0s autopkgtest [20:39:13]: starting date and time: 2025-05-04 20:39:13+0000 0s autopkgtest [20:39:13]: git checkout: 9986aa8c Merge branch 'skia/fix_network_interface' into 'ubuntu/production' 0s autopkgtest [20:39:13]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.qajoym1o/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,localhost,localdomain,internal,login.ubuntu.com,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:sqlite3 --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=sqlite3/3.46.1-4 -- lxd -r lxd-armhf-10.145.243.171 lxd-armhf-10.145.243.171:autopkgtest/ubuntu/questing/armhf 19s autopkgtest [20:39:32]: testbed dpkg architecture: armhf 21s autopkgtest [20:39:34]: testbed apt version: 3.0.0 25s autopkgtest [20:39:38]: @@@@@@@@@@@@@@@@@@@@ test bed setup 27s autopkgtest [20:39:40]: testbed release detected to be: None 34s autopkgtest [20:39:47]: updating testbed package index (apt update) 36s Get:1 http://ftpmaster.internal/ubuntu questing-proposed InRelease [110 kB] 36s Get:2 http://ftpmaster.internal/ubuntu questing InRelease [110 kB] 36s Get:3 http://ftpmaster.internal/ubuntu questing-updates InRelease [110 kB] 36s Get:4 http://ftpmaster.internal/ubuntu questing-security InRelease [110 kB] 36s Get:5 http://ftpmaster.internal/ubuntu questing-proposed/main Sources [111 kB] 36s Get:6 http://ftpmaster.internal/ubuntu questing-proposed/universe Sources [1095 kB] 37s Get:7 http://ftpmaster.internal/ubuntu questing-proposed/multiverse Sources [33.9 kB] 37s Get:8 http://ftpmaster.internal/ubuntu questing-proposed/main armhf Packages [132 kB] 37s Get:9 http://ftpmaster.internal/ubuntu questing-proposed/universe armhf Packages [1019 kB] 37s Get:10 http://ftpmaster.internal/ubuntu questing-proposed/multiverse armhf Packages [28.4 kB] 37s Get:11 http://ftpmaster.internal/ubuntu questing/main Sources [1395 kB] 37s Get:12 http://ftpmaster.internal/ubuntu questing/universe Sources [21.3 MB] 37s Get:13 http://ftpmaster.internal/ubuntu questing/multiverse Sources [306 kB] 37s Get:14 http://ftpmaster.internal/ubuntu questing/main armhf Packages [1358 kB] 37s Get:15 http://ftpmaster.internal/ubuntu questing/universe armhf Packages [15.3 MB] 38s Get:16 http://ftpmaster.internal/ubuntu questing/multiverse armhf Packages [180 kB] 41s Fetched 42.7 MB in 5s (8182 kB/s) 42s Reading package lists... 48s autopkgtest [20:40:01]: upgrading testbed (apt dist-upgrade and autopurge) 50s Reading package lists... 50s Building dependency tree... 50s Reading state information... 51s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 51s Starting 2 pkgProblemResolver with broken count: 0 51s Done 52s Entering ResolveByKeep 52s 52s Calculating upgrade... 53s The following packages will be upgraded: 53s base-files base-passwd cloud-init cloud-init-base debianutils 53s distro-info-data dpkg dpkg-dev ed ethtool fwupd htop iso-codes libbpf1 53s libdpkg-perl libevdev2 libftdi1-2 libfwupd3 libjcat1 libmbim-glib4 53s libmbim-proxy libmm-glib0 libnftnl11 libnghttp2-14 libnpth0t64 libnvme1t64 53s libqmi-glib5 libqmi-proxy libsensors-config libsensors5 libsepol2 53s libsqlite3-0 libunistring5 liburcu8t64 libusb-1.0-0 man-db motd-news-config 53s nano patch publicsuffix python3-lazr.restfulclient python3-more-itertools 53s python3-s3transfer sos ubuntu-pro-client ubuntu-pro-client-l10n usb.ids 53s usbutils 53s 48 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 53s Need to get 15.6 MB of archives. 53s After this operation, 1221 kB disk space will be freed. 