0s autopkgtest [12:21:41]: starting date and time: 2024-11-13 12:21:41+0000 0s autopkgtest [12:21:41]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 0s autopkgtest [12:21:41]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.6vhfh4zy/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-s390x-18.secgroup --name adt-plucky-s390x-presto-20241113-122141-juju-7f2275-prod-proposed-migration-environment-2-d72101fc-9565-452f-9cc4-4d3c3733a531 --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 100s autopkgtest [12:23:21]: testbed dpkg architecture: s390x 100s autopkgtest [12:23:21]: testbed apt version: 2.9.8 100s autopkgtest [12:23:21]: @@@@@@@@@@@@@@@@@@@@ test bed setup 101s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 101s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [967 kB] 101s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [16.5 kB] 101s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 101s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [104 kB] 101s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [107 kB] 101s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [641 kB] 101s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [17.4 kB] 102s Fetched 1934 kB in 1s (2523 kB/s) 102s Reading package lists... 104s Reading package lists... 104s Building dependency tree... 104s Reading state information... 104s Calculating upgrade... 104s The following NEW packages will be installed: 104s python3.13-gdbm 104s The following packages will be upgraded: 104s libgpgme11t64 libpython3-stdlib python3 python3-gdbm python3-minimal 104s 5 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 104s Need to get 252 kB of archives. 104s After this operation, 98.3 kB of additional disk space will be used. 104s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3-minimal s390x 3.12.7-1 [27.4 kB] 104s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3 s390x 3.12.7-1 [24.0 kB] 104s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libpython3-stdlib s390x 3.12.7-1 [10.0 kB] 104s Get:4 http://ftpmaster.internal/ubuntu plucky/main s390x python3.13-gdbm s390x 3.13.0-2 [31.0 kB] 104s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3-gdbm s390x 3.12.7-1 [8642 B] 104s Get:6 http://ftpmaster.internal/ubuntu plucky/main s390x libgpgme11t64 s390x 1.23.2-5ubuntu4 [151 kB] 105s Fetched 252 kB in 0s (590 kB/s) 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55510 files and directories currently installed.) 105s Preparing to unpack .../python3-minimal_3.12.7-1_s390x.deb ... 105s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 105s Setting up python3-minimal (3.12.7-1) ... 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55510 files and directories currently installed.) 105s Preparing to unpack .../python3_3.12.7-1_s390x.deb ... 105s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 105s Preparing to unpack .../libpython3-stdlib_3.12.7-1_s390x.deb ... 105s Unpacking libpython3-stdlib:s390x (3.12.7-1) over (3.12.6-0ubuntu1) ... 105s Selecting previously unselected package python3.13-gdbm. 105s Preparing to unpack .../python3.13-gdbm_3.13.0-2_s390x.deb ... 105s Unpacking python3.13-gdbm (3.13.0-2) ... 105s Preparing to unpack .../python3-gdbm_3.12.7-1_s390x.deb ... 105s Unpacking python3-gdbm:s390x (3.12.7-1) over (3.12.6-1ubuntu1) ... 105s Preparing to unpack .../libgpgme11t64_1.23.2-5ubuntu4_s390x.deb ... 105s Unpacking libgpgme11t64:s390x (1.23.2-5ubuntu4) over (1.18.0-4.1ubuntu4) ... 105s Setting up libgpgme11t64:s390x (1.23.2-5ubuntu4) ... 105s Setting up python3.13-gdbm (3.13.0-2) ... 105s Setting up libpython3-stdlib:s390x (3.12.7-1) ... 105s Setting up python3 (3.12.7-1) ... 105s Setting up python3-gdbm:s390x (3.12.7-1) ... 105s Processing triggers for man-db (2.12.1-3) ... 106s Processing triggers for libc-bin (2.40-1ubuntu3) ... 106s Reading package lists... 106s Building dependency tree... 106s Reading state information... 106s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 107s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 107s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 107s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 107s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 107s Reading package lists... 108s Reading package lists... 108s Building dependency tree... 108s Reading state information... 108s Calculating upgrade... 108s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 108s Reading package lists... 108s Building dependency tree... 108s Reading state information... 108s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 111s autopkgtest [12:23:32]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP Mon Sep 16 12:49:35 UTC 2024 111s autopkgtest [12:23:32]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 113s Get:1 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (dsc) [2233 B] 113s Get:2 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (tar) [362 kB] 113s Get:3 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (diff) [20.8 kB] 113s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC 113s gpgv: using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7 113s gpgv: Can't check signature: No public key 113s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found 113s autopkgtest [12:23:34]: testing package presto version 0.7.2-1 114s autopkgtest [12:23:35]: build not needed 114s autopkgtest [12:23:35]: test pybuild-autopkgtest: preparing testbed 115s Reading package lists... 116s Building dependency tree... 116s Reading state information... 116s Starting pkgProblemResolver with broken count: 0 116s Starting 2 pkgProblemResolver with broken count: 0 116s Done 116s The following additional packages will be installed: 116s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-14 116s cpp-14-s390x-linux-gnu cpp-s390x-linux-gnu debhelper debugedit dh-autoreconf 116s dh-python dh-strip-nondeterminism dwz fontconfig-config fonts-dejavu-core 116s fonts-dejavu-mono fonts-urw-base35 g++ g++-14 g++-14-s390x-linux-gnu 116s g++-s390x-linux-gnu gcc gcc-14 gcc-14-s390x-linux-gnu gcc-s390x-linux-gnu 116s gettext intltool-debian libarchive-zip-perl libasan8 libblas3 libcairo2 116s libcc1-0 libdebhelper-perl libdeflate0 libfile-stripnondeterminism-perl 116s libfontconfig1 libfontenc1 libfreetype6 libgcc-14-dev libgfortran5 libgomp1 116s libgraphite2-3 libharfbuzz0b libimagequant0 libisl23 libitm1 libjbig0 116s libjpeg-turbo8 libjpeg8 liblapack3 liblbfgsb0 liblcms2-2 libmbedcrypto7t64 116s libmbedtls14t64 libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 116s libpython3.13-minimal libpython3.13-stdlib libraqm0 libsharpyuv0 116s libstdc++-14-dev libtiff6 libtool libubsan1 libwebp7 libwebpdemux2 116s libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data 116s po-debconf presto pybuild-plugin-autopkgtest python3-all python3-biopython 116s python3-cairo python3-dateutil python3-decorator python3-freetype 116s python3-numpy python3-packaging python3-pandas python3-pandas-lib 116s python3-pil python3-presto python3-reportlab python3-rlpycairo python3-scipy 116s python3-six python3-tz python3.13 python3.13-minimal sgml-base w3c-sgml-lib 116s x11-common xfonts-encodings xfonts-utils xml-core 116s Suggested packages: 116s autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-14-locales 116s cpp-14-doc dh-make flit python3-build python3-installer python3-wheel 116s fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre