0s autopkgtest [14:56:21]: starting date and time: 2025-05-04 14:56:21+0000 0s autopkgtest [14:56:21]: git checkout: 9986aa8c Merge branch 'skia/fix_network_interface' into 'ubuntu/production' 0s autopkgtest [14:56:21]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.6aze4w19/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,localhost,localdomain,internal,login.ubuntu.com,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:libzstd --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=libzstd/1.5.7+dfsg-1 -- lxd -r lxd-armhf-10.145.243.115 lxd-armhf-10.145.243.115:autopkgtest/ubuntu/questing/armhf 19s autopkgtest [14:56:40]: testbed dpkg architecture: armhf 20s autopkgtest [14:56:41]: testbed apt version: 3.0.0 24s autopkgtest [14:56:45]: @@@@@@@@@@@@@@@@@@@@ test bed setup 26s autopkgtest [14:56:47]: testbed release detected to be: None 33s autopkgtest [14:56:54]: updating testbed package index (apt update) 35s Get:1 http://ftpmaster.internal/ubuntu questing-proposed InRelease [110 kB] 35s Get:2 http://ftpmaster.internal/ubuntu questing InRelease [110 kB] 35s Get:3 http://ftpmaster.internal/ubuntu questing-updates InRelease [110 kB] 35s Get:4 http://ftpmaster.internal/ubuntu questing-security InRelease [110 kB] 35s Get:5 http://ftpmaster.internal/ubuntu questing-proposed/main Sources [115 kB] 35s Get:6 http://ftpmaster.internal/ubuntu questing-proposed/multiverse Sources [33.3 kB] 35s Get:7 http://ftpmaster.internal/ubuntu questing-proposed/universe Sources [1153 kB] 35s Get:8 http://ftpmaster.internal/ubuntu questing-proposed/main armhf Packages [140 kB] 35s Get:9 http://ftpmaster.internal/ubuntu questing-proposed/universe armhf Packages [1097 kB] 35s Get:10 http://ftpmaster.internal/ubuntu questing-proposed/multiverse armhf Packages [27.8 kB] 35s Get:11 http://ftpmaster.internal/ubuntu questing/universe Sources [21.2 MB] 36s Get:12 http://ftpmaster.internal/ubuntu questing/multiverse Sources [306 kB] 36s Get:13 http://ftpmaster.internal/ubuntu questing/main Sources [1389 kB] 36s Get:14 http://ftpmaster.internal/ubuntu questing/main armhf Packages [1358 kB] 36s Get:15 http://ftpmaster.internal/ubuntu questing/universe armhf Packages [15.1 MB] 36s Get:16 http://ftpmaster.internal/ubuntu questing/multiverse armhf Packages [180 kB] 40s Fetched 42.6 MB in 6s (7379 kB/s) 41s Reading package lists... 47s autopkgtest [14:57:08]: upgrading testbed (apt dist-upgrade and autopurge) 48s Reading package lists... 48s Building dependency tree... 48s Reading state information... 49s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 49s Starting 2 pkgProblemResolver with broken count: 0 49s Done 50s Entering ResolveByKeep 50s 50s Calculating upgrade... 50s The following packages will be upgraded: 50s base-files base-passwd cloud-init cloud-init-base debianutils 50s distro-info-data dpkg dpkg-dev ed ethtool fwupd htop iso-codes libdpkg-perl 50s libevdev2 libftdi1-2 libfwupd3 libjcat1 libmbim-glib4 libmbim-proxy 50s libmm-glib0 libnftnl11 libnpth0t64 libnvme1t64 libqmi-glib5 libqmi-proxy 50s libsensors-config libsensors5 libsepol2 libunistring5 liburcu8t64 libzstd1 50s motd-news-config nano patch publicsuffix python3-lazr.restfulclient 50s python3-more-itertools python3-s3transfer sos ubuntu-pro-client 50s ubuntu-pro-client-l10n usb.ids zstd 51s 44 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 51s Need to get 14.3 MB of archives. 