53s Get:1 http://ftpmaster.internal/ubuntu questing/main armhf motd-news-config all 13.7ubuntu1 [5260 B] 53s Get:2 http://ftpmaster.internal/ubuntu questing/main armhf base-files armhf 13.7ubuntu1 [75.4 kB] 53s Get:3 http://ftpmaster.internal/ubuntu questing/main armhf debianutils armhf 5.22 [92.2 kB] 53s Get:4 http://ftpmaster.internal/ubuntu questing/main armhf dpkg armhf 1.22.18ubuntu3 [1254 kB] 53s Get:5 http://ftpmaster.internal/ubuntu questing/main armhf base-passwd armhf 3.6.7 [53.9 kB] 53s Get:6 http://ftpmaster.internal/ubuntu questing/main armhf libsepol2 armhf 3.8.1-1 [282 kB] 53s Get:7 http://ftpmaster.internal/ubuntu questing/main armhf libnpth0t64 armhf 1.8-3 [7716 B] 53s Get:8 http://ftpmaster.internal/ubuntu questing/main armhf distro-info-data all 0.64 [6664 B] 53s Get:9 http://ftpmaster.internal/ubuntu questing/main armhf iso-codes all 4.18.0-1 [3703 kB] 54s Get:10 http://ftpmaster.internal/ubuntu questing/main armhf libbpf1 armhf 1:1.5.0-3 [158 kB] 54s Get:11 http://ftpmaster.internal/ubuntu questing-proposed/main armhf libsqlite3-0 armhf 3.46.1-4 [602 kB] 54s Get:12 http://ftpmaster.internal/ubuntu questing/main armhf libunistring5 armhf 1.3-2 [583 kB] 54s Get:13 http://ftpmaster.internal/ubuntu questing/main armhf ubuntu-pro-client-l10n armhf 35.1ubuntu0 [19.7 kB] 54s Get:14 http://ftpmaster.internal/ubuntu questing/main armhf ubuntu-pro-client armhf 35.1ubuntu0 [258 kB] 54s Get:15 http://ftpmaster.internal/ubuntu questing/main armhf ed armhf 1.21.1-1 [53.0 kB] 54s Get:16 http://ftpmaster.internal/ubuntu questing/main armhf ethtool armhf 1:6.14-2 [230 kB] 54s Get:17 http://ftpmaster.internal/ubuntu questing/main armhf libevdev2 armhf 1.13.4+dfsg-1 [29.8 kB] 54s Get:18 http://ftpmaster.internal/ubuntu questing/main armhf libnftnl11 armhf 1.2.9-1 [53.3 kB] 54s Get:19 http://ftpmaster.internal/ubuntu questing/main armhf libnghttp2-14 armhf 1.64.0-1.1 [68.5 kB] 54s Get:20 http://ftpmaster.internal/ubuntu questing/main armhf libsensors-config all 1:3.6.2-2 [6756 B] 54s Get:21 http://ftpmaster.internal/ubuntu questing/main armhf libsensors5 armhf 1:3.6.2-2 [26.8 kB] 54s Get:22 http://ftpmaster.internal/ubuntu questing/main armhf liburcu8t64 armhf 0.15.2-2 [57.3 kB] 54s Get:23 http://ftpmaster.internal/ubuntu questing/main armhf libusb-1.0-0 armhf 2:1.0.28-1 [50.0 kB] 54s Get:24 http://ftpmaster.internal/ubuntu questing/main armhf man-db armhf 2.13.1-1 [1341 kB] 54s Get:25 http://ftpmaster.internal/ubuntu questing/main armhf nano armhf 8.4-1 [278 kB] 54s Get:26 http://ftpmaster.internal/ubuntu questing/main armhf publicsuffix all 20250328.1952-0.1 [135 kB] 54s Get:27 http://ftpmaster.internal/ubuntu questing/main armhf usb.ids all 2025.04.01-1 [223 kB] 54s Get:28 http://ftpmaster.internal/ubuntu questing/main armhf usbutils armhf 1:018-2 [77.4 kB] 54s Get:29 http://ftpmaster.internal/ubuntu questing/main armhf cloud-init-base all 25.2~1g7a0265d3-0ubuntu1 [619 kB] 54s Get:30 http://ftpmaster.internal/ubuntu questing/main armhf dpkg-dev all 1.22.18ubuntu3 [1089 kB] 54s Get:31 http://ftpmaster.internal/ubuntu questing/main armhf libdpkg-perl all 1.22.18ubuntu3 [281 kB] 54s Get:32 http://ftpmaster.internal/ubuntu questing/main armhf patch armhf 2.8-1 [94.1 kB] 54s Get:33 http://ftpmaster.internal/ubuntu questing/main armhf libjcat1 armhf 0.2.3-1 [30.9 kB] 54s Get:34 http://ftpmaster.internal/ubuntu questing/main armhf fwupd armhf 2.0.8-3 [1414 kB] 54s Get:35 http://ftpmaster.internal/ubuntu questing/main armhf libfwupd3 armhf 2.0.8-3 [126 kB] 54s Get:36 http://ftpmaster.internal/ubuntu questing/main armhf libmbim-proxy