0s autopkgtest [19:04:58]: starting date and time: 2025-03-15 19:04:58+0000 0s autopkgtest [19:04:58]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [19:04:58]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.cgyiyjxk/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-s390x-5.secgroup --name adt-plucky-s390x-seqkit-20250315-190458-juju-7f2275-prod-proposed-migration-environment-2-3be55cab-f07f-44f5-8d94-f7184dc5da3a --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 122s autopkgtest [19:07:00]: testbed dpkg architecture: s390x 122s autopkgtest [19:07:00]: testbed apt version: 2.9.33 122s autopkgtest [19:07:00]: @@@@@@@@@@@@@@@@@@@@ test bed setup 122s autopkgtest [19:07:00]: testbed release detected to be: None 123s autopkgtest [19:07:01]: updating testbed package index (apt update) 124s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 124s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 124s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 124s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 124s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [99.7 kB] 124s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [379 kB] 124s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 124s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [113 kB] 125s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x c-n-f Metadata [1824 B] 125s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted s390x c-n-f Metadata [116 B] 125s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [320 kB] 125s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x c-n-f Metadata [13.4 kB] 125s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [3776 B] 125s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x c-n-f Metadata [240 B] 125s Fetched 1073 kB in 1s (778 kB/s) 126s Reading package lists... 126s Reading package lists... 126s Building dependency tree... 126s Reading state information... 127s Calculating upgrade... 127s Calculating upgrade... 127s The following packages were automatically installed and are no longer required: 127s libnsl2 libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 127s linux-headers-6.11.0-8 linux-headers-6.11.0-8-generic 127s linux-modules-6.11.0-8-generic linux-tools-6.11.0-8 127s linux-tools-6.11.0-8-generic 127s Use 'sudo apt autoremove' to remove them. 127s The following packages will be upgraded: 127s pinentry-curses python3-jinja2 strace 127s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 127s Need to get 652 kB of archives. 127s After this operation, 27.6 kB of additional disk space will be used. 127s Get:1 http://ftpmaster.internal/ubuntu plucky/main s390x strace s390x 6.13+ds-1ubuntu1 [500 kB] 127s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x pinentry-curses s390x 1.3.1-2ubuntu3 [42.9 kB] 127s Get:3 http://ftpmaster.internal/ubuntu plucky/main s390x python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 128s Fetched 652 kB in 1s (845 kB/s) 128s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 128s Preparing to unpack .../strace_6.13+ds-1ubuntu1_s390x.deb ... 128s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 128s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_s390x.deb ... 128s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 128s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 128s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 128s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 128s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 128s Setting up strace (6.13+ds-1ubuntu1) ... 128s Processing triggers for man-db (2.13.0-1) ... 129s Reading package lists... 129s Building dependency tree... 129s Reading state information... 129s Solving dependencies... 129s The following packages will be REMOVED: 129s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 129s linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 129s linux-modules-6.11.0-8-generic* linux-tools-6.11.0-8* 129s linux-tools-6.11.0-8-generic* 129s 0 upgraded, 0 newly installed, 9 to remove and 5 not upgraded. 129s After this operation, 167 MB disk space will be freed. 129s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 129s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 129s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 129s Removing libpython3.12t64:s390x (3.12.9-1) ... 129s Removing libpython3.12-stdlib:s390x (3.12.9-1) ... 129s Removing libnsl2:s390x (1.3.0-3build3) ... 129s Removing libpython3.12-minimal:s390x (3.12.9-1) ... 129s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 130s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 130s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 130s Processing triggers for libc-bin (2.41-1ubuntu1) ... 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56328 files and directories currently installed.) 130s Purging configuration files for libpython3.12-minimal:s390x (3.12.9-1) ... 130s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 131s autopkgtest [19:07:09]: upgrading testbed (apt dist-upgrade and autopurge) 131s Reading package lists... 131s Building dependency tree... 131s Reading state information... 131s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 131s Starting 2 pkgProblemResolver with broken count: 0 131s Done 131s Entering ResolveByKeep 132s 132s Calculating upgrade... 132s The following packages will be upgraded: 132s libc-bin libc-dev-bin libc6 libc6-dev locales 132s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 132s Need to get 9512 kB of archives. 132s After this operation, 8192 B of additional disk space will be used. 132s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6-dev s390x 2.41-1ubuntu2 [1678 kB] 133s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-dev-bin s390x 2.41-1ubuntu2 [24.3 kB] 133s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6 s390x 2.41-1ubuntu2 [2892 kB] 135s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-bin s390x 2.41-1ubuntu2 [671 kB] 136s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x locales all 2.41-1ubuntu2 [4246 kB] 139s Preconfiguring packages ... 139s Fetched 9512 kB in 7s (1385 kB/s) 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 139s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_s390x.deb ... 139s Unpacking libc6-dev:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 139s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_s390x.deb ... 