51s After this operation, 2050 kB disk space will be freed. 51s Get:1 http://ftpmaster.internal/ubuntu questing/main armhf motd-news-config all 13.7ubuntu1 [5260 B] 51s Get:2 http://ftpmaster.internal/ubuntu questing/main armhf base-files armhf 13.7ubuntu1 [75.4 kB] 51s Get:3 http://ftpmaster.internal/ubuntu questing/main armhf debianutils armhf 5.22 [92.2 kB] 51s Get:4 http://ftpmaster.internal/ubuntu questing/main armhf dpkg armhf 1.22.18ubuntu3 [1254 kB] 51s Get:5 http://ftpmaster.internal/ubuntu questing/main armhf base-passwd armhf 3.6.7 [53.9 kB] 51s Get:6 http://ftpmaster.internal/ubuntu questing/main armhf libsepol2 armhf 3.8.1-1 [282 kB] 51s Get:7 http://ftpmaster.internal/ubuntu questing-proposed/main armhf libzstd1 armhf 1.5.7+dfsg-1 [271 kB] 51s Get:8 http://ftpmaster.internal/ubuntu questing/main armhf libnpth0t64 armhf 1.8-3 [7716 B] 51s Get:9 http://ftpmaster.internal/ubuntu questing/main armhf distro-info-data all 0.64 [6664 B] 51s Get:10 http://ftpmaster.internal/ubuntu questing/main armhf iso-codes all 4.18.0-1 [3703 kB] 51s Get:11 http://ftpmaster.internal/ubuntu questing/main armhf libunistring5 armhf 1.3-2 [583 kB] 51s Get:12 http://ftpmaster.internal/ubuntu questing/main armhf ubuntu-pro-client-l10n armhf 35.1ubuntu0 [19.7 kB] 51s Get:13 http://ftpmaster.internal/ubuntu questing/main armhf ubuntu-pro-client armhf 35.1ubuntu0 [258 kB] 51s Get:14 http://ftpmaster.internal/ubuntu questing/main armhf ed armhf 1.21.1-1 [53.0 kB] 51s Get:15 http://ftpmaster.internal/ubuntu questing/main armhf ethtool armhf 1:6.14-2 [230 kB] 51s Get:16 http://ftpmaster.internal/ubuntu questing/main armhf libevdev2 armhf 1.13.4+dfsg-1 [29.8 kB] 51s Get:17 http://ftpmaster.internal/ubuntu questing/main armhf libnftnl11 armhf 1.2.9-1 [53.3 kB] 51s Get:18 http://ftpmaster.internal/ubuntu questing/main armhf libsensors-config all 1:3.6.2-2 [6756 B] 51s Get:19 http://ftpmaster.internal/ubuntu questing/main armhf libsensors5 armhf 1:3.6.2-2 [26.8 kB] 51s Get:20 http://ftpmaster.internal/ubuntu questing/main armhf liburcu8t64 armhf 0.15.2-2 [57.3 kB] 51s Get:21 http://ftpmaster.internal/ubuntu questing/main armhf nano armhf 8.4-1 [278 kB] 51s Get:22 http://ftpmaster.internal/ubuntu questing/main armhf publicsuffix all 20250328.1952-0.1 [135 kB] 51s Get:23 http://ftpmaster.internal/ubuntu questing/main armhf usb.ids all 2025.04.01-1 [223 kB] 51s Get:24 http://ftpmaster.internal/ubuntu questing/main armhf cloud-init-base all 25.2~1g7a0265d3-0ubuntu1 [619 kB] 51s Get:25 http://ftpmaster.internal/ubuntu questing/main armhf dpkg-dev all 1.22.18ubuntu3 [1089 kB] 51s Get:26 http://ftpmaster.internal/ubuntu questing/main armhf libdpkg-perl all 1.22.18ubuntu3 [281 kB] 51s Get:27 http://ftpmaster.internal/ubuntu questing/main armhf patch armhf 2.8-1 [94.1 kB] 51s Get:28 http://ftpmaster.internal/ubuntu questing/main armhf libjcat1 armhf 0.2.3-1 [30.9 kB] 51s Get:29 http://ftpmaster.internal/ubuntu questing/main armhf fwupd armhf 2.0.8-3 [1414 kB] 52s Get:30 http://ftpmaster.internal/ubuntu questing/main armhf libfwupd3 armhf 2.0.8-3 [126 kB] 52s Get:31 http://ftpmaster.internal/ubuntu questing/main armhf libmbim-proxy armhf 1.32.0-1 [5888 B] 52s Get:32 http://ftpmaster.internal/ubuntu questing/main armhf libmbim-glib4 armhf 1.32.0-1 [218 kB] 52s Get:33 http://ftpmaster.internal/ubuntu questing/main armhf libmm-glib0 armhf 