armhf 1.32.0-1 [5888 B] 54s Get:37 http://ftpmaster.internal/ubuntu questing/main armhf libmbim-glib4 armhf 1.32.0-1 [218 kB] 54s Get:38 http://ftpmaster.internal/ubuntu questing/main armhf libmm-glib0 armhf 1.24.0-1 [223 kB] 54s Get:39 http://ftpmaster.internal/ubuntu questing/main armhf libqmi-proxy armhf 1.36.0-1 [5882 B] 54s Get:40 http://ftpmaster.internal/ubuntu questing/main armhf libqmi-glib5 armhf 1.36.0-1 [936 kB] 54s Get:41 http://ftpmaster.internal/ubuntu questing/main armhf htop armhf 3.4.1-4 [147 kB] 54s Get:42 http://ftpmaster.internal/ubuntu questing/main armhf libftdi1-2 armhf 1.5-10 [27.8 kB] 54s Get:43 http://ftpmaster.internal/ubuntu questing/main armhf libnvme1t64 armhf 1.13-2 [74.3 kB] 54s Get:44 http://ftpmaster.internal/ubuntu questing/main armhf python3-lazr.restfulclient all 0.14.6-3 [51.0 kB] 54s Get:45 http://ftpmaster.internal/ubuntu questing/main armhf python3-more-itertools all 10.7.0-1 [59.6 kB] 54s Get:46 http://ftpmaster.internal/ubuntu questing/main armhf python3-s3transfer all 0.11.4-1 [55.8 kB] 54s Get:47 http://ftpmaster.internal/ubuntu questing/main armhf sos all 4.9.1-1 [367 kB] 54s Get:48 http://ftpmaster.internal/ubuntu questing/main armhf cloud-init all 25.2~1g7a0265d3-0ubuntu1 [2106 B] 54s Preconfiguring packages ... 55s Fetched 15.6 MB in 1s (13.2 MB/s) 55s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 55s Preparing to unpack .../motd-news-config_13.7ubuntu1_all.deb ... 55s Unpacking motd-news-config (13.7ubuntu1) over (13.6ubuntu2) ... 55s Preparing to unpack .../base-files_13.7ubuntu1_armhf.deb ... 55s Unpacking base-files (13.7ubuntu1) over (13.6ubuntu2) ... 55s Setting up base-files (13.7ubuntu1) ... 55s Installing new version of config file /etc/issue ... 55s Installing new version of config file /etc/issue.net ... 55s Installing new version of config file /etc/lsb-release ... 56s motd-news.service is a disabled or a static unit not running, not starting it. 56s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 56s Preparing to unpack .../debianutils_5.22_armhf.deb ... 56s Unpacking debianutils (5.22) over (5.21) ... 56s Setting up debianutils (5.22) ... 56s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 56s Preparing to unpack .../dpkg_1.22.18ubuntu3_armhf.deb ... 56s Unpacking dpkg (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 56s Setting up dpkg (1.22.18ubuntu3) ... 56s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 56s Preparing to unpack .../base-passwd_3.6.7_armhf.deb ... 57s Unpacking base-passwd (3.6.7) over (3.6.6) ... 57s Setting up base-passwd (3.6.7) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 57s Preparing to unpack .../libsepol2_3.8.1-1_armhf.deb ... 57s Unpacking libsepol2:armhf (3.8.1-1) over (3.7-1) ... 57s Setting up libsepol2:armhf (3.8.1-1) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 57s Preparing to unpack .../libnpth0t64_1.8-3_armhf.deb ... 57s Unpacking libnpth0t64:armhf (1.8-3) over (1.8-2) ... 57s Setting up libnpth0t64:armhf (1.8-3) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 57s Preparing to unpack .../00-distro-info-data_0.64_all.deb ... 57s Unpacking distro-info-data (0.64) over (0.63) ... 57s Preparing to unpack .../01-iso-codes_4.18.0-1_all.deb ... 57s Unpacking iso-codes (4.18.0-1) over (4.17.0-1) ... 57s Preparing to unpack .../02-libbpf1_1%3a1.5.0-3_armhf.deb ... 57s Unpacking libbpf1:armhf (1:1.5.0-3) over (1:1.5.0-2) ... 57s Preparing to unpack .../03-libsqlite3-0_3.46.1-4_armhf.deb ... 57s Unpacking libsqlite3-0:armhf (3.46.1-4) over (3.46.1-3) ... 