gcc-14-doc 116s gcc-multilib manpages-dev flex bison gdb gcc-doc gdb-s390x-linux-gnu 116s gettext-doc libasprintf-dev libgettextpo-dev liblcms2-utils libstdc++-14-doc 116s libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc libmail-box-perl 116s python3-tk bwa clustalo clustalw dialign dssp emboss fasttree mafft muscle3 116s phylip phyml prank probcons python3-mysqldb python3-matplotlib python3-mmtf 116s python3-rdflib python3-psycopg2 raxml samtools t-coffee wise gfortran 116s python-numpy-doc python3-dev python3-pytest python-pandas-doc 116s python3-statsmodels python-pil-doc pdf-viewer python3-egenix-mxtexttools 116s python-reportlab-doc rl-accel rl-renderpm python-scipy-doc python3.13-venv 116s python3.13-doc binfmt-support sgml-base-doc 116s Recommended packages: 116s libarchive-cpio-perl libltdl-dev libmail-sendmail-perl python-biopython-doc 116s python3-matplotlib python3-bottleneck python3-numexpr python3-odf 116s python3-openpyxl python3-bs4 python3-html5lib python3-lxml python3-tables 116s python3-olefile fonts-dejavu-extra 116s The following NEW packages will be installed: 116s autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential 116s cd-hit cpp cpp-14 cpp-14-s390x-linux-gnu cpp-s390x-linux-gnu debhelper 116s debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz 116s fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ 116s g++-14 g++-14-s390x-linux-gnu g++-s390x-linux-gnu gcc gcc-14 116s gcc-14-s390x-linux-gnu gcc-s390x-linux-gnu gettext intltool-debian 116s libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 libdebhelper-perl 116s libdeflate0 libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 116s libfreetype6 libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 116s libharfbuzz0b libimagequant0 libisl23 libitm1 libjbig0 libjpeg-turbo8 116s libjpeg8 liblapack3 liblbfgsb0 liblcms2-2 libmbedcrypto7t64 libmbedtls14t64 116s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal 116s libpython3.13-stdlib libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool 116s libubsan1 libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 116s libxrender1 m4 ncbi-blast+ ncbi-data po-debconf presto 116s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 116s python3-dateutil python3-decorator python3-freetype python3-numpy 116s python3-packaging python3-pandas python3-pandas-lib python3-pil 116s python3-presto python3-reportlab python3-rlpycairo python3-scipy python3-six 116s python3-tz python3.13 python3.13-minimal sgml-base w3c-sgml-lib x11-common 116s xfonts-encodings xfonts-utils xml-core 116s 0 upgraded, 107 newly installed, 0 to remove and 0 not upgraded. 116s Need to get 133 MB/133 MB of archives. 116s After this operation, 479 MB of additional disk space will be used. 116s Get:1 /tmp/autopkgtest.Vv7tPc/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [820 B] 116s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x libpython3.13-minimal s390x 3.13.0-2 [877 kB] 117s Get:3 http://ftpmaster.internal/ubuntu plucky/main s390x python3.13-minimal s390x 3.13.0-2 [2172 kB] 117s Get:4 http://ftpmaster.internal/ubuntu plucky/main s390x sgml-base all 1.31 [11.4 kB] 117s Get:5 http://ftpmaster.internal/ubuntu plucky/main s390x m4 s390x 1.4.19-4build1 [256 kB] 117s Get:6 http://ftpmaster.internal/ubuntu plucky/main s390x autoconf all 2.72-3 [382 kB] 117s Get:7 http://ftpmaster.internal/ubuntu plucky/main s390x autotools-dev all 20220109.1 [44.9 kB] 118s Get:8 http://ftpmaster.internal/ubuntu plucky/main s390x automake all 1:1.16.5-1.3ubuntu1 [558 kB] 118s Get:9 http://ftpmaster.internal/ubuntu plucky/main s390x autopoint all 0.22.5-2 [616 kB] 118s Get:10 http://ftpmaster.internal/ubuntu plucky/main s390x libisl23 s390x 0.27-1 [704 kB] 118s Get:11 http://ftpmaster.internal/ubuntu plucky/main s390x libmpc3 s390x 1.3.1-1build2 [57.8 kB] 118s Get:12 http://ftpmaster.internal/ubuntu plucky/main s390x cpp-14-s390x-linux-gnu s390x 14.2.0-8ubuntu1 [9570 kB] 119s Get:13 http://ftpmaster.internal/ubuntu plucky/main s390x cpp-14 s390x 14.2.0-8ubuntu1 [1026 B] 119s Get:14 http://ftpmaster.internal/ubuntu plucky/main s390x cpp-s390x-linux-gnu s390x 4:14.1.0-2ubuntu1 [5452 B] 119s Get:15 http://ftpmaster.internal/ubuntu plucky/main s390x cpp s390x 4:14.1.0-2ubuntu1 [22.4 kB] 119s Get:16 http://ftpmaster.internal/ubuntu plucky/main s390x libcc1-0 s390x 14.2.0-8ubuntu1 [50.6 kB] 119s Get:17 http://ftpmaster.internal/ubuntu plucky/main s390x libgomp1 s390x 14.2.0-8ubuntu1 [151 kB] 119s Get:18 http://ftpmaster.internal/ubuntu plucky/main s390x libitm1 s390x 14.2.0-8ubuntu1 [30.9 kB] 119s Get:19 http://ftpmaster.internal/ubuntu plucky/main s390x libasan8 s390x 14.2.0-8ubuntu1 [2963 kB] 119s Get:20 http://ftpmaster.internal/ubuntu plucky/main s390x libubsan1 s390x 14.2.0-8ubuntu1 [1184 kB] 120s Get:21 http://ftpmaster.internal/ubuntu plucky/main s390x libgcc-14-dev s390x 14.2.0-8ubuntu1 [1037 kB] 120s Get:22 http://ftpmaster.internal/ubuntu plucky/main s390x gcc-14-s390x-linux-gnu s390x 14.2.0-8ubuntu1 [18.7 MB] 122s Get:23 http://ftpmaster.internal/ubuntu plucky/main s390x gcc-14 s390x 14.2.0-8ubuntu1 [518 kB] 122s Get:24 http://ftpmaster.internal/ubuntu plucky/main s390x gcc-s390x-linux-gnu s390x 4:14.1.0-2ubuntu1 [1204 B] 122s Get:25 http://ftpmaster.internal/ubuntu plucky/main s390x gcc s390x 4:14.1.0-2ubuntu1 [4996 B] 122s Get:26 http://ftpmaster.internal/ubuntu plucky/main s390x libstdc++-14-dev s390x 14.2.0-8ubuntu1 [2608 kB] 123s Get:27 http://ftpmaster.internal/ubuntu plucky/main s390x g++-14-s390x-linux-gnu s390x 14.2.0-8ubuntu1 [11.0 MB] 124s Get:28 http://ftpmaster.internal/ubuntu plucky/main s390x g++-14 s390x 14.2.0-8ubuntu1 [19.9 kB] 124s Get:29 http://ftpmaster.internal/ubuntu plucky/main s390x g++-s390x-linux-gnu s390x 4:14.1.0-2ubuntu1 [956 B] 124s Get:30 http://ftpmaster.internal/ubuntu plucky/main s390x g++ s390x 4:14.1.0-2ubuntu1 [1076 B] 124s Get:31 http://ftpmaster.internal/ubuntu plucky/main s390x build-essential s390x 12.10ubuntu1 [4930 B] 124s Get:32 http://ftpmaster.internal/ubuntu plucky/universe s390x cd-hit s390x 4.8.1-4 [521 kB] 124s Get:33 http://ftpmaster.internal/ubuntu plucky/main s390x libdebhelper-perl all 13.20ubuntu1 [94.2 kB] 124s Get:34 http://ftpmaster.internal/ubuntu plucky/main s390x libtool all 2.4.7-7build1 [166 kB] 124s Get:35 http://ftpmaster.internal/ubuntu plucky/main s390x dh-autoreconf all 20 [16.1 kB] 124s Get:36 http://ftpmaster.internal/ubuntu plucky/main s390x libarchive-zip-perl all 1.68-1 [90.2 kB] 124s Get:37 http://ftpmaster.internal/ubuntu plucky/main s390x libfile-stripnondeterminism-perl all 1.14.0-1 [20.1 kB] 124s Get:38 http://ftpmaster.internal/ubuntu plucky/main s390x dh-strip-nondeterminism all 1.14.0-1 [5058 B] 124s Get:39 http://ftpmaster.internal/ubuntu plucky/main s390x debugedit s390x 1:5.1-1 [49.9 kB] 124s Get:40 http://ftpmaster.internal/ubuntu plucky/main s390x dwz s390x 0.15-1build6 [122 kB] 124s Get:41 http://ftpmaster.internal/ubuntu plucky/main s390x gettext s390x 0.22.5-2 [996 kB] 125s Get:42 http://ftpmaster.internal/ubuntu plucky/main s390x intltool-debian all 0.35.0+20060710.6 [23.2 kB] 125s Get:43 http://ftpmaster.internal/ubuntu plucky/main s390x po-debconf all 1.0.21+nmu1 [233 kB] 125s Get:44 http://ftpmaster.internal/ubuntu plucky/main s390x debhelper all 13.20ubuntu1 [893 kB] 125s Get:45 http://ftpmaster.internal/ubuntu plucky/universe s390x dh-python all 6.20241024 [112 kB] 125s Get:46 