0s autopkgtest [23:01:27]: starting date and time: 2025-05-04 23:01:27+0000
  0s autopkgtest [23:01:27]: git checkout: 9986aa8c Merge branch 'skia/fix_network_interface' into 'ubuntu/production'
  0s autopkgtest [23:01:27]: host juju-7f2275-prod-proposed-migration-environment-23; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.zb_kpz8o/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:libzstd --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=libzstd/1.5.7+dfsg-1 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-ppc64el --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-23@bos03-ppc64el-4.secgroup --name adt-questing-ppc64el-ncbi-blast+-20250504-230127-juju-7f2275-prod-proposed-migration-environment-23-ac626ccf-f8f7-4a37-ad24-b216f4eb789c --image adt/ubuntu-questing-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-23 --net-id=net_prod-proposed-migration-ppc64el -e TERM=linux --mirror=http://ftpmaster.internal/ubuntu/
 79s autopkgtest [23:02:46]: testbed dpkg architecture: ppc64el
 79s autopkgtest [23:02:46]: testbed apt version: 3.0.0
 80s autopkgtest [23:02:47]: @@@@@@@@@@@@@@@@@@@@ test bed setup
 80s autopkgtest [23:02:47]: testbed release detected to be: None
 81s autopkgtest [23:02:48]: updating testbed package index (apt update)
 81s Get:1 http://ftpmaster.internal/ubuntu questing-proposed InRelease [110 kB]
 81s Hit:2 http://ftpmaster.internal/ubuntu questing InRelease
 81s Hit:3 http://ftpmaster.internal/ubuntu questing-updates InRelease
 81s Hit:4 http://ftpmaster.internal/ubuntu questing-security InRelease
 82s Get:5 http://ftpmaster.internal/ubuntu questing-proposed/universe Sources [1078 kB]
 82s Get:6 http://ftpmaster.internal/ubuntu questing-proposed/main Sources [110 kB]
 82s Get:7 http://ftpmaster.internal/ubuntu questing-proposed/multiverse Sources [33.2 kB]
 82s Get:8 http://ftpmaster.internal/ubuntu questing-proposed/main ppc64el Packages [148 kB]
 82s Get:9 http://ftpmaster.internal/ubuntu questing-proposed/universe ppc64el Packages [1052 kB]
 82s Get:10 http://ftpmaster.internal/ubuntu questing-proposed/multiverse ppc64el Packages [31.0 kB]
 82s Fetched 2562 kB in 1s (2120 kB/s)
 83s Reading package lists...
 84s autopkgtest [23:02:51]: upgrading testbed (apt dist-upgrade and autopurge)
 84s Reading package lists...
 84s Building dependency tree...
 84s Reading state information...
 84s Calculating upgrade...Starting pkgProblemResolver with broken count: 0
 85s Starting 2 pkgProblemResolver with broken count: 0
 85s Done
 85s Entering ResolveByKeep
 85s 
 85s Calculating upgrade...
 86s The following packages will be upgraded:
 86s   base-passwd ethtool libbpf1 libevdev2 libmm-glib0 libnghttp2-14
 86s   libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 libunistring5
 86s   libusb-1.0-0 libzstd1 man-db patch publicsuffix usbutils zstd
 86s 17 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
 86s Need to get 10.2 MB of archives.
 86s After this operation, 64.5 kB disk space will be freed.