58s Preparing to unpack .../04-libunistring5_1.3-2_armhf.deb ... 58s Unpacking libunistring5:armhf (1.3-2) over (1.3-1) ... 58s Preparing to unpack .../05-ubuntu-pro-client-l10n_35.1ubuntu0_armhf.deb ... 58s Unpacking ubuntu-pro-client-l10n (35.1ubuntu0) over (35) ... 58s Preparing to unpack .../06-ubuntu-pro-client_35.1ubuntu0_armhf.deb ... 58s Unpacking ubuntu-pro-client (35.1ubuntu0) over (35) ... 58s Preparing to unpack .../07-ed_1.21.1-1_armhf.deb ... 58s Unpacking ed (1.21.1-1) over (1.21-1) ... 58s Preparing to unpack .../08-ethtool_1%3a6.14-2_armhf.deb ... 58s Unpacking ethtool (1:6.14-2) over (1:6.11-1) ... 58s Preparing to unpack .../09-libevdev2_1.13.4+dfsg-1_armhf.deb ... 58s Unpacking libevdev2:armhf (1.13.4+dfsg-1) over (1.13.3+dfsg-1) ... 58s Preparing to unpack .../10-libnftnl11_1.2.9-1_armhf.deb ... 58s Unpacking libnftnl11:armhf (1.2.9-1) over (1.2.8-1) ... 58s Preparing to unpack .../11-libnghttp2-14_1.64.0-1.1_armhf.deb ... 58s Unpacking libnghttp2-14:armhf (1.64.0-1.1) over (1.64.0-1ubuntu1) ... 58s Preparing to unpack .../12-libsensors-config_1%3a3.6.2-2_all.deb ... 58s Unpacking libsensors-config (1:3.6.2-2) over (1:3.6.0-10) ... 58s Preparing to unpack .../13-libsensors5_1%3a3.6.2-2_armhf.deb ... 58s Unpacking libsensors5:armhf (1:3.6.2-2) over (1:3.6.0-10) ... 58s Preparing to unpack .../14-liburcu8t64_0.15.2-2_armhf.deb ... 58s Unpacking liburcu8t64:armhf (0.15.2-2) over (0.15.1-1) ... 58s Preparing to unpack .../15-libusb-1.0-0_2%3a1.0.28-1_armhf.deb ... 58s Unpacking libusb-1.0-0:armhf (2:1.0.28-1) over (2:1.0.27-2) ... 58s Preparing to unpack .../16-man-db_2.13.1-1_armhf.deb ... 58s Unpacking man-db (2.13.1-1) over (2.13.0-1) ... 58s Preparing to unpack .../17-nano_8.4-1_armhf.deb ... 58s Unpacking nano (8.4-1) over (8.3-1) ... 58s Preparing to unpack .../18-publicsuffix_20250328.1952-0.1_all.deb ... 58s Unpacking publicsuffix (20250328.1952-0.1) over (20250108.1153-0.1) ... 59s Preparing to unpack .../19-usb.ids_2025.04.01-1_all.deb ... 59s Unpacking usb.ids (2025.04.01-1) over (2025.01.14-1) ... 59s Preparing to unpack .../20-usbutils_1%3a018-2_armhf.deb ... 59s Unpacking usbutils (1:018-2) over (1:018-1) ... 59s Preparing to unpack .../21-cloud-init-base_25.2~1g7a0265d3-0ubuntu1_all.deb ... 59s Unpacking cloud-init-base (25.2~1g7a0265d3-0ubuntu1) over (25.1.1-0ubuntu2) ... 59s Preparing to unpack .../22-dpkg-dev_1.22.18ubuntu3_all.deb ... 59s Unpacking dpkg-dev (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 59s Preparing to unpack .../23-libdpkg-perl_1.22.18ubuntu3_all.deb ... 59s Unpacking libdpkg-perl (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 59s Preparing to unpack .../24-patch_2.8-1_armhf.deb ... 59s Unpacking patch (2.8-1) over (2.7.6-7build3) ... 59s Preparing to unpack .../25-libjcat1_0.2.3-1_armhf.deb ... 59s Unpacking libjcat1:armhf (0.2.3-1) over (0.2.0-2build3) ... 59s Preparing to unpack .../26-fwupd_2.0.8-3_armhf.deb ... 60s Unpacking fwupd (2.0.8-3) over (2.0.7-1) ... 60s dpkg: warning: unable to delete old directory '/etc/grub.d': Directory not empty 60s Preparing to unpack .../27-libfwupd3_2.0.8-3_armhf.deb ... 60s Unpacking libfwupd3:armhf (2.0.8-3) over (2.0.7-1) ... 60s Preparing to unpack .../28-libmbim-proxy_1.32.0-1_armhf.deb ... 60s Unpacking libmbim-proxy (1.32.0-1) over (1.31.2-0ubuntu4) ... 60s Preparing to unpack .../29-libmbim-glib4_1.32.0-1_armhf.deb ... 60s Unpacking libmbim-glib4:armhf (1.32.0-1) over (1.31.2-0ubuntu4) ... 60s Preparing to unpack .../30-libmm-glib0_1.24.0-1_armhf.deb ... 