http://ftpmaster.internal/ubuntu plucky/main s390x fonts-dejavu-mono all 2.37-8 [502 kB] 125s Get:47 http://ftpmaster.internal/ubuntu plucky/main s390x fonts-dejavu-core all 2.37-8 [835 kB] 125s Get:48 http://ftpmaster.internal/ubuntu plucky/main s390x libfontenc1 s390x 1:1.1.8-1build1 [14.8 kB] 125s Get:49 http://ftpmaster.internal/ubuntu plucky/main s390x libfreetype6 s390x 2.13.3+dfsg-1 [431 kB] 125s Get:50 http://ftpmaster.internal/ubuntu plucky/main s390x x11-common all 1:7.7+23ubuntu3 [21.7 kB] 125s Get:51 http://ftpmaster.internal/ubuntu plucky/main s390x xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 125s Get:52 http://ftpmaster.internal/ubuntu plucky/main s390x xfonts-utils s390x 1:7.7+7 [101 kB] 125s Get:53 http://ftpmaster.internal/ubuntu plucky/main s390x fonts-urw-base35 all 20200910-8 [11.0 MB] 126s Get:54 http://ftpmaster.internal/ubuntu plucky/main s390x fontconfig-config s390x 2.15.0-1.1ubuntu2 [37.4 kB] 126s Get:55 http://ftpmaster.internal/ubuntu plucky/main s390x libblas3 s390x 3.12.0-3build2 [238 kB] 126s Get:56 http://ftpmaster.internal/ubuntu plucky/main s390x libfontconfig1 s390x 2.15.0-1.1ubuntu2 [150 kB] 126s Get:57 http://ftpmaster.internal/ubuntu plucky/main s390x libpixman-1-0 s390x 0.44.0-3 [201 kB] 126s Get:58 http://ftpmaster.internal/ubuntu plucky/main s390x libxcb-render0 s390x 1.17.0-2 [17.0 kB] 126s Get:59 http://ftpmaster.internal/ubuntu plucky/main s390x libxcb-shm0 s390x 1.17.0-2 [5862 B] 127s Get:60 http://ftpmaster.internal/ubuntu plucky/main s390x libxrender1 s390x 1:0.9.10-1.1build1 [20.4 kB] 127s Get:61 http://ftpmaster.internal/ubuntu plucky/main s390x libcairo2 s390x 1.18.2-2 [580 kB] 127s Get:62 http://ftpmaster.internal/ubuntu plucky/main s390x libdeflate0 s390x 1.22-1 [46.1 kB] 127s Get:63 http://ftpmaster.internal/ubuntu plucky/main s390x libgfortran5 s390x 14.2.0-8ubuntu1 [587 kB] 127s Get:64 http://ftpmaster.internal/ubuntu plucky/main s390x libgraphite2-3 s390x 1.3.14-2ubuntu1 [79.8 kB] 127s Get:65 http://ftpmaster.internal/ubuntu plucky/main s390x libharfbuzz0b s390x 10.0.1-1 [536 kB] 127s Get:66 http://ftpmaster.internal/ubuntu plucky/main s390x libimagequant0 s390x 2.18.0-1build1 [43.3 kB] 127s Get:67 http://ftpmaster.internal/ubuntu plucky/main s390x libjpeg-turbo8 s390x 2.1.5-2ubuntu2 [150 kB] 127s Get:68 http://ftpmaster.internal/ubuntu plucky/main s390x libjpeg8 s390x 8c-2ubuntu11 [2146 B] 127s Get:69 http://ftpmaster.internal/ubuntu plucky/main s390x liblapack3 s390x 3.12.0-3build2 [2953 kB] 127s Get:70 http://ftpmaster.internal/ubuntu plucky/universe s390x liblbfgsb0 s390x 3.0+dfsg.4-1build1 [32.4 kB] 127s Get:71 http://ftpmaster.internal/ubuntu plucky/main s390x liblcms2-2 s390x 2.16-2 [175 kB] 127s Get:72 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedcrypto7t64 s390x 2.28.8-1 [219 kB] 127s Get:73 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedx509-1t64 s390x 2.28.8-1 [46.2 kB] 127s Get:74 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedtls14t64 s390x 2.28.8-1 [84.7 kB] 127s Get:75 http://ftpmaster.internal/ubuntu plucky/main s390x libpython3.13-stdlib s390x 3.13.0-2 [2086 kB] 127s Get:76 http://ftpmaster.internal/ubuntu plucky/main s390x libraqm0 s390x 0.10.1-1build1 [16.2 kB] 127s Get:77 http://ftpmaster.internal/ubuntu plucky/main s390x libsharpyuv0 s390x 1.4.0-0.1 [16.2 kB] 127s Get:78 http://ftpmaster.internal/ubuntu plucky/main s390x libjbig0 s390x 2.1-6.1ubuntu2 [33.1 kB] 127s Get:79 http://ftpmaster.internal/ubuntu plucky/main s390x libwebp7 s390x 1.4.0-0.1 [204 kB] 127s Get:80 http://ftpmaster.internal/ubuntu plucky/main s390x libtiff6 s390x 4.5.1+git230720-4ubuntu4 [217 kB] 128s Get:81 http://ftpmaster.internal/ubuntu plucky/main s390x libwebpdemux2 s390x 1.4.0-0.1 [12.2 kB] 128s Get:82 http://ftpmaster.internal/ubuntu plucky/main s390x libwebpmux3 s390x 1.4.0-0.1 [25.3 kB] 128s Get:83 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 128s Get:84 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-blast+ s390x 2.16.0+ds-6 [15.2 MB] 130s Get:85 http://ftpmaster.internal/ubuntu plucky/main s390x python3-numpy s390x 1:1.26.4+ds-11build1 [4113 kB] 130s Get:86 http://ftpmaster.internal/ubuntu plucky/main s390x libopenjp2-7 s390x 2.5.0-2ubuntu1 [208 kB] 130s Get:87 http://ftpmaster.internal/ubuntu plucky/main s390x python3-pil s390x 10.4.0-1ubuntu1 [492 kB] 131s Get:88 http://ftpmaster.internal/ubuntu plucky/main s390x python3-cairo s390x 1.26.1-2 [119 kB] 131s Get:89 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-freetype all 2.5.1-1 [92.3 kB] 131s Get:90 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-rlpycairo all 0.3.0-3 [9130 B] 131s Get:91 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-reportlab all 4.2.5-1 [1107 kB] 131s Get:92 http://ftpmaster.internal/ubuntu plucky/main s390x xml-core all 0.19 [20.3 kB] 131s Get:93 http://ftpmaster.internal/ubuntu plucky/universe s390x w3c-sgml-lib all 1.3-3 [280 kB] 131s Get:94 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-biopython s390x 1.84+dfsg-4 [1721 kB] 131s Get:95 http://ftpmaster.internal/ubuntu plucky/main s390x python3-six all 1.16.0-7 [13.1 kB] 131s Get:96 http://ftpmaster.internal/ubuntu plucky/main s390x python3-dateutil all 2.9.0-2 [80.3 kB] 131s Get:97 http://ftpmaster.internal/ubuntu plucky/main s390x python3-tz all 2024.1-2 [31.4 kB] 131s Get:98 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-pandas-lib s390x 2.2.3+dfsg-5 [4938 kB] 131s Get:99 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-pandas all 2.2.3+dfsg-5 [3112 kB] 132s Get:100 http://ftpmaster.internal/ubuntu plucky/main s390x python3-decorator all 5.1.1-5 [10.1 kB] 132s Get:101 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-scipy s390x 1.13.1-5 [17.5 MB] 133s Get:102 http://ftpmaster.internal/ubuntu plucky/main s390x python3-packaging all 24.1-1 [41.4 kB] 134s Get:103 http://ftpmaster.internal/ubuntu plucky/universe s390x python3-presto s390x 0.7.2-1 [80.7 kB] 134s Get:104 http://ftpmaster.internal/ubuntu plucky/universe s390x presto all 0.7.2-1 [240 kB] 134s Get:105 http://ftpmaster.internal/ubuntu plucky/universe s390x pybuild-plugin-autopkgtest all 6.20241024 [1746 B] 134s Get:106 http://ftpmaster.internal/ubuntu plucky/main s390x python3.13 s390x 3.13.0-2 [719 kB] 134s Get:107 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3-all s390x 3.12.7-1 [890 B] 134s Fetched 133 MB in 18s (7485 kB/s) 134s Selecting previously unselected package libpython3.13-minimal:s390x. 134s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55517 files and directories currently installed.) 134s Preparing to unpack .../000-libpython3.13-minimal_3.13.0-2_s390x.deb ... 134s Unpacking libpython3.13-minimal:s390x (3.13.0-2) ... 134s Selecting previously unselected package python3.13-minimal. 134s Preparing to unpack .../001-python3.13-minimal_3.13.0-2_s390x.deb ... 134s Unpacking python3.13-minimal (3.13.0-2) ... 134s Selecting previously unselected package sgml-base. 134s Preparing to unpack .../002-sgml-base_1.31_all.deb ... 134s Unpacking sgml-base (1.31) ... 134s Selecting previously unselected package m4. 134s Preparing to unpack .../003-m4_1.4.19-4build1_s390x.deb ... 134s Unpacking m4 (1.4.19-4build1) ... 134s Selecting previously unselected package autoconf. 134s Preparing to unpack .../004-autoconf_2.72-3_all.deb ... 134s Unpacking autoconf (2.72-3) ... 134s Selecting previously unselected package autotools-dev. 135s Preparing to unpack .../005-autotools-dev_20220109.1_all.deb ... 