0s autopkgtest [19:08:45]: starting date and time: 2025-03-15 19:08:45+0000 0s autopkgtest [19:08:45]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [19:08:45]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.j3cu_0j3/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade skewer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-s390x-11.secgroup --name adt-plucky-s390x-skewer-20250315-190845-juju-7f2275-prod-proposed-migration-environment-2-823ce055-93eb-4949-87b2-aa155eb3697c --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 144s autopkgtest [19:11:09]: testbed dpkg architecture: s390x 144s autopkgtest [19:11:09]: testbed apt version: 2.9.33 144s autopkgtest [19:11:09]: @@@@@@@@@@@@@@@@@@@@ test bed setup 144s autopkgtest [19:11:09]: testbed release detected to be: None 145s autopkgtest [19:11:10]: updating testbed package index (apt update) 145s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 146s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 146s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 146s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 146s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [369 kB] 146s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [14.5 kB] 146s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [45.1 kB] 146s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [77.3 kB] 146s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x c-n-f Metadata [1824 B] 146s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted s390x c-n-f Metadata [116 B] 146s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [314 kB] 147s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x c-n-f Metadata [13.3 kB] 147s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [3532 B] 147s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x c-n-f Metadata [240 B] 147s Fetched 965 kB in 1s (646 kB/s) 148s Reading package lists... 148s Reading package lists... 148s Building dependency tree... 148s Reading state information... 149s Calculating upgrade... 149s Calculating upgrade... 149s The following packages were automatically installed and are no longer required: 149s libnsl2 libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 149s linux-headers-6.11.0-8 linux-headers-6.11.0-8-generic 149s linux-modules-6.11.0-8-generic linux-tools-6.11.0-8 149s linux-tools-6.11.0-8-generic 149s Use 'sudo apt autoremove' to remove them. 149s The following packages will be upgraded: 149s pinentry-curses python3-jinja2 strace 149s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 149s Need to get 652 kB of archives. 149s After this operation, 27.6 kB of additional disk space will be used. 149s Get:1 http://ftpmaster.internal/ubuntu plucky/main s390x strace s390x 6.13+ds-1ubuntu1 [500 kB] 150s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x pinentry-curses s390x 1.3.1-2ubuntu3 [42.9 kB] 150s Get:3 http://ftpmaster.internal/ubuntu plucky/main s390x python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 150s Fetched 652 kB in 1s (664 kB/s) 150s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 150s Preparing to unpack .../strace_6.13+ds-1ubuntu1_s390x.deb ... 150s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 150s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_s390x.deb ... 150s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 150s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 150s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 150s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 150s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 150s Setting up strace (6.13+ds-1ubuntu1) ... 150s Processing triggers for man-db (2.13.0-1) ... 151s Reading package lists... 151s Building dependency tree... 151s Reading state information... 151s Solving dependencies... 151s The following packages will be REMOVED: 151s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 151s linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 151s linux-modules-6.11.0-8-generic* linux-tools-6.11.0-8* 151s linux-tools-6.11.0-8-generic* 152s 0 upgraded, 0 newly installed, 9 to remove and 5 not upgraded. 152s After this operation, 167 MB disk space will be freed. 152s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 152s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 152s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 152s Removing libpython3.12t64:s390x (3.12.9-1) ... 152s Removing libpython3.12-stdlib:s390x (3.12.9-1) ... 