139s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 139s Preparing to unpack .../libc6_2.41-1ubuntu2_s390x.deb ... 139s Unpacking libc6:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 139s Setting up libc6:s390x (2.41-1ubuntu2) ... 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 139s Preparing to unpack .../libc-bin_2.41-1ubuntu2_s390x.deb ... 139s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 139s Setting up libc-bin (2.41-1ubuntu2) ... 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 139s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 139s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 140s Setting up locales (2.41-1ubuntu2) ... 140s Generating locales (this might take a while)... 141s en_US.UTF-8... done 141s Generation complete. 141s Setting up libc-dev-bin (2.41-1ubuntu2) ... 141s Setting up libc6-dev:s390x (2.41-1ubuntu2) ... 141s Processing triggers for man-db (2.13.0-1) ... 142s Processing triggers for systemd (257.3-1ubuntu3) ... 143s Reading package lists... 143s Building dependency tree... 143s Reading state information... 143s Starting pkgProblemResolver with broken count: 0 143s Starting 2 pkgProblemResolver with broken count: 0 143s Done 143s Solving dependencies... 143s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 143s autopkgtest [19:07:21]: rebooting testbed after setup commands that affected boot 157s autopkgtest-virt-ssh: WARNING: ssh connection failed. Retrying in 3 seconds... 164s autopkgtest [19:07:42]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP Wed Mar 12 14:53:49 UTC 2025 166s autopkgtest [19:07:44]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 188s Get:1 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (dsc) [3288 B] 188s Get:2 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (tar) [16.6 MB] 188s Get:3 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (diff) [10.8 MB] 188s gpgv: Signature made Thu Jan 9 12:18:12 2025 UTC 188s gpgv: using RSA key 4A5FD1CD115087CC03DC35C1D597897206C5F07F 188s gpgv: issuer "maytha8thedev@gmail.com" 188s gpgv: Can't check signature: No public key 188s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.9.0+ds-1.dsc: no acceptable signature found 189s autopkgtest [19:08:07]: testing package seqkit version 2.9.0+ds-1 191s autopkgtest [19:08:09]: build not needed 194s autopkgtest [19:08:12]: test run-unit-test: preparing testbed 194s Reading package lists... 194s Building dependency tree... 194s Reading state information... 194s Starting pkgProblemResolver with broken count: 0 194s Starting 2 pkgProblemResolver with broken count: 0 194s Done 195s The following NEW packages will be installed: 195s seqkit seqkit-examples ssshtest 195s 0 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. 195s Need to get 46.7 MB of archives. 195s After this operation, 59.0 MB of additional disk space will be used. 195s Get:1 http://ftpmaster.internal/ubuntu plucky/universe s390x seqkit s390x 2.9.0+ds-1 [7163 kB] 200s Get:2 http://ftpmaster.internal/ubuntu plucky/universe s390x seqkit-examples all 2.9.0+ds-1 [39.6 MB] 228s Get:3 http://ftpmaster.internal/ubuntu plucky/universe s390x ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 229s Fetched 46.7 MB in 34s (1383 kB/s) 229s Selecting previously unselected package seqkit. 229s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 229s Preparing to unpack .../seqkit_2.9.0+ds-1_s390x.deb ... 229s Unpacking seqkit (2.9.0+ds-1) ... 229s Selecting previously unselected package seqkit-examples. 229s Preparing to unpack .../seqkit-examples_2.9.0+ds-1_all.deb ... 229s Unpacking seqkit-examples (2.9.0+ds-1) ... 229s Selecting previously unselected package ssshtest. 229s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 229s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 229s Setting up seqkit (2.9.0+ds-1) ... 229s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 229s Setting up seqkit-examples (2.9.0+ds-1) ... 229s Processing triggers for man-db (2.13.0-1) ... 231s autopkgtest [19:08:49]: test run-unit-test: [----------------------- 231s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 232s 232s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 232s PASS "28645" == "28645" (LINE 28) 232s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 232s 232s seq_type ran in 0 sec with 2/92423 lines to STDERR/OUT 232s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 232s 232s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "Protein" (LINE 42) 232s 232s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "RNA" (LINE 48) 232s 232s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "DNA" (LINE 54) 232s 232s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "DNA" (LINE 60) 232s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 232s 232s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 232s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 232s 232s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 232s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 232s 232s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 232s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 232s 232s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 232s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 232s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 232s 232s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 232s 232s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 232s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 232s 232s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 232s PASS "a" == "a" (LINE 117) 232s 232s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 232s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 232s 232s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 232s PASS "gtn" == "gtn" (LINE 129) 232s 232s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 232s PASS "ACG" == "ACG" (LINE 135) 232s 232s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 232s PASS "N" == "N" (LINE 141) 232s 232s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 232s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 232s 232s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 232s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 232s 232s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 232s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 233s 233s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 233s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 