135s Unpacking autotools-dev (20220109.1) ... 135s Selecting previously unselected package automake. 135s Preparing to unpack .../006-automake_1%3a1.16.5-1.3ubuntu1_all.deb ... 135s Unpacking automake (1:1.16.5-1.3ubuntu1) ... 135s Selecting previously unselected package autopoint. 135s Preparing to unpack .../007-autopoint_0.22.5-2_all.deb ... 135s Unpacking autopoint (0.22.5-2) ... 135s Selecting previously unselected package libisl23:s390x. 135s Preparing to unpack .../008-libisl23_0.27-1_s390x.deb ... 135s Unpacking libisl23:s390x (0.27-1) ... 135s Selecting previously unselected package libmpc3:s390x. 135s Preparing to unpack .../009-libmpc3_1.3.1-1build2_s390x.deb ... 135s Unpacking libmpc3:s390x (1.3.1-1build2) ... 135s Selecting previously unselected package cpp-14-s390x-linux-gnu. 135s Preparing to unpack .../010-cpp-14-s390x-linux-gnu_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking cpp-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package cpp-14. 135s Preparing to unpack .../011-cpp-14_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking cpp-14 (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package cpp-s390x-linux-gnu. 135s Preparing to unpack .../012-cpp-s390x-linux-gnu_4%3a14.1.0-2ubuntu1_s390x.deb ... 135s Unpacking cpp-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 135s Selecting previously unselected package cpp. 135s Preparing to unpack .../013-cpp_4%3a14.1.0-2ubuntu1_s390x.deb ... 135s Unpacking cpp (4:14.1.0-2ubuntu1) ... 135s Selecting previously unselected package libcc1-0:s390x. 135s Preparing to unpack .../014-libcc1-0_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libcc1-0:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package libgomp1:s390x. 135s Preparing to unpack .../015-libgomp1_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libgomp1:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package libitm1:s390x. 135s Preparing to unpack .../016-libitm1_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libitm1:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package libasan8:s390x. 135s Preparing to unpack .../017-libasan8_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libasan8:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package libubsan1:s390x. 135s Preparing to unpack .../018-libubsan1_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libubsan1:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package libgcc-14-dev:s390x. 135s Preparing to unpack .../019-libgcc-14-dev_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libgcc-14-dev:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package gcc-14-s390x-linux-gnu. 135s Preparing to unpack .../020-gcc-14-s390x-linux-gnu_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking gcc-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package gcc-14. 135s Preparing to unpack .../021-gcc-14_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking gcc-14 (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package gcc-s390x-linux-gnu. 135s Preparing to unpack .../022-gcc-s390x-linux-gnu_4%3a14.1.0-2ubuntu1_s390x.deb ... 135s Unpacking gcc-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 135s Selecting previously unselected package gcc. 135s Preparing to unpack .../023-gcc_4%3a14.1.0-2ubuntu1_s390x.deb ... 135s Unpacking gcc (4:14.1.0-2ubuntu1) ... 135s Selecting previously unselected package libstdc++-14-dev:s390x. 135s Preparing to unpack .../024-libstdc++-14-dev_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking libstdc++-14-dev:s390x (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package g++-14-s390x-linux-gnu. 135s Preparing to unpack .../025-g++-14-s390x-linux-gnu_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking g++-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package g++-14. 135s Preparing to unpack .../026-g++-14_14.2.0-8ubuntu1_s390x.deb ... 135s Unpacking g++-14 (14.2.0-8ubuntu1) ... 135s Selecting previously unselected package g++-s390x-linux-gnu. 136s Preparing to unpack .../027-g++-s390x-linux-gnu_4%3a14.1.0-2ubuntu1_s390x.deb ... 136s Unpacking g++-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 136s Selecting previously unselected package g++. 136s Preparing to unpack .../028-g++_4%3a14.1.0-2ubuntu1_s390x.deb ... 136s Unpacking g++ (4:14.1.0-2ubuntu1) ... 136s Selecting previously unselected package build-essential. 136s Preparing to unpack .../029-build-essential_12.10ubuntu1_s390x.deb ... 136s Unpacking build-essential (12.10ubuntu1) ... 136s Selecting previously unselected package cd-hit. 136s Preparing to unpack .../030-cd-hit_4.8.1-4_s390x.deb ... 136s Unpacking cd-hit (4.8.1-4) ... 136s Selecting previously unselected package libdebhelper-perl. 136s Preparing to unpack .../031-libdebhelper-perl_13.20ubuntu1_all.deb ... 136s Unpacking libdebhelper-perl (13.20ubuntu1) ... 136s Selecting previously unselected package libtool. 136s Preparing to unpack .../032-libtool_2.4.7-7build1_all.deb ... 136s Unpacking libtool (2.4.7-7build1) ... 136s Selecting previously unselected package dh-autoreconf. 136s Preparing to unpack .../033-dh-autoreconf_20_all.deb ... 136s Unpacking dh-autoreconf (20) ... 136s Selecting previously unselected package libarchive-zip-perl. 136s Preparing to unpack .../034-libarchive-zip-perl_1.68-1_all.deb ... 136s Unpacking libarchive-zip-perl (1.68-1) ... 136s Selecting previously unselected package libfile-stripnondeterminism-perl. 136s Preparing to unpack .../035-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... 136s Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... 136s Selecting previously unselected package dh-strip-nondeterminism. 136s Preparing to unpack .../036-dh-strip-nondeterminism_1.14.0-1_all.deb ... 136s Unpacking dh-strip-nondeterminism (1.14.0-1) ... 136s Selecting previously unselected package debugedit. 136s Preparing to unpack .../037-debugedit_1%3a5.1-1_s390x.deb ... 136s Unpacking debugedit (1:5.1-1) ... 136s Selecting previously unselected package dwz. 136s Preparing to unpack .../038-dwz_0.15-1build6_s390x.deb ... 136s Unpacking dwz (0.15-1build6) ... 136s Selecting previously unselected package gettext. 136s Preparing to unpack .../039-gettext_0.22.5-2_s390x.deb ... 136s Unpacking gettext (0.22.5-2) ... 136s Selecting previously unselected package intltool-debian. 136s Preparing to unpack .../040-intltool-debian_0.35.0+20060710.6_all.deb ... 136s Unpacking intltool-debian (0.35.0+20060710.6) ... 136s Selecting previously unselected package po-debconf. 136s Preparing to unpack .../041-po-debconf_1.0.21+nmu1_all.deb ... 136s Unpacking po-debconf (1.0.21+nmu1) ... 136s Selecting previously unselected package debhelper. 136s Preparing to unpack .../042-debhelper_13.20ubuntu1_all.deb ... 136s Unpacking debhelper (13.20ubuntu1) ... 136s Selecting previously unselected package dh-python. 136s Preparing to unpack .../043-dh-python_6.20241024_all.deb ... 136s Unpacking dh-python (6.20241024) ... 136s Selecting previously unselected package fonts-dejavu-mono. 136s Preparing to unpack .../044-fonts-dejavu-mono_2.37-8_all.deb ... 136s Unpacking fonts-dejavu-mono (2.37-8) ... 136s Selecting previously unselected package fonts-dejavu-core. 136s Preparing to unpack .../045-fonts-dejavu-core_2.37-8_all.deb ... 136s Unpacking fonts-dejavu-core (2.37-8) ... 