1.24.0-1 [223 kB] 52s Get:34 http://ftpmaster.internal/ubuntu questing/main armhf libqmi-proxy armhf 1.36.0-1 [5882 B] 52s Get:35 http://ftpmaster.internal/ubuntu questing/main armhf libqmi-glib5 armhf 1.36.0-1 [936 kB] 52s Get:36 http://ftpmaster.internal/ubuntu questing/main armhf htop armhf 3.4.1-4 [147 kB] 52s Get:37 http://ftpmaster.internal/ubuntu questing/main armhf libftdi1-2 armhf 1.5-10 [27.8 kB] 52s Get:38 http://ftpmaster.internal/ubuntu questing/main armhf libnvme1t64 armhf 1.13-2 [74.3 kB] 52s Get:39 http://ftpmaster.internal/ubuntu questing/main armhf python3-lazr.restfulclient all 0.14.6-3 [51.0 kB] 52s Get:40 http://ftpmaster.internal/ubuntu questing/main armhf python3-more-itertools all 10.7.0-1 [59.6 kB] 52s Get:41 http://ftpmaster.internal/ubuntu questing/main armhf python3-s3transfer all 0.11.4-1 [55.8 kB] 52s Get:42 http://ftpmaster.internal/ubuntu questing/main armhf sos all 4.9.1-1 [367 kB] 52s Get:43 http://ftpmaster.internal/ubuntu questing-proposed/main armhf zstd armhf 1.5.7+dfsg-1 [722 kB] 52s Get:44 http://ftpmaster.internal/ubuntu questing/main armhf cloud-init all 25.2~1g7a0265d3-0ubuntu1 [2106 B] 52s Preconfiguring packages ... 52s Fetched 14.3 MB in 1s (11.6 MB/s) 52s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 52s Preparing to unpack .../motd-news-config_13.7ubuntu1_all.deb ... 52s Unpacking motd-news-config (13.7ubuntu1) over (13.6ubuntu2) ... 52s Preparing to unpack .../base-files_13.7ubuntu1_armhf.deb ... 52s Unpacking base-files (13.7ubuntu1) over (13.6ubuntu2) ... 53s Setting up base-files (13.7ubuntu1) ... 53s Installing new version of config file /etc/issue ... 53s Installing new version of config file /etc/issue.net ... 53s Installing new version of config file /etc/lsb-release ... 53s motd-news.service is a disabled or a static unit not running, not starting it. 53s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 53s Preparing to unpack .../debianutils_5.22_armhf.deb ... 53s Unpacking debianutils (5.22) over (5.21) ... 53s Setting up debianutils (5.22) ... 54s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 54s Preparing to unpack .../dpkg_1.22.18ubuntu3_armhf.deb ... 54s Unpacking dpkg (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 54s Setting up dpkg (1.22.18ubuntu3) ... 54s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 54s Preparing to unpack .../base-passwd_3.6.7_armhf.deb ... 54s Unpacking base-passwd (3.6.7) over (3.6.6) ... 54s Setting up base-passwd (3.6.7) ... 54s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 54s Preparing to unpack .../libsepol2_3.8.1-1_armhf.deb ... 54s Unpacking libsepol2:armhf (3.8.1-1) over (3.7-1) ... 54s Setting up libsepol2:armhf (3.8.1-1) ... 54s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 54s Preparing to unpack .../libzstd1_1.5.7+dfsg-1_armhf.deb ... 54s Unpacking libzstd1:armhf (1.5.7+dfsg-1) over (1.5.6+dfsg-2) ... 54s Setting up libzstd1:armhf (1.5.7+dfsg-1) ... 54s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 54s Preparing to unpack .../libnpth0t64_1.8-3_armhf.deb ... 54s Unpacking libnpth0t64:armhf (1.8-3) over (1.8-2) ... 55s Setting up libnpth0t64:armhf (1.8-3) ... 55s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63953 files and directories currently installed.) 55s Preparing to unpack .../00-distro-info-data_0.64_all.deb ... 55s Unpacking distro-info-data (0.64) over (0.63) ... 