233s 233s sliding ran in 1 sec with 0/2 lines to STDERR/OUT 233s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 233s 233s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 233s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 233s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 233s [ERRO] xopen: no content 233s 233s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 233s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 233s 233s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 233s Length correlation: 233s PASS "1" == "1" (LINE 220) 233s Length correlation: 233s PASS "1" == "1" (LINE 224) 233s Qual correlation: 233s PASS "1" == "1" (LINE 228) 233s 233s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 234s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 234s 234s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 234s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 234s 234s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT 234s PASS "100" == "100" (LINE 249) 234s 234s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 234s PASS "3074" == "3074" (LINE 254) 234s 234s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 234s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 234s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 234s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 234s 234s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 234s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 234s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 234s [INFO] 0 duplicated records removed 234s [INFO] sample by proportion 234s [INFO] 2814 sequences outputted 234s 234s common ran in 0 sec with 5/0 lines to STDERR/OUT 234s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 299) 234s 234s split ran in 0 sec with 104/0 lines to STDERR/OUT 234s [INFO] 0 duplicated records removed 234s PASS "100" == "100" (LINE 316) 234s [INFO] 0 duplicated records removed 234s PASS "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" == "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" (LINE 317) 234s [INFO] sample by proportion 235s [INFO] 2814 sequences outputted 235s [INFO] sample by proportion 235s [INFO] 2814 sequences outputted 235s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 324) 235s 235s head ran in 0 sec with 0/30 lines to STDERR/OUT 235s PASS "10" == "10" (LINE 332) 235s PASS "snq" == "snq" (LINE 341) 235s PASS "seq_2" == "seq_2" (LINE 350) 235s 235s restart ran in 0 sec with 0/2 lines to STDERR/OUT 235s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 235s 235s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 235s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 235s 235s shuffle ran in 0 sec with 20/0 lines to STDERR/OUT 235s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 389) 235s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 236s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 393) 236s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 394) 236s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 395) 236s 236s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 422) 236s 236s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 432) 236s 236s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 442) 236s 236s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 452) 236s 236s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 462) 236s 236s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 475) 236s 236s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 236s Correlation: 236s PASS "1" == "1" (LINE 488) 237s 237s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 237s PASS "0" == "0" (LINE 498) 237s 237s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 237s PASS EXIT CODE (LINE 516) 237s 237s sana_fastq_sep_id ran in 0 sec with 9/0 lines to STDERR/OUT 237s PASS "0" == "0" (LINE 529) 237s 237s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 237s PASS "0" == "0" (LINE 539) 238s 238s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 238s PASS "0" == "0" (LINE 550) 238s 238s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 238s PASS "0" == "0" (LINE 558) 238s 238s sana_fastq_regression ran in 1 sec with 1/0 lines to STDERR/OUT 238s PASS "0" == "0" (LINE 566) 240s 240s scat_fasta ran in 1 sec with 261/0 lines to STDERR/OUT 240s PASS "0" == "0" (LINE 615) 240s PASS "0" == "0" (LINE 617) 241s 241s scat_fastq ran in 1 sec with 531/0 lines to STDERR/OUT 241s PASS "0" == "0" (LINE 661) 241s PASS "0" == "0" (LINE 663) 241s [INFO] sample by number 241s [INFO] loading all sequences into memory... 241s [INFO] 9 sequences outputted 241s 241s faidx_id ran in 0 sec with 3/0 lines to STDERR/OUT 241s [INFO] 9 patterns loaded from file 241s [INFO] read sequences ... 241s [INFO] 9 sequences loaded 241s [INFO] sorting ... 241s [INFO] output ... 241s [INFO] read sequences ... 241s [INFO] 9 sequences loaded 241s [INFO] sorting ... 241s [INFO] output ... 241s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 679) 241s 241s faidx_full_head ran in 0 sec with 3/0 lines to STDERR/OUT 242s [INFO] read sequences ... 242s [INFO] 9 patterns loaded from file 242s [INFO] 9 sequences loaded 242s [INFO] sorting ... 242s [INFO] output ... 242s [INFO] read sequences ... 242s [INFO] 9 sequences loaded 242s [INFO] sorting ... 242s [INFO] output ... 242s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 686) 242s 242s faidx_region ran in 0 sec with 3/0 lines to STDERR/OUT 242s PASS "UCGGAAACCCAGGGGUAUUUUGCUCUUACGUUUCACUCGCGAGUGAAACGUUAGAGCAAAAUACUCCUGGGUUUCCGAGG" == "UCGGAAACCCAGGGGUAUUUUGCUCUUACGUUUCACUCGCGAGUGAAACGUUAGAGCAAAAUACUCCUGGGUUUCCGAGG" (LINE 695) 242s 242s sshtest v0.1.5 242s 242s 72 Tests 242s 0 Failures 242s 72 Successes 242s autopkgtest [19:09:00]: test run-unit-test: -----------------------] 242s autopkgtest [19:09:00]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 242s run-unit-test PASS 243s autopkgtest [19:09:01]: @@@@@@@@@@@@@@@@@@@@ summary 243s run-unit-test PASS 262s nova [W] Using flock in prodstack6-s390x 262s flock: timeout while waiting to get lock 262s Creating nova instance adt-plucky-s390x-seqkit-20250315-190458-juju-7f2275-prod-proposed-migration-environment-2-3be55cab-f07f-44f5-8d94-f7184dc5da3a from image adt/ubuntu-plucky-s390x-server-20250315.img (UUID 3d3557fa-fd0f-4bba-9b89-8d5964e09f61)... 262s nova [W] Timed out waiting for 0e6f3669-50c2-4340-97ba-69ec9eefe19e to get deleted.