0s autopkgtest [19:37:21]: starting date and time: 2025-03-15 19:37:21+0000 0s autopkgtest [19:37:21]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [19:37:21]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.b8e4j_t1/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade unikmer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-s390x-11.secgroup --name adt-plucky-s390x-unikmer-20250315-193720-juju-7f2275-prod-proposed-migration-environment-2-ad487f40-4abd-44f5-806d-a8780c66cdaa --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 114s autopkgtest [19:39:15]: testbed dpkg architecture: s390x 114s autopkgtest [19:39:15]: testbed apt version: 2.9.33 114s autopkgtest [19:39:15]: @@@@@@@@@@@@@@@@@@@@ test bed setup 114s autopkgtest [19:39:15]: testbed release detected to be: None 115s autopkgtest [19:39:16]: updating testbed package index (apt update) 115s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 116s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 116s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 116s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 116s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [14.5 kB] 116s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [45.1 kB] 116s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [369 kB] 116s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [77.3 kB] 116s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x c-n-f Metadata [1824 B] 116s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted s390x c-n-f Metadata [116 B] 116s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [314 kB] 116s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x c-n-f Metadata [13.3 kB] 116s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [3532 B] 116s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x c-n-f Metadata [240 B] 117s Fetched 965 kB in 1s (964 kB/s) 117s Reading package lists... 118s Reading package lists... 118s Building dependency tree... 118s Reading state information... 118s Calculating upgrade... 118s Calculating upgrade... 118s The following packages were automatically installed and are no longer required: 118s libnsl2 libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 118s linux-headers-6.11.0-8 linux-headers-6.11.0-8-generic 118s linux-modules-6.11.0-8-generic linux-tools-6.11.0-8 118s linux-tools-6.11.0-8-generic 118s Use 'sudo apt autoremove' to remove them. 118s The following packages will be upgraded: 118s pinentry-curses python3-jinja2 strace 118s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 118s Need to get 652 kB of archives. 118s After this operation, 27.6 kB of additional disk space will be used. 118s Get:1 http://ftpmaster.internal/ubuntu plucky/main s390x strace s390x 6.13+ds-1ubuntu1 [500 kB] 119s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x pinentry-curses s390x 1.3.1-2ubuntu3 [42.9 kB] 119s Get:3 http://ftpmaster.internal/ubuntu plucky/main s390x python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 119s Fetched 652 kB in 1s (1008 kB/s) 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 119s Preparing to unpack .../strace_6.13+ds-1ubuntu1_s390x.deb ... 119s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 119s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_s390x.deb ... 119s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 119s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 119s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 119s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 119s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 119s Setting up strace (6.13+ds-1ubuntu1) ... 119s Processing triggers for man-db (2.13.0-1) ... 120s Reading package lists... 120s Building dependency tree... 120s Reading state information... 120s Solving dependencies... 120s The following packages will be REMOVED: 120s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 120s linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 120s linux-modules-6.11.0-8-generic* linux-tools-6.11.0-8* 120s linux-tools-6.11.0-8-generic* 120s 0 upgraded, 0 newly installed, 9 to remove and 5 not upgraded. 120s After this operation, 167 MB disk space will be freed. 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 120s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 120s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 120s Removing libpython3.12t64:s390x (3.12.9-1) ... 120s Removing libpython3.12-stdlib:s390x (3.12.9-1) ... 120s Removing libnsl2:s390x (1.3.0-3build3) ... 120s Removing libpython3.12-minimal:s390x (3.12.9-1) ... 120s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 120s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 121s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 121s Processing triggers for libc-bin (2.41-1ubuntu1) ... 121s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56328 files and directories currently installed.) 121s Purging configuration files for libpython3.12-minimal:s390x (3.12.9-1) ... 121s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 122s autopkgtest [19:39:23]: upgrading testbed (apt dist-upgrade and autopurge) 122s Reading package lists... 122s Building dependency tree... 122s Reading state information... 122s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 122s Starting 2 pkgProblemResolver with broken count: 0 122s Done 122s Entering ResolveByKeep 122s 122s Calculating upgrade... 123s The following packages will be upgraded: 123s libc-bin libc-dev-bin libc6 libc6-dev locales 123s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 123s Need to get 9512 kB of archives. 