55s Preparing to unpack .../01-iso-codes_4.18.0-1_all.deb ... 55s Unpacking iso-codes (4.18.0-1) over (4.17.0-1) ... 55s Preparing to unpack .../02-libunistring5_1.3-2_armhf.deb ... 55s Unpacking libunistring5:armhf (1.3-2) over (1.3-1) ... 55s Preparing to unpack .../03-ubuntu-pro-client-l10n_35.1ubuntu0_armhf.deb ... 55s Unpacking ubuntu-pro-client-l10n (35.1ubuntu0) over (35) ... 55s Preparing to unpack .../04-ubuntu-pro-client_35.1ubuntu0_armhf.deb ... 55s Unpacking ubuntu-pro-client (35.1ubuntu0) over (35) ... 55s Preparing to unpack .../05-ed_1.21.1-1_armhf.deb ... 55s Unpacking ed (1.21.1-1) over (1.21-1) ... 55s Preparing to unpack .../06-ethtool_1%3a6.14-2_armhf.deb ... 55s Unpacking ethtool (1:6.14-2) over (1:6.11-1) ... 55s Preparing to unpack .../07-libevdev2_1.13.4+dfsg-1_armhf.deb ... 55s Unpacking libevdev2:armhf (1.13.4+dfsg-1) over (1.13.3+dfsg-1) ... 55s Preparing to unpack .../08-libnftnl11_1.2.9-1_armhf.deb ... 55s Unpacking libnftnl11:armhf (1.2.9-1) over (1.2.8-1) ... 55s Preparing to unpack .../09-libsensors-config_1%3a3.6.2-2_all.deb ... 55s Unpacking libsensors-config (1:3.6.2-2) over (1:3.6.0-10) ... 56s Preparing to unpack .../10-libsensors5_1%3a3.6.2-2_armhf.deb ... 56s Unpacking libsensors5:armhf (1:3.6.2-2) over (1:3.6.0-10) ... 56s Preparing to unpack .../11-liburcu8t64_0.15.2-2_armhf.deb ... 56s Unpacking liburcu8t64:armhf (0.15.2-2) over (0.15.1-1) ... 56s Preparing to unpack .../12-nano_8.4-1_armhf.deb ... 56s Unpacking nano (8.4-1) over (8.3-1) ... 56s Preparing to unpack .../13-publicsuffix_20250328.1952-0.1_all.deb ... 56s Unpacking publicsuffix (20250328.1952-0.1) over (20250108.1153-0.1) ... 56s Preparing to unpack .../14-usb.ids_2025.04.01-1_all.deb ... 56s Unpacking usb.ids (2025.04.01-1) over (2025.01.14-1) ... 56s Preparing to unpack .../15-cloud-init-base_25.2~1g7a0265d3-0ubuntu1_all.deb ... 56s Unpacking cloud-init-base (25.2~1g7a0265d3-0ubuntu1) over (25.1.1-0ubuntu2) ... 56s Preparing to unpack .../16-dpkg-dev_1.22.18ubuntu3_all.deb ... 56s Unpacking dpkg-dev (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 56s Preparing to unpack .../17-libdpkg-perl_1.22.18ubuntu3_all.deb ... 56s Unpacking libdpkg-perl (1.22.18ubuntu3) over (1.22.18ubuntu2) ... 57s Preparing to unpack .../18-patch_2.8-1_armhf.deb ... 57s Unpacking patch (2.8-1) over (2.7.6-7build3) ... 57s Preparing to unpack .../19-libjcat1_0.2.3-1_armhf.deb ... 57s Unpacking libjcat1:armhf (0.2.3-1) over (0.2.0-2build3) ... 57s Preparing to unpack .../20-fwupd_2.0.8-3_armhf.deb ... 57s Unpacking fwupd (2.0.8-3) over (2.0.7-1) ... 57s dpkg: warning: unable to delete old directory '/etc/grub.d': Directory not empty 57s Preparing to unpack .../21-libfwupd3_2.0.8-3_armhf.deb ... 57s Unpacking libfwupd3:armhf (2.0.8-3) over (2.0.7-1) ... 57s Preparing to unpack .../22-libmbim-proxy_1.32.0-1_armhf.deb ... 57s Unpacking libmbim-proxy (1.32.0-1) over (1.31.2-0ubuntu4) ... 57s Preparing to unpack .../23-libmbim-glib4_1.32.0-1_armhf.deb ... 57s Unpacking libmbim-glib4:armhf (1.32.0-1) over (1.31.2-0ubuntu4) ... 57s Preparing to unpack .../24-libmm-glib0_1.24.0-1_armhf.deb ... 57s Unpacking libmm-glib0:armhf (1.24.0-1) over (1.23.4-0ubuntu3) ... 57s Preparing to unpack .../25-libqmi-proxy_1.36.0-1_armhf.deb ... 57s Unpacking libqmi-proxy (1.36.0-1) over (1.35.6-1) ... 57s Preparing to unpack .../26-libqmi-glib5_1.36.0-1_armhf.deb ... 