136s Selecting previously unselected package libfontenc1:s390x. 136s Preparing to unpack .../046-libfontenc1_1%3a1.1.8-1build1_s390x.deb ... 136s Unpacking libfontenc1:s390x (1:1.1.8-1build1) ... 136s Selecting previously unselected package libfreetype6:s390x. 136s Preparing to unpack .../047-libfreetype6_2.13.3+dfsg-1_s390x.deb ... 136s Unpacking libfreetype6:s390x (2.13.3+dfsg-1) ... 136s Selecting previously unselected package x11-common. 136s Preparing to unpack .../048-x11-common_1%3a7.7+23ubuntu3_all.deb ... 136s Unpacking x11-common (1:7.7+23ubuntu3) ... 136s Selecting previously unselected package xfonts-encodings. 136s Preparing to unpack .../049-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 136s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 136s Selecting previously unselected package xfonts-utils. 136s Preparing to unpack .../050-xfonts-utils_1%3a7.7+7_s390x.deb ... 136s Unpacking xfonts-utils (1:7.7+7) ... 136s Selecting previously unselected package fonts-urw-base35. 136s Preparing to unpack .../051-fonts-urw-base35_20200910-8_all.deb ... 136s Unpacking fonts-urw-base35 (20200910-8) ... 136s Selecting previously unselected package fontconfig-config. 136s Preparing to unpack .../052-fontconfig-config_2.15.0-1.1ubuntu2_s390x.deb ... 136s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 136s Selecting previously unselected package libblas3:s390x. 136s Preparing to unpack .../053-libblas3_3.12.0-3build2_s390x.deb ... 136s Unpacking libblas3:s390x (3.12.0-3build2) ... 136s Selecting previously unselected package libfontconfig1:s390x. 136s Preparing to unpack .../054-libfontconfig1_2.15.0-1.1ubuntu2_s390x.deb ... 136s Unpacking libfontconfig1:s390x (2.15.0-1.1ubuntu2) ... 136s Selecting previously unselected package libpixman-1-0:s390x. 136s Preparing to unpack .../055-libpixman-1-0_0.44.0-3_s390x.deb ... 136s Unpacking libpixman-1-0:s390x (0.44.0-3) ... 136s Selecting previously unselected package libxcb-render0:s390x. 136s Preparing to unpack .../056-libxcb-render0_1.17.0-2_s390x.deb ... 136s Unpacking libxcb-render0:s390x (1.17.0-2) ... 136s Selecting previously unselected package libxcb-shm0:s390x. 136s Preparing to unpack .../057-libxcb-shm0_1.17.0-2_s390x.deb ... 136s Unpacking libxcb-shm0:s390x (1.17.0-2) ... 136s Selecting previously unselected package libxrender1:s390x. 136s Preparing to unpack .../058-libxrender1_1%3a0.9.10-1.1build1_s390x.deb ... 136s Unpacking libxrender1:s390x (1:0.9.10-1.1build1) ... 136s Selecting previously unselected package libcairo2:s390x. 136s Preparing to unpack .../059-libcairo2_1.18.2-2_s390x.deb ... 136s Unpacking libcairo2:s390x (1.18.2-2) ... 136s Selecting previously unselected package libdeflate0:s390x. 136s Preparing to unpack .../060-libdeflate0_1.22-1_s390x.deb ... 136s Unpacking libdeflate0:s390x (1.22-1) ... 136s Selecting previously unselected package libgfortran5:s390x. 136s Preparing to unpack .../061-libgfortran5_14.2.0-8ubuntu1_s390x.deb ... 136s Unpacking libgfortran5:s390x (14.2.0-8ubuntu1) ... 136s Selecting previously unselected package libgraphite2-3:s390x. 136s Preparing to unpack .../062-libgraphite2-3_1.3.14-2ubuntu1_s390x.deb ... 136s Unpacking libgraphite2-3:s390x (1.3.14-2ubuntu1) ... 136s Selecting previously unselected package libharfbuzz0b:s390x. 136s Preparing to unpack .../063-libharfbuzz0b_10.0.1-1_s390x.deb ... 136s Unpacking libharfbuzz0b:s390x (10.0.1-1) ... 136s Selecting previously unselected package libimagequant0:s390x. 136s Preparing to unpack .../064-libimagequant0_2.18.0-1build1_s390x.deb ... 136s Unpacking libimagequant0:s390x (2.18.0-1build1) ... 136s Selecting previously unselected package libjpeg-turbo8:s390x. 136s Preparing to unpack .../065-libjpeg-turbo8_2.1.5-2ubuntu2_s390x.deb ... 136s Unpacking libjpeg-turbo8:s390x (2.1.5-2ubuntu2) ... 136s Selecting previously unselected package libjpeg8:s390x. 136s Preparing to unpack .../066-libjpeg8_8c-2ubuntu11_s390x.deb ... 136s Unpacking libjpeg8:s390x (8c-2ubuntu11) ... 136s Selecting previously unselected package liblapack3:s390x. 136s Preparing to unpack .../067-liblapack3_3.12.0-3build2_s390x.deb ... 136s Unpacking liblapack3:s390x (3.12.0-3build2) ... 136s Selecting previously unselected package liblbfgsb0:s390x. 136s Preparing to unpack .../068-liblbfgsb0_3.0+dfsg.4-1build1_s390x.deb ... 136s Unpacking liblbfgsb0:s390x (3.0+dfsg.4-1build1) ... 136s Selecting previously unselected package liblcms2-2:s390x. 136s Preparing to unpack .../069-liblcms2-2_2.16-2_s390x.deb ... 136s Unpacking liblcms2-2:s390x (2.16-2) ... 136s Selecting previously unselected package libmbedcrypto7t64:s390x. 136s Preparing to unpack .../070-libmbedcrypto7t64_2.28.8-1_s390x.deb ... 136s Unpacking libmbedcrypto7t64:s390x (2.28.8-1) ... 136s Selecting previously unselected package libmbedx509-1t64:s390x. 136s Preparing to unpack .../071-libmbedx509-1t64_2.28.8-1_s390x.deb ... 136s Unpacking libmbedx509-1t64:s390x (2.28.8-1) ... 136s Selecting previously unselected package libmbedtls14t64:s390x. 136s Preparing to unpack .../072-libmbedtls14t64_2.28.8-1_s390x.deb ... 136s Unpacking libmbedtls14t64:s390x (2.28.8-1) ... 136s Selecting previously unselected package libpython3.13-stdlib:s390x. 136s Preparing to unpack .../073-libpython3.13-stdlib_3.13.0-2_s390x.deb ... 136s Unpacking libpython3.13-stdlib:s390x (3.13.0-2) ... 136s Selecting previously unselected package libraqm0:s390x. 136s Preparing to unpack .../074-libraqm0_0.10.1-1build1_s390x.deb ... 136s Unpacking libraqm0:s390x (0.10.1-1build1) ... 136s Selecting previously unselected package libsharpyuv0:s390x. 136s Preparing to unpack .../075-libsharpyuv0_1.4.0-0.1_s390x.deb ... 136s Unpacking libsharpyuv0:s390x (1.4.0-0.1) ... 137s Selecting previously unselected package libjbig0:s390x. 137s Preparing to unpack .../076-libjbig0_2.1-6.1ubuntu2_s390x.deb ... 137s Unpacking libjbig0:s390x (2.1-6.1ubuntu2) ... 137s Selecting previously unselected package libwebp7:s390x. 137s Preparing to unpack .../077-libwebp7_1.4.0-0.1_s390x.deb ... 137s Unpacking libwebp7:s390x (1.4.0-0.1) ... 137s Selecting previously unselected package libtiff6:s390x. 137s Preparing to unpack .../078-libtiff6_4.5.1+git230720-4ubuntu4_s390x.deb ... 137s Unpacking libtiff6:s390x (4.5.1+git230720-4ubuntu4) ... 137s Selecting previously unselected package libwebpdemux2:s390x. 137s Preparing to unpack .../079-libwebpdemux2_1.4.0-0.1_s390x.deb ... 137s Unpacking libwebpdemux2:s390x (1.4.0-0.1) ... 137s Selecting previously unselected package libwebpmux3:s390x. 137s Preparing to unpack .../080-libwebpmux3_1.4.0-0.1_s390x.deb ... 137s Unpacking libwebpmux3:s390x (1.4.0-0.1) ... 137s Selecting previously unselected package ncbi-data. 137s Preparing to unpack .../081-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 137s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 137s Selecting previously unselected package ncbi-blast+. 137s Preparing to unpack .../082-ncbi-blast+_2.16.0+ds-6_s390x.deb ... 137s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 137s Selecting previously unselected package python3-numpy. 137s Preparing to unpack .../083-python3-numpy_1%3a1.26.4+ds-11build1_s390x.deb ... 137s Unpacking python3-numpy (1:1.26.4+ds-11build1) ... 137s Selecting previously unselected package libopenjp2-7:s390x. 137s Preparing to unpack .../084-libopenjp2-7_2.5.0-2ubuntu1_s390x.deb ... 137s Unpacking libopenjp2-7:s390x (2.5.0-2ubuntu1) ... 