152s Removing libnsl2:s390x (1.3.0-3build3) ... 152s Removing libpython3.12-minimal:s390x (3.12.9-1) ... 152s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 152s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 153s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 153s Processing triggers for libc-bin (2.41-1ubuntu1) ... 153s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56328 files and directories currently installed.) 153s Purging configuration files for libpython3.12-minimal:s390x (3.12.9-1) ... 153s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 153s autopkgtest [19:11:18]: upgrading testbed (apt dist-upgrade and autopurge) 153s Reading package lists... 153s Building dependency tree... 153s Reading state information... 154s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 154s Starting 2 pkgProblemResolver with broken count: 0 154s Done 154s Entering ResolveByKeep 154s 154s Calculating upgrade... 154s The following packages will be upgraded: 154s libc-bin libc-dev-bin libc6 libc6-dev locales 154s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 154s Need to get 9512 kB of archives. 154s After this operation, 8192 B of additional disk space will be used. 154s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6-dev s390x 2.41-1ubuntu2 [1678 kB] 156s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-dev-bin s390x 2.41-1ubuntu2 [24.3 kB] 156s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6 s390x 2.41-1ubuntu2 [2892 kB] 158s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-bin s390x 2.41-1ubuntu2 [671 kB] 158s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x locales all 2.41-1ubuntu2 [4246 kB] 161s Preconfiguring packages ... 161s Fetched 9512 kB in 7s (1440 kB/s) 161s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 161s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_s390x.deb ... 161s Unpacking libc6-dev:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 161s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_s390x.deb ... 161s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 161s Preparing to unpack .../libc6_2.41-1ubuntu2_s390x.deb ... 161s Unpacking libc6:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 161s Setting up libc6:s390x (2.41-1ubuntu2) ... 161s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 161s Preparing to unpack .../libc-bin_2.41-1ubuntu2_s390x.deb ... 161s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 161s Setting up libc-bin (2.41-1ubuntu2) ... 161s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 161s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 161s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 162s Setting up locales (2.41-1ubuntu2) ... 162s Generating locales (this might take a while)... 163s en_US.UTF-8... done 163s Generation complete. 163s Setting up libc-dev-bin (2.41-1ubuntu2) ... 163s Setting up libc6-dev:s390x (2.41-1ubuntu2) ... 163s Processing triggers for man-db (2.13.0-1) ... 164s Processing triggers for systemd (257.3-1ubuntu3) ... 164s Reading package lists... 165s Building dependency tree... 165s Reading state information... 165s Starting pkgProblemResolver with broken count: 0 165s Starting 2 pkgProblemResolver with broken count: 0 165s Done 165s Solving dependencies... 165s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 165s autopkgtest [19:11:30]: rebooting testbed after setup commands that affected boot 185s autopkgtest [19:11:50]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP Wed Mar 12 14:53:49 UTC 2025 187s autopkgtest [19:11:52]: @@@@@@@@@@@@@@@@@@@@ apt-source skewer 189s Get:1 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (dsc) [1941 B] 189s Get:2 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (tar) [36.4 kB] 189s Get:3 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (diff) [21.8 kB] 189s gpgv: Signature made Sun Oct 31 14:43:32 2021 UTC 189s gpgv: using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1 189s gpgv: issuer "nilesh@debian.org" 189s gpgv: Can't check signature: No public key 189s dpkg-source: warning: cannot verify inline signature for ./skewer_0.2.2-6.dsc: no acceptable signature found 189s autopkgtest [19:11:54]: testing package skewer version 0.2.2-6 189s autopkgtest [19:11:54]: build not needed 190s autopkgtest [19:11:55]: test run-unit-test: preparing testbed 190s Reading package lists... 190s Building dependency tree... 190s Reading state information... 