57s Unpacking libqmi-glib5:armhf (1.36.0-1) over (1.35.6-1) ... 57s Preparing to unpack .../27-htop_3.4.1-4_armhf.deb ... 57s Unpacking htop (3.4.1-4) over (3.4.0-2) ... 57s Preparing to unpack .../28-libftdi1-2_1.5-10_armhf.deb ... 57s Unpacking libftdi1-2:armhf (1.5-10) over (1.5-8build1) ... 57s Preparing to unpack .../29-libnvme1t64_1.13-2_armhf.deb ... 57s Unpacking libnvme1t64 (1.13-2) over (1.11.1-2) ... 57s Preparing to unpack .../30-python3-lazr.restfulclient_0.14.6-3_all.deb ... 57s Unpacking python3-lazr.restfulclient (0.14.6-3) over (0.14.6-2) ... 58s Preparing to unpack .../31-python3-more-itertools_10.7.0-1_all.deb ... 58s Unpacking python3-more-itertools (10.7.0-1) over (10.6.0-1) ... 58s Preparing to unpack .../32-python3-s3transfer_0.11.4-1_all.deb ... 58s Unpacking python3-s3transfer (0.11.4-1) over (0.11.2-2) ... 58s Preparing to unpack .../33-sos_4.9.1-1_all.deb ... 58s Unpacking sos (4.9.1-1) over (4.9.0-6) ... 58s Preparing to unpack .../34-zstd_1.5.7+dfsg-1_armhf.deb ... 58s Unpacking zstd (1.5.7+dfsg-1) over (1.5.6+dfsg-2) ... 58s Preparing to unpack .../35-cloud-init_25.2~1g7a0265d3-0ubuntu1_all.deb ... 58s Unpacking cloud-init (25.2~1g7a0265d3-0ubuntu1) over (25.1.1-0ubuntu2) ... 58s Setting up sos (4.9.1-1) ... 59s Setting up motd-news-config (13.7ubuntu1) ... 59s Setting up python3-more-itertools (10.7.0-1) ... 59s Setting up liburcu8t64:armhf (0.15.2-2) ... 59s Setting up distro-info-data (0.64) ... 59s Setting up htop (3.4.1-4) ... 59s Setting up python3-s3transfer (0.11.4-1) ... 59s Setting up libsensors-config (1:3.6.2-2) ... 59s Installing new version of config file /etc/sensors3.conf ... 59s Setting up libnftnl11:armhf (1.2.9-1) ... 59s Setting up cloud-init-base (25.2~1g7a0265d3-0ubuntu1) ... 61s Setting up libjcat1:armhf (0.2.3-1) ... 61s Setting up libftdi1-2:armhf (1.5-10) ... 61s Setting up libnvme1t64 (1.13-2) ... 61s Setting up ed (1.21.1-1) ... 62s Setting up libunistring5:armhf (1.3-2) ... 62s Setting up patch (2.8-1) ... 62s Setting up usb.ids (2025.04.01-1) ... 62s Setting up libsensors5:armhf (1:3.6.2-2) ... 62s Setting up libdpkg-perl (1.22.18ubuntu3) ... 62s Setting up nano (8.4-1) ... 62s Installing new version of config file /etc/nanorc ... 62s Setting up libmm-glib0:armhf (1.24.0-1) ... 62s Setting up python3-lazr.restfulclient (0.14.6-3) ... 62s Setting up libevdev2:armhf (1.13.4+dfsg-1) ... 62s Setting up publicsuffix (20250328.1952-0.1) ... 62s Setting up ubuntu-pro-client (35.1ubuntu0) ... 62s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 62s 62s apparmor_parser: Unable to replace "apt_methods". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 62s 62s apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 62s 64s Setting up zstd (1.5.7+dfsg-1) ... 64s Setting up iso-codes (4.18.0-1) ... 64s Setting up libmbim-glib4:armhf (1.32.0-1) ... 64s Setting up ethtool (1:6.14-2) ... 64s Setting up ubuntu-pro-client-l10n (35.1ubuntu0) ... 64s Setting up cloud-init (25.2~1g7a0265d3-0ubuntu1) ... 64s Setting up libfwupd3:armhf (2.0.8-3) ... 64s Setting up libmbim-proxy (1.32.0-1) ... 64s Setting up dpkg-dev (1.22.18ubuntu3) ... 64s Setting up libqmi-glib5:armhf (1.36.0-1) ... 64s Setting up libqmi-proxy (1.36.0-1) ... 64s Setting up fwupd (2.0.8-3) ... 