137s Selecting previously unselected package python3-pil:s390x. 137s Preparing to unpack .../085-python3-pil_10.4.0-1ubuntu1_s390x.deb ... 137s Unpacking python3-pil:s390x (10.4.0-1ubuntu1) ... 137s Selecting previously unselected package python3-cairo. 137s Preparing to unpack .../086-python3-cairo_1.26.1-2_s390x.deb ... 137s Unpacking python3-cairo (1.26.1-2) ... 137s Selecting previously unselected package python3-freetype. 137s Preparing to unpack .../087-python3-freetype_2.5.1-1_all.deb ... 137s Unpacking python3-freetype (2.5.1-1) ... 137s Selecting previously unselected package python3-rlpycairo. 137s Preparing to unpack .../088-python3-rlpycairo_0.3.0-3_all.deb ... 137s Unpacking python3-rlpycairo (0.3.0-3) ... 137s Selecting previously unselected package python3-reportlab. 137s Preparing to unpack .../089-python3-reportlab_4.2.5-1_all.deb ... 137s Unpacking python3-reportlab (4.2.5-1) ... 137s Selecting previously unselected package xml-core. 137s Preparing to unpack .../090-xml-core_0.19_all.deb ... 137s Unpacking xml-core (0.19) ... 137s Selecting previously unselected package w3c-sgml-lib. 137s Preparing to unpack .../091-w3c-sgml-lib_1.3-3_all.deb ... 137s Unpacking w3c-sgml-lib (1.3-3) ... 137s Selecting previously unselected package python3-biopython. 137s Preparing to unpack .../092-python3-biopython_1.84+dfsg-4_s390x.deb ... 137s Unpacking python3-biopython (1.84+dfsg-4) ... 137s Selecting previously unselected package python3-six. 137s Preparing to unpack .../093-python3-six_1.16.0-7_all.deb ... 137s Unpacking python3-six (1.16.0-7) ... 137s Selecting previously unselected package python3-dateutil. 137s Preparing to unpack .../094-python3-dateutil_2.9.0-2_all.deb ... 137s Unpacking python3-dateutil (2.9.0-2) ... 137s Selecting previously unselected package python3-tz. 137s Preparing to unpack .../095-python3-tz_2024.1-2_all.deb ... 137s Unpacking python3-tz (2024.1-2) ... 137s Selecting previously unselected package python3-pandas-lib:s390x. 137s Preparing to unpack .../096-python3-pandas-lib_2.2.3+dfsg-5_s390x.deb ... 137s Unpacking python3-pandas-lib:s390x (2.2.3+dfsg-5) ... 138s Selecting previously unselected package python3-pandas. 138s Preparing to unpack .../097-python3-pandas_2.2.3+dfsg-5_all.deb ... 138s Unpacking python3-pandas (2.2.3+dfsg-5) ... 138s Selecting previously unselected package python3-decorator. 138s Preparing to unpack .../098-python3-decorator_5.1.1-5_all.deb ... 138s Unpacking python3-decorator (5.1.1-5) ... 138s Selecting previously unselected package python3-scipy. 138s Preparing to unpack .../099-python3-scipy_1.13.1-5_s390x.deb ... 138s Unpacking python3-scipy (1.13.1-5) ... 138s Selecting previously unselected package python3-packaging. 138s Preparing to unpack .../100-python3-packaging_24.1-1_all.deb ... 138s Unpacking python3-packaging (24.1-1) ... 138s Selecting previously unselected package python3-presto. 138s Preparing to unpack .../101-python3-presto_0.7.2-1_s390x.deb ... 138s Unpacking python3-presto (0.7.2-1) ... 138s Selecting previously unselected package presto. 138s Preparing to unpack .../102-presto_0.7.2-1_all.deb ... 138s Unpacking presto (0.7.2-1) ... 138s Selecting previously unselected package pybuild-plugin-autopkgtest. 138s Preparing to unpack .../103-pybuild-plugin-autopkgtest_6.20241024_all.deb ... 138s Unpacking pybuild-plugin-autopkgtest (6.20241024) ... 138s Selecting previously unselected package python3.13. 138s Preparing to unpack .../104-python3.13_3.13.0-2_s390x.deb ... 138s Unpacking python3.13 (3.13.0-2) ... 138s Selecting previously unselected package python3-all. 138s Preparing to unpack .../105-python3-all_3.12.7-1_s390x.deb ... 138s Unpacking python3-all (3.12.7-1) ... 138s Selecting previously unselected package autopkgtest-satdep. 138s Preparing to unpack .../106-1-autopkgtest-satdep.deb ... 138s Unpacking autopkgtest-satdep (0) ... 138s Setting up dh-python (6.20241024) ... 138s Setting up libgraphite2-3:s390x (1.3.14-2ubuntu1) ... 138s Setting up liblcms2-2:s390x (2.16-2) ... 138s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 138s Setting up libpixman-1-0:s390x (0.44.0-3) ... 138s Setting up libsharpyuv0:s390x (1.4.0-0.1) ... 138s Setting up libmbedcrypto7t64:s390x (2.28.8-1) ... 138s Setting up libxrender1:s390x (1:0.9.10-1.1build1) ... 138s Setting up libxcb-render0:s390x (1.17.0-2) ... 138s Setting up libarchive-zip-perl (1.68-1) ... 138s Setting up libdebhelper-perl (13.20ubuntu1) ... 138s Setting up x11-common (1:7.7+23ubuntu3) ... 139s Setting up libdeflate0:s390x (1.22-1) ... 139s Setting up m4 (1.4.19-4build1) ... 139s Setting up libxcb-shm0:s390x (1.17.0-2) ... 139s Setting up libgomp1:s390x (14.2.0-8ubuntu1) ... 139s Setting up libjbig0:s390x (2.1-6.1ubuntu2) ... 139s Setting up python3-tz (2024.1-2) ... 139s Setting up python3-six (1.16.0-7) ... 139s Setting up libpython3.13-minimal:s390x (3.13.0-2) ... 139s Setting up python3-decorator (5.1.1-5) ... 139s Setting up libfontenc1:s390x (1:1.1.8-1build1) ... 139s Setting up autotools-dev (20220109.1) ... 139s Setting up libblas3:s390x (3.12.0-3build2) ... 139s update-alternatives: using /usr/lib/s390x-linux-gnu/blas/libblas.so.3 to provide /usr/lib/s390x-linux-gnu/libblas.so.3 (libblas.so.3-s390x-linux-gnu) in auto mode 139s Setting up python3-packaging (24.1-1) ... 139s Setting up libfreetype6:s390x (2.13.3+dfsg-1) ... 139s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 139s Setting up libimagequant0:s390x (2.18.0-1build1) ... 139s Setting up fonts-dejavu-mono (2.37-8) ... 139s Setting up libmpc3:s390x (1.3.1-1build2) ... 139s Setting up autopoint (0.22.5-2) ... 139s Setting up fonts-dejavu-core (2.37-8) ... 139s Setting up libjpeg-turbo8:s390x (2.1.5-2ubuntu2) ... 139s Setting up libgfortran5:s390x (14.2.0-8ubuntu1) ... 139s Setting up autoconf (2.72-3) ... 139s Setting up libwebp7:s390x (1.4.0-0.1) ... 139s Setting up libubsan1:s390x (14.2.0-8ubuntu1) ... 139s Setting up dwz (0.15-1build6) ... 139s Setting up libasan8:s390x (14.2.0-8ubuntu1) ... 139s Setting up debugedit (1:5.1-1) ... 139s Setting up libopenjp2-7:s390x (2.5.0-2ubuntu1) ... 139s Setting up python3.13-minimal (3.13.0-2) ... 140s Setting up libharfbuzz0b:s390x (10.0.1-1) ... 140s Setting up python3-dateutil (2.9.0-2) ... 140s Setting up sgml-base (1.31) ... 140s Setting up libisl23:s390x (0.27-1) ... 140s Setting up libwebpmux3:s390x (1.4.0-0.1) ... 140s Setting up libpython3.13-stdlib:s390x (3.13.0-2) ... 140s Setting up libcc1-0:s390x (14.2.0-8ubuntu1) ... 140s Setting up libitm1:s390x (14.2.0-8ubuntu1) ... 140s Setting up cd-hit (4.8.1-4) ... 140s Setting up libjpeg8:s390x (8c-2ubuntu11) ... 140s Setting up automake (1:1.16.5-1.3ubuntu1) ... 140s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode 140s Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... 140s Setting up liblapack3:s390x (3.12.0-3build2) ... 140s update-alternatives: using /usr/lib/s390x-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/s390x-linux-gnu/liblapack.so.3 (liblapack.so.3-s390x-linux-gnu) in auto mode 140s Setting up gettext (0.22.5-2) ... 140s Setting up libmbedx509-1t64:s390x (2.28.8-1) ... 140s Setting up python3.13 (3.13.0-2) ... 142s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 142s Setting up libwebpdemux2:s390x (1.4.0-0.1) ... 142s Setting up python3-all (3.12.7-1) ... 142s Setting up python3-freetype (2.5.1-1) ... 142s Setting up xfonts-utils (1:7.7+7) ... 142s Setting up intltool-debian (0.35.0+20060710.6) ... 