 86s Get:1 http://ftpmaster.internal/ubuntu questing/main ppc64el base-passwd ppc64el 3.6.7 [55.8 kB]
 86s Get:2 http://ftpmaster.internal/ubuntu questing-proposed/main ppc64el libzstd1 ppc64el 1.5.7+dfsg-1 [410 kB]
 86s Get:3 http://ftpmaster.internal/ubuntu questing/main ppc64el libbpf1 ppc64el 1:1.5.0-3 [231 kB]
 86s Get:4 http://ftpmaster.internal/ubuntu questing/main ppc64el libunistring5 ppc64el 1.3-2 [627 kB]
 86s Get:5 http://ftpmaster.internal/ubuntu questing/main ppc64el ethtool ppc64el 1:6.14-2 [294 kB]
 86s Get:6 http://ftpmaster.internal/ubuntu questing/main ppc64el libevdev2 ppc64el 1.13.4+dfsg-1 [38.0 kB]
 86s Get:7 http://ftpmaster.internal/ubuntu questing/main ppc64el libnghttp2-14 ppc64el 1.64.0-1.1 [89.7 kB]
 86s Get:8 http://ftpmaster.internal/ubuntu questing/main ppc64el libusb-1.0-0 ppc64el 2:1.0.28-1 [64.4 kB]
 86s Get:9 http://ftpmaster.internal/ubuntu questing/main ppc64el man-db ppc64el 2.13.1-1 [1409 kB]
 86s Get:10 http://ftpmaster.internal/ubuntu questing/main ppc64el publicsuffix all 20250328.1952-0.1 [135 kB]
 86s Get:11 http://ftpmaster.internal/ubuntu questing/main ppc64el usbutils ppc64el 1:018-2 [90.0 kB]
 86s Get:12 http://ftpmaster.internal/ubuntu questing/main ppc64el libmm-glib0 ppc64el 1.24.0-1 [290 kB]
 86s Get:13 http://ftpmaster.internal/ubuntu questing-proposed/universe ppc64el libpython3.12t64 ppc64el 3.12.10-1 [2558 kB]
 87s Get:14 http://ftpmaster.internal/ubuntu questing-proposed/universe ppc64el libpython3.12-stdlib ppc64el 3.12.10-1 [2105 kB]
 87s Get:15 http://ftpmaster.internal/ubuntu questing-proposed/universe ppc64el libpython3.12-minimal ppc64el 3.12.10-1 [841 kB]
 87s Get:16 http://ftpmaster.internal/ubuntu questing/main ppc64el patch ppc64el 2.8-1 [110 kB]
 87s Get:17 http://ftpmaster.internal/ubuntu questing-proposed/main ppc64el zstd ppc64el 1.5.7+dfsg-1 [811 kB]
 87s Preconfiguring packages ...
 87s Fetched 10.2 MB in 1s (7327 kB/s)
 88s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 107204 files and directories currently installed.)
 88s Preparing to unpack .../base-passwd_3.6.7_ppc64el.deb ...
 88s Unpacking base-passwd (3.6.7) over (3.6.6) ...
 88s Setting up base-passwd (3.6.7) ...
 88s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 107204 files and directories currently installed.)
 88s Preparing to unpack .../libzstd1_1.5.7+dfsg-1_ppc64el.deb ...
 88s Unpacking libzstd1:ppc64el (1.5.7+dfsg-1) over (1.5.6+dfsg-2) ...
 88s Setting up libzstd1:ppc64el (1.5.7+dfsg-1) ...
 88s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 107204 files and directories currently installed.)
 88s Preparing to unpack .../00-libbpf1_1%3a1.5.0-3_ppc64el.deb ...
 88s Unpacking libbpf1:ppc64el (1:1.5.0-3) over (1:1.5.0-2) ...
 88s Preparing to unpack .../01-libunistring5_1.3-2_ppc64el.deb ...
 88s Unpacking libunistring5:ppc64el (1.3-2) over (1.3-1) ...
 88s Preparing to unpack .../02-ethtool_1%3a6.14-2_ppc64el.deb ...
 88s Unpacking ethtool (1:6.14-2) over (1:6.11-1) ...
 88s Preparing to unpack .../03-libevdev2_1.13.4+dfsg-1_ppc64el.deb ...
 88s Unpacking libevdev2:ppc64el (1.13.4+dfsg-1) over (1.13.3+dfsg-1) ...
 88s Preparing to unpack .../04-libnghttp2-14_1.64.0-1.1_ppc64el.deb ...
 88s Unpacking libnghttp2-14:ppc64el (1.64.0-1.1) over (1.64.0-1ubuntu1) ...
 88s Preparing to unpack .../05-libusb-1.0-0_2%3a1.0.28-1_ppc64el.deb ...
 88s Unpacking libusb-1.0-0:ppc64el (2:1.0.28-1) over (2:1.0.27-2) ...
 88s Preparing to unpack .../06-man-db_2.13.1-1_ppc64el.deb ...
 88s Unpacking man-db (2.13.1-1) over (2.13.0-1) ...
 88s Preparing to unpack .../07-publicsuffix_20250328.1952-0.1_all.deb ...
 88s Unpacking publicsuffix (20250328.1952-0.1) over (20250108.1153-0.1) ...
 88s Preparing to unpack .../08-usbutils_1%3a018-2_ppc64el.deb ...
 88s Unpacking usbutils (1:018-2) over (1:018-1) ...
 88s Preparing to unpack .../09-libmm-glib0_1.24.0-1_ppc64el.deb ...
 88s Unpacking libmm-glib0:ppc64el (1.24.0-1) over (1.23.4-0ubuntu3) ...
 88s Preparing to unpack .../10-libpython3.12t64_3.12.10-1_ppc64el.deb ...
 88s Unpacking libpython3.12t64:ppc64el (3.12.10-1) over (3.12.8-3) ...
 88s Preparing to unpack .../11-libpython3.12-stdlib_3.12.10-1_ppc64el.deb ...
 89s Unpacking libpython3.12-stdlib:ppc64el (3.12.10-1) over (3.12.8-3) ...