64s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 64s fwupd.service is a disabled or a static unit not running, not starting it. 64s Processing triggers for rsyslog (8.2412.0-2ubuntu2) ... 65s Processing triggers for man-db (2.13.0-1) ... 66s Processing triggers for plymouth-theme-ubuntu-text (24.004.60-2ubuntu7) ... 66s Processing triggers for dbus (1.16.2-2ubuntu1) ... 66s Processing triggers for install-info (7.1.1-1) ... 66s Processing triggers for libc-bin (2.41-6ubuntu1) ... 67s Processing triggers for initramfs-tools (0.147ubuntu1) ... 69s Reading package lists... 69s Building dependency tree... 69s Reading state information... 70s Starting pkgProblemResolver with broken count: 0 70s Starting 2 pkgProblemResolver with broken count: 0 70s Done 71s Solving dependencies... 71s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 73s autopkgtest [14:57:34]: rebooting testbed after setup commands that affected boot 110s autopkgtest [14:58:11]: testbed running kernel: Linux 6.8.0-58-generic #60~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Fri Mar 28 14:48:37 UTC 2 133s autopkgtest [14:58:34]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 146s Get:1 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (dsc) [2401 B] 146s Get:2 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (tar) [18.4 MB] 146s Get:3 http://ftpmaster.internal/ubuntu questing/universe ncbi-blast+ 2.16.0+ds-6build1 (diff) [40.8 kB] 146s gpgv: Signature made Thu Nov 21 15:47:04 2024 UTC 146s gpgv: using RSA key 4D0BE12F0E4776D8AACE9696E66C775AEBFE6C7D 146s gpgv: Can't check signature: No public key 146s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6build1.dsc: no acceptable signature found 148s autopkgtest [14:58:49]: testing package ncbi-blast+ version 2.16.0+ds-6build1 149s autopkgtest [14:58:50]: build not needed 155s autopkgtest [14:58:56]: test run-unit-test: preparing testbed 156s Reading package lists... 157s Building dependency tree... 157s Reading state information... 157s Starting pkgProblemResolver with broken count: 0 157s Starting 2 pkgProblemResolver with broken count: 0 157s Done 158s The following NEW packages will be installed: 158s libgomp1 libmbedcrypto16 libmbedtls21 libmbedx509-7 ncbi-blast+ 158s ncbi-blast+-legacy ncbi-data 158s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 158s Need to get 19.3 MB of archives. 158s After this operation, 72.9 MB of additional disk space will be used. 158s Get:1 http://ftpmaster.internal/ubuntu questing/main armhf libgomp1 armhf 15-20250404-0ubuntu1 [128 kB] 158s Get:2 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedcrypto16 armhf 3.6.2-3ubuntu1 [226 kB] 158s Get:3 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedx509-7 armhf 3.6.2-3ubuntu1 [30.4 kB] 158s Get:4 http://ftpmaster.internal/ubuntu questing/universe armhf libmbedtls21 armhf 3.6.2-3ubuntu1 [116 kB] 158s Get:5 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 158s Get:6 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-blast+ armhf 2.16.0+ds-6build1 [14.8 MB] 159s Get:7 http://ftpmaster.internal/ubuntu questing/universe armhf ncbi-blast+-legacy all 2.16.0+ds-6build1 [4984 B] 159s Fetched 19.3 MB in 1s (17.2 MB/s) 159s Selecting previously unselected package libgomp1:armhf. 159s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 63955 files and directories currently installed.) 159s Preparing to unpack .../0-libgomp1_15-20250404-0ubuntu1_armhf.deb ... 