142s Setting up libraqm0:s390x (0.10.1-1build1) ... 142s Setting up python3-numpy (1:1.26.4+ds-11build1) ... 146s Setting up cpp-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 146s Setting up cpp-14 (14.2.0-8ubuntu1) ... 146s Setting up dh-strip-nondeterminism (1.14.0-1) ... 146s Setting up libmbedtls14t64:s390x (2.28.8-1) ... 146s Setting up libtiff6:s390x (4.5.1+git230720-4ubuntu4) ... 146s Setting up xml-core (0.19) ... 146s Setting up libfontconfig1:s390x (2.15.0-1.1ubuntu2) ... 146s Setting up libgcc-14-dev:s390x (14.2.0-8ubuntu1) ... 146s Setting up libstdc++-14-dev:s390x (14.2.0-8ubuntu1) ... 146s Setting up liblbfgsb0:s390x (3.0+dfsg.4-1build1) ... 146s Setting up python3-scipy (1.13.1-5) ... 154s Setting up cpp-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 154s Setting up po-debconf (1.0.21+nmu1) ... 154s Setting up python3-pandas-lib:s390x (2.2.3+dfsg-5) ... 154s Setting up fonts-urw-base35 (20200910-8) ... 154s Setting up libcairo2:s390x (1.18.2-2) ... 154s Setting up ncbi-blast+ (2.16.0+ds-6) ... 154s Setting up python3-pil:s390x (10.4.0-1ubuntu1) ... 155s Setting up gcc-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 155s Setting up python3-pandas (2.2.3+dfsg-5) ... 166s Setting up gcc-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 166s Setting up g++-14-s390x-linux-gnu (14.2.0-8ubuntu1) ... 166s Setting up cpp (4:14.1.0-2ubuntu1) ... 167s Setting up python3-cairo (1.26.1-2) ... 167s Setting up g++-s390x-linux-gnu (4:14.1.0-2ubuntu1) ... 167s Setting up gcc-14 (14.2.0-8ubuntu1) ... 167s Setting up python3-rlpycairo (0.3.0-3) ... 167s Setting up python3-reportlab (4.2.5-1) ... 168s Setting up g++-14 (14.2.0-8ubuntu1) ... 168s Setting up libtool (2.4.7-7build1) ... 168s Setting up gcc (4:14.1.0-2ubuntu1) ... 168s Setting up dh-autoreconf (20) ... 168s Setting up g++ (4:14.1.0-2ubuntu1) ... 168s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 168s Setting up build-essential (12.10ubuntu1) ... 168s Setting up debhelper (13.20ubuntu1) ... 168s Setting up pybuild-plugin-autopkgtest (6.20241024) ... 168s Processing triggers for libc-bin (2.40-1ubuntu3) ... 168s Processing triggers for systemd (256.5-2ubuntu4) ... 169s Processing triggers for man-db (2.12.1-3) ... 170s Processing triggers for install-info (7.1.1-1) ... 170s Processing triggers for sgml-base (1.31) ... 170s Setting up w3c-sgml-lib (1.3-3) ... 193s Setting up python3-biopython (1.84+dfsg-4) ... 196s Setting up python3-presto (0.7.2-1) ... 196s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 196s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 196s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 196s header['SPECIES'] = re.sub('\s', '_', fields[2]) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 196s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 196s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 196s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 196s version = re.sub('\.linux.*$','',version) 196s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 196s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 196s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 196s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 196s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 196s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 196s header['SPECIES'] = re.sub('\s', '_', fields[2]) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 196s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 196s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 196s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 196s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 196s version = re.sub('\.linux.*$','',version) 196s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 196s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 196s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 196s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 196s Setting up presto (0.7.2-1) ... 196s Setting up autopkgtest-satdep (0) ... 200s (Reading database ... 65458 files and directories currently installed.) 200s Removing autopkgtest-satdep (0) ... 202s autopkgtest [12:25:03]: test pybuild-autopkgtest: pybuild-autopkgtest 202s autopkgtest [12:25:03]: test pybuild-autopkgtest: [----------------------- 202s pybuild-autopkgtest 202s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Vv7tPc/build.L2b/src/bin /tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build; rm /tmp/autopkgtest.Vv7tPc/build.L2b/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 202s I: pybuild base:311: cd /tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build; python3.13 -m unittest discover -v 203s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... -> test_collapseAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 203s <- test_collapseAnnotation() 0.000 203s -> test_getCoordKey() 203s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 203s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 203s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 203s <- test_getCoordKey() 0.000 203s -> test_mergeAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 203s <- test_mergeAnnotation() 0.000 203s -> test_renameAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 203s <- test_renameAnnotation() 0.000 203s ok 203s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 203s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 203s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 203s tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) ... ERROR 203s tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) ... ERROR 203s tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) ... ERROR 203s tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) ... ERROR 203s tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) ... ERROR 203s tests.test_IO (unittest.loader._FailedTest.tests.test_IO) ... ERROR 203s tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) ... ERROR 203s tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) ... ERROR 203s tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) ... ERROR 203s 203s ====================================================================== 203s ERROR: tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_AssemblePairs 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_AssemblePairs.py", line 12, in 203s import pandas as pd 203s File "/usr/lib/python3/dist-packages/pandas/__init__.py", line 19, in 203s raise ImportError( 203s "Unable to import required dependencies:\n" + "\n".join(_missing_dependencies) 203s ) 203s ImportError: Unable to import required dependencies: 203s numpy: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_BuildConsensus 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 203s from . import multiarray 203s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 203s from . import overrides 203s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 203s from numpy.core._multiarray_umath import ( 203s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 203s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 203s 203s During handling of the above exception, another exception occurred: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 203s from numpy.__config__ import show as show_config 203s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 203s from numpy.core._multiarray_umath import ( 203s ...<3 lines>... 