s SEQ7> 8 309s SEQ8> 8 309s AA Weight> 309s SEQ1> 8 309s SEQ2> 6 309s SEQ3> 8 309s SEQ4> 6 309s <- test_weightDNA() 0.000 309s -> test_consensusUnify() 309s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 309s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 309s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 309s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 309s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 309s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 309s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 309s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 309s <- test_consensusUnify() 0.001 309s -> test_deletionUnify() 309s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 309s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 309s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 309s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 309s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 309s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 309s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 309s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 309s <- test_deletionUnify() 0.000 309s autopkgtest [10:30:27]: test pybuild-autopkgtest: -----------------------] 313s autopkgtest [10:30:31]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 313s pybuild-autopkgtest PASS 317s autopkgtest [10:30:35]: @@@@@@@@@@@@@@@@@@@@ summary 317s pybuild-autopkgtest PASS