 89s Preparing to unpack .../12-libpython3.12-minimal_3.12.10-1_ppc64el.deb ...
 89s Unpacking libpython3.12-minimal:ppc64el (3.12.10-1) over (3.12.8-3) ...
 89s Preparing to unpack .../13-patch_2.8-1_ppc64el.deb ...
 89s Unpacking patch (2.8-1) over (2.7.6-7build3) ...
 89s Preparing to unpack .../14-zstd_1.5.7+dfsg-1_ppc64el.deb ...
 89s Unpacking zstd (1.5.7+dfsg-1) over (1.5.6+dfsg-2) ...
 89s Setting up libpython3.12-minimal:ppc64el (3.12.10-1) ...
 89s Setting up libnghttp2-14:ppc64el (1.64.0-1.1) ...
 89s Setting up man-db (2.13.1-1) ...
 89s Updating database of manual pages ...
 92s man-db.service is a disabled or a static unit not running, not starting it.
 92s Setting up libunistring5:ppc64el (1.3-2) ...
 92s Setting up patch (2.8-1) ...
 92s Setting up libmm-glib0:ppc64el (1.24.0-1) ...
 92s Setting up libusb-1.0-0:ppc64el (2:1.0.28-1) ...
 92s Setting up libevdev2:ppc64el (1.13.4+dfsg-1) ...
 92s Setting up publicsuffix (20250328.1952-0.1) ...
 92s Setting up zstd (1.5.7+dfsg-1) ...
 92s Setting up libbpf1:ppc64el (1:1.5.0-3) ...
 92s Setting up ethtool (1:6.14-2) ...
 92s Setting up libpython3.12-stdlib:ppc64el (3.12.10-1) ...
 92s Setting up usbutils (1:018-2) ...
 92s Setting up libpython3.12t64:ppc64el (3.12.10-1) ...
 92s Processing triggers for libc-bin (2.41-6ubuntu1) ...
 92s Reading package lists...
 92s Building dependency tree...
 92s Reading state information...
 93s Starting pkgProblemResolver with broken count: 0
 93s Starting 2 pkgProblemResolver with broken count: 0
 93s Done
 93s Solving dependencies...
 93s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
 93s autopkgtest [23:03:00]: rebooting testbed after setup commands that affected boot
127s autopkgtest [23:03:34]: testbed running kernel: Linux 6.14.0-15-generic #15-Ubuntu SMP Sun Apr  6 14:52:42 UTC 2025
130s autopkgtest [23:03:37]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+
133s Get:1 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (dsc) [2401 B]
133s Get:2 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (tar) [18.4 MB]
133s Get:3 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (diff) [40.8 kB]
133s gpgv: Signature made Thu Nov 21 15:47:04 2024 UTC
133s gpgv:                using RSA key 4D0BE12F0E4776D8AACE9696E66C775AEBFE6C7D
133s gpgv: Can't check signature: No public key
133s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6build1.dsc: no acceptable signature found
135s autopkgtest [23:03:42]: testing package ncbi-blast+ version 2.16.0+ds-6build1
135s autopkgtest [23:03:42]: build not needed
140s autopkgtest [23:03:47]: test run-unit-test: preparing testbed
140s Reading package lists...
141s Building dependency tree...
141s Reading state information...
141s Starting pkgProblemResolver with broken count: 0
141s Starting 2 pkgProblemResolver with broken count: 0
141s Done
141s The following NEW packages will be installed:
141s   libgomp1 libmbedcrypto16 libmbedtls21 libmbedx509-7 ncbi-blast+
141s   ncbi-blast+-legacy ncbi-data
141s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded.
141s Need to get 20.7 MB of archives.
141s After this operation, 100 MB of additional disk space will be used.
141s Get:1 http://ftpmaster.internal/ubuntu questing/main ppc64el libgomp1 ppc64el 15-20250404-0ubuntu1 [168 kB]
142s Get:2 http://ftpmaster.internal/ubuntu questing/universe ppc64el libmbedcrypto16 ppc64el 3.6.2-3ubuntu1 [293 kB]
142s Get:3 http://ftpmaster.internal/ubuntu questing/universe ppc64el libmbedx509-7 ppc64el 3.6.2-3ubuntu1 [40.1 kB]
142s Get:4 http://ftpmaster.internal/ubuntu questing/universe ppc64el libmbedtls21 ppc64el 3.6.2-3ubuntu1 [135 kB]
142s Get:5 http://ftpmaster.internal/ubuntu questing/universe ppc64el ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB]
142s Get:6 http://ftpmaster.internal/ubuntu questing/universe ppc64el ncbi-blast+ ppc64el 2.16.0+ds-6build1 [16.1 MB]
144s Get:7 http://ftpmaster.internal/ubuntu questing/universe ppc64el ncbi-blast+-legacy all 2.16.0+ds-6build1 [4984 B]
144s Fetched 20.7 MB in 2s (9047 kB/s)
144s Selecting previously unselected package libgomp1:ppc64el.