159s Unpacking libgomp1:armhf (15-20250404-0ubuntu1) ... 159s Selecting previously unselected package libmbedcrypto16:armhf. 159s Preparing to unpack .../1-libmbedcrypto16_3.6.2-3ubuntu1_armhf.deb ... 159s Unpacking libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 159s Selecting previously unselected package libmbedx509-7:armhf. 159s Preparing to unpack .../2-libmbedx509-7_3.6.2-3ubuntu1_armhf.deb ... 159s Unpacking libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 159s Selecting previously unselected package libmbedtls21:armhf. 159s Preparing to unpack .../3-libmbedtls21_3.6.2-3ubuntu1_armhf.deb ... 159s Unpacking libmbedtls21:armhf (3.6.2-3ubuntu1) ... 159s Selecting previously unselected package ncbi-data. 159s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 159s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 160s Selecting previously unselected package ncbi-blast+. 160s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6build1_armhf.deb ... 160s Unpacking ncbi-blast+ (2.16.0+ds-6build1) ... 160s Selecting previously unselected package ncbi-blast+-legacy. 160s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6build1_all.deb ... 160s Unpacking ncbi-blast+-legacy (2.16.0+ds-6build1) ... 160s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 160s Setting up libgomp1:armhf (15-20250404-0ubuntu1) ... 160s Setting up libmbedcrypto16:armhf (3.6.2-3ubuntu1) ... 160s Setting up libmbedx509-7:armhf (3.6.2-3ubuntu1) ... 160s Setting up libmbedtls21:armhf (3.6.2-3ubuntu1) ... 160s Setting up ncbi-blast+ (2.16.0+ds-6build1) ... 160s Setting up ncbi-blast+-legacy (2.16.0+ds-6build1) ... 160s Processing triggers for man-db (2.13.0-1) ... 160s Processing triggers for libc-bin (2.41-6ubuntu1) ... 169s autopkgtest [14:59:10]: test run-unit-test: [----------------------- 171s ---Creating Database-- 171s 171s 171s Building a new DB, current time: 05/04/2025 14:59:12 171s New DB name: /tmp/autopkgtest.XBTImt/autopkgtest_tmp/testdb 171s New DB title: testdatabase.fa 171s Sequence type: Nucleotide 171s Keep MBits: T 171s Maximum file size: 3000000000B 171s Adding sequences from FASTA; added 3 sequences in 0.222553 seconds. 171s 171s 171s ---Searching Database for Hits--- 172s Warning: [blastn] Examining 5 or more matches is recommended 172s # BLASTN 2.16.0+ 172s # Query: gnl|MYDB|1 this is sequence 1 172s # Database: testdb 172s # Fields: query id, subject id, evalue, bit score 172s # 2 hits found 172s gnl|MYDB|1 gnl2 0.0 1299 172s gnl|MYDB|1 gnl1 0.0 1299 172s # BLAST processed 1 queries 172s ---Search and Fetch An Entry From Database--- 172s >gnl1 172s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 172s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 172s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 172s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 172s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 172s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 172s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 172s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 172s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 172s PASS 172s autopkgtest [14:59:13]: test run-unit-test: -----------------------] 176s run-unit-test PASS 176s autopkgtest [14:59:17]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 179s autopkgtest [14:59:20]: @@@@@@@@@@@@@@@@@@@@ summary 179s run-unit-test PASS