123s After this operation, 8192 B of additional disk space will be used. 123s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6-dev s390x 2.41-1ubuntu2 [1678 kB] 123s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-dev-bin s390x 2.41-1ubuntu2 [24.3 kB] 123s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6 s390x 2.41-1ubuntu2 [2892 kB] 124s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-bin s390x 2.41-1ubuntu2 [671 kB] 124s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x locales all 2.41-1ubuntu2 [4246 kB] 125s Preconfiguring packages ... 125s Fetched 9512 kB in 2s (3894 kB/s) 125s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 125s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_s390x.deb ... 125s Unpacking libc6-dev:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 125s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_s390x.deb ... 125s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 125s Preparing to unpack .../libc6_2.41-1ubuntu2_s390x.deb ... 125s Unpacking libc6:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 125s Setting up libc6:s390x (2.41-1ubuntu2) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 126s Preparing to unpack .../libc-bin_2.41-1ubuntu2_s390x.deb ... 126s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 126s Setting up libc-bin (2.41-1ubuntu2) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 126s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 126s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 126s Setting up locales (2.41-1ubuntu2) ... 126s Generating locales (this might take a while)... 127s en_US.UTF-8... done 127s Generation complete. 127s Setting up libc-dev-bin (2.41-1ubuntu2) ... 127s Setting up libc6-dev:s390x (2.41-1ubuntu2) ... 127s Processing triggers for man-db (2.13.0-1) ... 128s Processing triggers for systemd (257.3-1ubuntu3) ... 129s Reading package lists... 129s Building dependency tree... 129s Reading state information... 129s Starting pkgProblemResolver with broken count: 0 129s Starting 2 pkgProblemResolver with broken count: 0 129s Done 129s Solving dependencies... 129s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 129s autopkgtest [19:39:30]: rebooting testbed after setup commands that affected boot 148s autopkgtest [19:39:49]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP Wed Mar 12 14:53:49 UTC 2025 150s autopkgtest [19:39:51]: @@@@@@@@@@@@@@@@@@@@ apt-source unikmer 153s Get:1 http://ftpmaster.internal/ubuntu plucky/universe unikmer 0.20.0-1 (dsc) [2144 B] 153s Get:2 http://ftpmaster.internal/ubuntu plucky/universe unikmer 0.20.0-1 (tar) [4228 kB] 153s Get:3 http://ftpmaster.internal/ubuntu plucky/universe unikmer 0.20.0-1 (diff) [5560 B] 153s gpgv: Signature made Sat Jul 6 09:00:41 2024 UTC 153s gpgv: using EDDSA key A095B66EE09024BEE6A2F0722A27904BD7243EDA 153s gpgv: Can't check signature: No public key 153s dpkg-source: warning: cannot verify inline signature for ./unikmer_0.20.0-1.dsc: no acceptable signature found 153s autopkgtest [19:39:54]: testing package unikmer version 0.20.0-1 153s autopkgtest [19:39:54]: build not needed 154s autopkgtest [19:39:55]: test run-unit-test: preparing testbed 154s Reading package lists... 154s Building dependency tree... 154s Reading state information... 154s Starting pkgProblemResolver with broken count: 0 154s Starting 2 pkgProblemResolver with broken count: 0 154s Done 155s The following NEW packages will be installed: 155s unikmer 155s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 155s Need to get 3021 kB of archives. 155s After this operation, 9921 kB of additional disk space will be used. 155s Get:1 http://ftpmaster.internal/ubuntu plucky/universe s390x unikmer s390x 0.20.0-1 [3021 kB] 156s Fetched 3021 kB in 1s (2653 kB/s) 156s Selecting previously unselected package unikmer. 156s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 156s Preparing to unpack .../unikmer_0.20.0-1_s390x.deb ... 156s Unpacking unikmer (0.20.0-1) ... 156s Setting up unikmer (0.20.0-1) ... 156s Processing triggers for man-db (2.13.0-1) ... 157s autopkgtest [19:39:58]: test run-unit-test: [----------------------- 158s Test 1 - counting and assigning taxid 158s 19:41:24.607 [INFO] flag -s/--sort overides -c/--compact 159s 19:41:25.809 [INFO] flag -s/--sort overides -c/--compact 160s 19:41:26.976 [INFO] flag -s/--sort overides -c/--compact 161s ================================= 161s PASS 161s Test 2 - view taxid 161s AAAAAAAAACCATCCAAATCTGG 511145 161s AAAAAAAAACCGCTAGTATATTC 511145 161s AAAAAAAAACCTGAAAAAAACGG 511145 161s ================================== 161s PASS 161s Test 3 - check stats 161s file k canonical hashed scaled include-taxid global-taxid sorted compact gzipped version number description 161s A.muciniphila-ATCC_BAA-835.fasta.gz.sorted.unik 23 ✓ ✕ ✕ ✕ 349741 ✓ ✕ ✓ v5.0 2,630,905 161s Ecoli-IAI39.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 585057 ✓ ✕ ✓ v5.0 4,902,266 161s Ecoli-MG1655.fasta.gz.k23.sorted.unik 23 ✓ ✕ ✕ ✕ 511145 ✓ ✕ ✓ v5.0 4,546,632 161s ================================== 161s PASS 161s autopkgtest [19:40:02]: test run-unit-test: -----------------------] 162s autopkgtest [19:40:03]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 162s run-unit-test PASS 162s autopkgtest [19:40:03]: @@@@@@@@@@@@@@@@@@@@ summary 162s run-unit-test PASS 169s nova [W] Using flock in prodstack6-s390x 169s Creating nova instance adt-plucky-s390x-unikmer-20250315-193720-juju-7f2275-prod-proposed-migration-environment-2-ad487f40-4abd-44f5-806d-a8780c66cdaa from image adt/ubuntu-plucky-s390x-server-20250315.img (UUID 3d3557fa-fd0f-4bba-9b89-8d5964e09f61)... 169s nova [W] Timed out waiting for b33aad5f-c964-4fd9-b7c3-ab82ab28b223 to get deleted.