144s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 107214 files and directories currently installed.)
144s Preparing to unpack .../0-libgomp1_15-20250404-0ubuntu1_ppc64el.deb ...
144s Unpacking libgomp1:ppc64el (15-20250404-0ubuntu1) ...
144s Selecting previously unselected package libmbedcrypto16:ppc64el.
144s Preparing to unpack .../1-libmbedcrypto16_3.6.2-3ubuntu1_ppc64el.deb ...
144s Unpacking libmbedcrypto16:ppc64el (3.6.2-3ubuntu1) ...
144s Selecting previously unselected package libmbedx509-7:ppc64el.
144s Preparing to unpack .../2-libmbedx509-7_3.6.2-3ubuntu1_ppc64el.deb ...
144s Unpacking libmbedx509-7:ppc64el (3.6.2-3ubuntu1) ...
144s Selecting previously unselected package libmbedtls21:ppc64el.
144s Preparing to unpack .../3-libmbedtls21_3.6.2-3ubuntu1_ppc64el.deb ...
144s Unpacking libmbedtls21:ppc64el (3.6.2-3ubuntu1) ...
144s Selecting previously unselected package ncbi-data.
144s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ...
144s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ...
144s Selecting previously unselected package ncbi-blast+.
144s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6build1_ppc64el.deb ...
144s Unpacking ncbi-blast+ (2.16.0+ds-6build1) ...
145s Selecting previously unselected package ncbi-blast+-legacy.
145s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6build1_all.deb ...
145s Unpacking ncbi-blast+-legacy (2.16.0+ds-6build1) ...
145s Setting up ncbi-data (6.1.20170106+dfsg2-5) ...
145s Setting up libgomp1:ppc64el (15-20250404-0ubuntu1) ...
145s Setting up libmbedcrypto16:ppc64el (3.6.2-3ubuntu1) ...
145s Setting up libmbedx509-7:ppc64el (3.6.2-3ubuntu1) ...
145s Setting up libmbedtls21:ppc64el (3.6.2-3ubuntu1) ...
145s Setting up ncbi-blast+ (2.16.0+ds-6build1) ...
145s Setting up ncbi-blast+-legacy (2.16.0+ds-6build1) ...
145s Processing triggers for man-db (2.13.1-1) ...
145s Processing triggers for libc-bin (2.41-6ubuntu1) ...
147s autopkgtest [23:03:54]: test run-unit-test: [-----------------------
147s ---Creating Database--
147s 
147s 
147s Building a new DB, current time: 05/04/2025 23:03:54
147s New DB name:   /tmp/autopkgtest.HeCEGh/autopkgtest_tmp/testdb
147s New DB title:  testdatabase.fa
147s Sequence type: Nucleotide
147s Keep MBits: T
147s Maximum file size: 3000000000B
147s Adding sequences from FASTA; added 3 sequences in 0.198625 seconds.
147s 
147s 
147s ---Searching Database for Hits---
147s Warning: [blastn] Examining 5 or more matches is recommended
147s # BLASTN 2.16.0+
147s # Query: gnl|MYDB|1 this is sequence 1
147s # Database: testdb
147s # Fields: query id, subject id, evalue, bit score
147s # 2 hits found
147s gnl|MYDB|1	gnl2	0.0	1299
147s gnl|MYDB|1	gnl1	0.0	1299
147s # BLAST processed 1 queries
147s ---Search and Fetch An Entry From Database---
147s >gnl1 
147s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG
147s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA
147s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT
147s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG
147s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT
147s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG
147s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT
147s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT
147s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA
147s PASS
148s autopkgtest [23:03:55]: test run-unit-test: -----------------------]
148s run-unit-test        PASS
148s autopkgtest [23:03:55]: test run-unit-test:  - - - - - - - - - - results - - - - - - - - - -
149s autopkgtest [23:03:56]: @@@@@@@@@@@@@@@@@@@@ summary
149s run-unit-test        PASS
165s nova [W] Using flock in prodstack6-ppc64el
165s Creating nova instance adt-questing-ppc64el-ncbi-blast+-20250504-230127-juju-7f2275-prod-proposed-migration-environment-23-ac626ccf-f8f7-4a37-ad24-b216f4eb789c from image adt/ubuntu-questing-ppc64el-server-20250504.img (UUID 65e029e2-4bd9-4b30-b646-f26a73cdeb97)...
165s nova [W] Timed out waiting for f45ba0f7-2d1b-4d85-8cb8-71fa31d10af7 to get deleted.