60s Unpacking libmm-glib0:armhf (1.24.0-1) over (1.23.4-0ubuntu3) ... 60s Preparing to unpack .../31-libqmi-proxy_1.36.0-1_armhf.deb ... 60s Unpacking libqmi-proxy (1.36.0-1) over (1.35.6-1) ... 60s Preparing to unpack .../32-libqmi-glib5_1.36.0-1_armhf.deb ... 60s Unpacking libqmi-glib5:armhf (1.36.0-1) over (1.35.6-1) ... 60s Preparing to unpack .../33-htop_3.4.1-4_armhf.deb ... 60s Unpacking htop (3.4.1-4) over (3.4.0-2) ... 60s Preparing to unpack .../34-libftdi1-2_1.5-10_armhf.deb ... 60s Unpacking libftdi1-2:armhf (1.5-10) over (1.5-8build1) ... 60s Preparing to unpack .../35-libnvme1t64_1.13-2_armhf.deb ... 60s Unpacking libnvme1t64 (1.13-2) over (1.11.1-2) ... 60s Preparing to unpack .../36-python3-lazr.restfulclient_0.14.6-3_all.deb ... 60s Unpacking python3-lazr.restfulclient (0.14.6-3) over (0.14.6-2) ... 60s Preparing to unpack .../37-python3-more-itertools_10.7.0-1_all.deb ... 60s Unpacking python3-more-itertools (10.7.0-1) over (10.6.0-1) ... 60s Preparing to unpack .../38-python3-s3transfer_0.11.4-1_all.deb ... 60s Unpacking python3-s3transfer (0.11.4-1) over (0.11.2-2) ... 61s Preparing to unpack .../39-sos_4.9.1-1_all.deb ... 61s Unpacking sos (4.9.1-1) over (4.9.0-6) ... 61s Preparing to unpack .../40-cloud-init_25.2~1g7a0265d3-0ubuntu1_all.deb ... 61s Unpacking cloud-init (25.2~1g7a0265d3-0ubuntu1) over (25.1.1-0ubuntu2) ... 61s Setting up sos (4.9.1-1) ... 62s Setting up motd-news-config (13.7ubuntu1) ... 62s Setting up python3-more-itertools (10.7.0-1) ... 62s Setting up liburcu8t64:armhf (0.15.2-2) ... 62s Setting up distro-info-data (0.64) ... 62s Setting up htop (3.4.1-4) ... 62s Setting up libsqlite3-0:armhf (3.46.1-4) ... 62s Setting up python3-s3transfer (0.11.4-1) ... 62s Setting up libsensors-config (1:3.6.2-2) ... 62s Installing new version of config file /etc/sensors3.conf ... 62s Setting up libnghttp2-14:armhf (1.64.0-1.1) ... 62s Setting up libnftnl11:armhf (1.2.9-1) ... 62s Setting up man-db (2.13.1-1) ... 62s Updating database of manual pages ... 64s apparmor_parser: Unable to replace "/usr/bin/man". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 64s 64s man-db.service is a disabled or a static unit not running, not starting it. 64s Setting up cloud-init-base (25.2~1g7a0265d3-0ubuntu1) ... 66s Setting up libjcat1:armhf (0.2.3-1) ... 66s Setting up libnvme1t64 (1.13-2) ... 66s Setting up ed (1.21.1-1) ... 66s Setting up libunistring5:armhf (1.3-2) ... 66s Setting up patch (2.8-1) ... 66s Setting up usb.ids (2025.04.01-1) ... 66s Setting up libsensors5:armhf (1:3.6.2-2) ... 66s Setting up libdpkg-perl (1.22.18ubuntu3) ... 66s Setting up nano (8.4-1) ... 66s Installing new version of config file /etc/nanorc ... 66s Setting up libmm-glib0:armhf (1.24.0-1) ... 66s Setting up libusb-1.0-0:armhf (2:1.0.28-1) ... 66s Setting up python3-lazr.restfulclient (0.14.6-3) ... 66s Setting up libevdev2:armhf (1.13.4+dfsg-1) ... 66s Setting up publicsuffix (20250328.1952-0.1) ... 66s Setting up ubuntu-pro-client (35.1ubuntu0) ... 66s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 66s 67s apparmor_parser: Unable to replace "apt_methods". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 67s 67s apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 67s 68s Setting up iso-codes (4.18.0-1) ... 68s Setting up libbpf1:armhf (1:1.5.0-3) ... 68s Setting up libmbim-glib4:armhf (1.32.0-1) ... 68s Setting up ethtool (1:6.14-2) ... 68s Setting up ubuntu-pro-client-l10n (35.1ubuntu0) ... 68s Setting up cloud-init (25.2~1g7a0265d3-0ubuntu1) ... 68s Setting up libfwupd3:armhf (2.0.8-3) ... 