190s Starting pkgProblemResolver with broken count: 0 190s Starting 2 pkgProblemResolver with broken count: 0 190s Done 191s The following NEW packages will be installed: 191s skewer 191s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 191s Need to get 82.5 kB of archives. 191s After this operation, 189 kB of additional disk space will be used. 191s Get:1 http://ftpmaster.internal/ubuntu plucky/universe s390x skewer s390x 0.2.2-6 [82.5 kB] 191s Fetched 82.5 kB in 0s (265 kB/s) 191s Selecting previously unselected package skewer. 191s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 191s Preparing to unpack .../skewer_0.2.2-6_s390x.deb ... 191s Unpacking skewer (0.2.2-6) ... 191s Setting up skewer (0.2.2-6) ... 192s autopkgtest [19:11:57]: test run-unit-test: [----------------------- 192s .--. .-. 192s : .--': :.-. 192s `. `. : `'.' .--. .-..-..-. .--. .--. 192s _`, :: . `.' '_.': `; `; :' '_.': ..' 192s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 192s skewer v0.2.2 [April 4, 2016] 192s Parameters used: 192s -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGT 192s -- maximum error ratio allowed (-r): 0.100 192s -- maximum indel error ratio allowed (-d): 0.000 192s -- minimum read length allowed after trimming (-l): 16 192s -- maximum read length for output (-L): 30 192s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 192s -- minimum overlap length for adapter detection (-k): 3 192s Sat Mar 15 19:13:23 2025 >> started 192s 192s Sat Mar 15 19:13:23 2025 >> done (0.002s) 192s 24 reads processed; of these: 192s 0 ( 0.00%) short reads filtered out after trimming by size control 192s 0 ( 0.00%) empty reads filtered out after trimming by size control 192s 24 (100.00%) long reads filtered out after trimming by size control 192s 0 ( 0.00%) reads available. 192s log has been saved to "output-trimmed.log". 192s |==> | (7.73%) |======> | (15.79%) |==========> | (23.94%) |==============> | (31.73%) |==================> | (39.85%) |======================> | (47.86%) |===========================> | (56.12%) |===============================> | (64.20%) |===================================> | (72.21%) |=======================================> | (80.23%) |===========================================> | (88.12%) |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 192s |================================================> | (99.99%).--. .-. 192s : .--': :.-. 192s `. `. : `'.' .--. .-..-..-. .--. .--. 192s _`, :: . `.' '_.': `; `; :' '_.': ..' 192s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 192s skewer v0.2.2 [April 4, 2016] 192s Parameters used: 192s -- 3' end adapter sequences in file (-x): adapters.fa 192s A: ATGCGATCGACTCGACTAC 192s -- maximum error ratio allowed (-r): 0.100 192s -- maximum indel error ratio allowed (-d): 0.030 192s -- mean quality threshold (-Q): 9 192s -- minimum read length allowed after trimming (-l): 18 192s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 192s -- minimum overlap length for adapter detection (-k): 3 192s -- number of concurrent threads (-t): 2 192s Sat Mar 15 19:13:23 2025 >> started 192s 192s Sat Mar 15 19:13:23 2025 >> done (0.003s) 192s 24 reads processed; of these: 192s 0 ( 0.00%) short reads filtered out after trimming by size control 192s 0 ( 0.00%) empty reads filtered out after trimming by size control 192s 24 (100.00%) reads available; of these: 192s 24 (100.00%) untrimmed reads available after processing 192s log has been saved to "trimmed-trimmed.log". 192s output-trimmed.log 192s trimmed-trimmed.log 192s PASS 192s |======> | (15.79%) |==============> | (31.73%) |======================> | (47.86%) |===============================> | (64.20%) |=======================================> | (80.23%) |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 193s |================================================> | (99.99%)autopkgtest [19:11:58]: test run-unit-test: -----------------------] 193s run-unit-test PASS 193s autopkgtest [19:11:58]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 194s autopkgtest [19:11:59]: @@@@@@@@@@@@@@@@@@@@ summary 194s run-unit-test PASS 200s nova [W] Using flock in prodstack6-s390x 200s Creating nova instance adt-plucky-s390x-skewer-20250315-190845-juju-7f2275-prod-proposed-migration-environment-2-823ce055-93eb-4949-87b2-aa155eb3697c from image adt/ubuntu-plucky-s390x-server-20250315.img (UUID 3d3557fa-fd0f-4bba-9b89-8d5964e09f61)... 200s nova [W] Timed out waiting for 63ef415c-28af-4039-92dd-8b9bee6b0a22 to get deleted.