68s Setting up libmbim-proxy (1.32.0-1) ... 68s Setting up usbutils (1:018-2) ... 68s Setting up dpkg-dev (1.22.18ubuntu3) ... 68s Setting up libftdi1-2:armhf (1.5-10) ... 68s Setting up libqmi-glib5:armhf (1.36.0-1) ... 68s Setting up libqmi-proxy (1.36.0-1) ... 68s Setting up fwupd (2.0.8-3) ... 69s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 69s fwupd.service is a disabled or a static unit not running, not starting it. 69s Processing triggers for rsyslog (8.2412.0-2ubuntu2) ... 69s Processing triggers for plymouth-theme-ubuntu-text (24.004.60-2ubuntu7) ... 69s Processing triggers for dbus (1.16.2-2ubuntu1) ... 69s Processing triggers for install-info (7.1.1-1) ... 69s Processing triggers for libc-bin (2.41-6ubuntu1) ... 69s Processing triggers for initramfs-tools (0.147ubuntu1) ... 71s Reading package lists... 72s Building dependency tree... 72s Reading state information... 72s Starting pkgProblemResolver with broken count: 0 72s Starting 2 pkgProblemResolver with broken count: 0 72s Done 73s Solving dependencies... 73s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 75s autopkgtest [20:40:28]: rebooting testbed after setup commands that affected boot 115s autopkgtest [20:41:08]: testbed running kernel: Linux 6.8.0-58-generic #60~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Fri Mar 28 14:48:37 UTC 2 139s autopkgtest [20:41:32]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 153s Get:1 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (dsc) [2401 B] 153s Get:2 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (tar) [18.4 MB] 153s Get:3 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (diff) [40.8 kB] 153s gpgv: Signature made Thu Nov 21 15:47:04 2024 UTC 153s gpgv: using RSA key 4D0BE12F0E4776D8AACE9696E66C775AEBFE6C7D 153s gpgv: Can't check signature: No public key 153s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6build1.dsc: no acceptable signature found 155s autopkgtest [20:41:48]: testing package ncbi-blast+ version 2.16.0+ds-6build1 157s autopkgtest [20:41:50]: build not needed 162s autopkgtest [20:41:55]: test run-unit-test: preparing testbed 164s Reading package lists... 164s Building dependency tree... 164s Reading state information... 165s Starting pkgProblemResolver with broken count: 0 165s Starting 2 pkgProblemResolver with broken count: 0 165s Done 166s The following NEW packages will be installed: 166s libgomp1 libmbedcrypto16 libmbedtls21 libmbedx509-7 ncbi-blast+ 166s ncbi-blast+-legacy ncbi-data 166s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 166s Need to get 19.3 MB of archives. 166s After this operation, 72.9 MB of additional disk space will be used. 166s Get:1 http://ftpmaster.internal/ubuntu questing/main armhf libgomp1 armhf 15-20250404-0ubuntu1 [128 kB] 166s Get:2 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedcrypto16 armhf 3.6.2-3ubuntu1 [226 kB] 166s Get:3 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedx509-7 armhf 3.6.2-3ubuntu1 [30.4 kB] 166s Get:4 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedtls21 armhf 3.6.2-3ubuntu1 [116 kB] 166s Get:5 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 167s Get:6 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-blast+ armhf 2.16.0+ds-6build1 [14.8 MB] 167s Get:7 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-blast+-legacy all 2.16.0+ds-6build1 [4984 B] 168s Fetched 19.3 MB in 1s (14.7 MB/s) 168s Selecting previously unselected package libgomp1:armhf. 168s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63964 files and directories currently installed.) 168s Preparing to unpack .../0-libgomp1_15-20250404-0ubuntu1_armhf.deb ... 168s Unpacking libgomp1:armhf (15-20250404-0ubuntu1) ... 168s Selecting previously unselected package libmbedcrypto16:armhf. 168s Preparing to unpack .../1-libmbedcrypto16_3.6.2-3ubuntu1_armhf.deb ... 168s Unpacking libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 168s Selecting previously unselected package libmbedx509-7:armhf. 168s Preparing to unpack .../2-libmbedx509-7_3.6.2-3ubuntu1_armhf.deb ... 168s Unpacking libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 168s Selecting previously unselected package libmbedtls21:armhf. 168s Preparing to unpack .../3-libmbedtls21_3.6.2-3ubuntu1_armhf.deb ... 168s Unpacking libmbedtls21:armhf (3.6.2-3ubuntu1) ... 168s Selecting previously unselected package ncbi-data. 168s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 168s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 168s Selecting previously unselected package ncbi-blast+. 168s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6build1_armhf.deb ... 168s Unpacking ncbi-blast+ (2.16.0+ds-6build1) ... 168s Selecting previously unselected package ncbi-blast+-legacy. 168s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6build1_all.deb ... 168s Unpacking ncbi-blast+-legacy (2.16.0+ds-6build1) ... 168s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 168s Setting up libgomp1:armhf (15-20250404-0ubuntu1) ... 168s Setting up libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 168s Setting up libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 168s Setting up libmbedtls21:armhf (3.6.2-3ubuntu1) ... 168s Setting up ncbi-blast+ (2.16.0+ds-6build1) ... 168s Setting up ncbi-blast+-legacy (2.16.0+ds-6build1) ... 168s Processing triggers for man-db (2.13.1-1) ... 169s Processing triggers for libc-bin (2.41-6ubuntu1) ... 178s autopkgtest [20:42:11]: test run-unit-test: [----------------------- 180s ---Creating Database-- 180s 180s 180s Building a new DB, current time: 05/04/2025 20:42:13 180s New DB name: /tmp/autopkgtest.4OaX8P/autopkgtest_tmp/testdb 180s New DB title: testdatabase.fa 180s Sequence type: Nucleotide 180s Keep MBits: T 180s Maximum file size: 3000000000B 181s Adding sequences from FASTA; added 3 sequences in 0.228146 seconds. 181s 181s 181s ---Searching Database for Hits--- 181s Warning: [blastn] Examining 5 or more matches is recommended 181s # BLASTN 2.16.0+ 181s # Query: gnl|MYDB|1 this is sequence 1 181s # Database: testdb 181s # Fields: query id, subject id, evalue, bit score 181s # 2 hits found 181s gnl|MYDB|1 gnl2 0.0 1299 181s gnl|MYDB|1 gnl1 0.0 1299 181s # BLAST processed 1 queries 181s ---Search and Fetch An Entry From Database--- 181s >gnl1 181s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 181s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 181s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 181s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 181s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 181s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 181s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 181s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 181s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 181s PASS 181s autopkgtest [20:42:14]: test run-unit-test: -----------------------] 185s autopkgtest [20:42:18]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 185s run-unit-test PASS 189s autopkgtest [20:42:22]: @@@@@@@@@@@@@@@@@@@@ summary 189s run-unit-test PASS