203s ) 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 203s raise ImportError(msg) 203s ImportError: 203s 203s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 203s 203s Importing the numpy C-extensions failed. This error can happen for 203s many reasons, often due to issues with your setup or how NumPy was 203s installed. 203s 203s We have compiled some common reasons and troubleshooting tips at: 203s 203s https://numpy.org/devdocs/user/troubleshooting-importerror.html 203s 203s Please note and check the following: 203s 203s * The Python version is: Python3.13 from "/usr/bin/python3.13" 203s * The NumPy version is: "1.26.4" 203s 203s and make sure that they are the versions you expect. 203s Please carefully study the documentation linked above for further help. 203s 203s Original error was: No module named 'numpy.core._multiarray_umath' 203s 203s 203s The above exception was the direct cause of the following exception: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_BuildConsensus.py", line 16, in 203s from presto.Sequence import calculateSetError, deleteSeqPositions, findGapPositions, \ 203s frequencyConsensus, qualityConsensus 203s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 203s import numpy as np 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 203s raise ImportError(msg) from e 203s ImportError: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_CollapseSeq 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 203s from . import multiarray 203s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 203s from . import overrides 203s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 203s from numpy.core._multiarray_umath import ( 203s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 203s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 203s 203s During handling of the above exception, another exception occurred: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 203s from numpy.__config__ import show as show_config 203s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 203s from numpy.core._multiarray_umath import ( 203s ...<3 lines>... 203s ) 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 203s raise ImportError(msg) 203s ImportError: 203s 203s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 203s 203s Importing the numpy C-extensions failed. This error can happen for 203s many reasons, often due to issues with your setup or how NumPy was 203s installed. 203s 203s We have compiled some common reasons and troubleshooting tips at: 203s 203s https://numpy.org/devdocs/user/troubleshooting-importerror.html 203s 203s Please note and check the following: 203s 203s * The Python version is: Python3.13 from "/usr/bin/python3.13" 203s * The NumPy version is: "1.26.4" 203s 203s and make sure that they are the versions you expect. 203s Please carefully study the documentation linked above for further help. 203s 203s Original error was: No module named 'numpy.core._multiarray_umath' 203s 203s 203s The above exception was the direct cause of the following exception: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_CollapseSeq.py", line 17, in 203s from presto.Sequence import checkSeqEqual 203s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 203s import numpy as np 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 203s raise ImportError(msg) from e 203s ImportError: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_ConvertHeaders 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_ConvertHeaders.py", line 18, in 203s import ConvertHeaders 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/../bin/ConvertHeaders.py", line 15, in 203s from Bio import SeqIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 203s from Bio.SeqIO import TwoBitIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 203s raise MissingPythonDependencyError( 203s ...<2 lines>... 203s ) from None 203s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 203s 203s 203s ====================================================================== 203s ERROR: tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_EstimateError 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 203s from . import multiarray 203s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 203s from . import overrides 203s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 203s from numpy.core._multiarray_umath import ( 203s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 203s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 203s 203s During handling of the above exception, another exception occurred: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 203s from numpy.__config__ import show as show_config 203s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 203s from numpy.core._multiarray_umath import ( 203s ...<3 lines>... 203s ) 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 203s raise ImportError(msg) 203s ImportError: 203s 203s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 203s 203s Importing the numpy C-extensions failed. This error can happen for 203s many reasons, often due to issues with your setup or how NumPy was 203s installed. 203s 203s We have compiled some common reasons and troubleshooting tips at: 203s 203s https://numpy.org/devdocs/user/troubleshooting-importerror.html 203s 203s Please note and check the following: 203s 203s * The Python version is: Python3.13 from "/usr/bin/python3.13" 203s * The NumPy version is: "1.26.4" 203s 203s and make sure that they are the versions you expect. 203s Please carefully study the documentation linked above for further help. 203s 203s Original error was: No module named 'numpy.core._multiarray_umath' 203s 203s 203s The above exception was the direct cause of the following exception: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_EstimateError.py", line 11, in 203s import numpy as np 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 203s raise ImportError(msg) from e 203s ImportError: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_IO (unittest.loader._FailedTest.tests.test_IO) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_IO 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_IO.py", line 15, in 203s from presto.IO import getFileType, readSeqFile 203s File "/usr/lib/python3/dist-packages/presto/IO.py", line 15, in 203s from Bio import SeqIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 203s from Bio.SeqIO import TwoBitIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 203s raise MissingPythonDependencyError( 203s ...<2 lines>... 203s ) from None 203s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 203s 203s 203s ====================================================================== 203s ERROR: tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_MaskPrimers 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 203s from . import multiarray 203s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 203s from . import overrides 203s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 203s from numpy.core._multiarray_umath import ( 203s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 203s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 203s 203s During handling of the above exception, another exception occurred: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 203s from numpy.__config__ import show as show_config 203s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 203s from numpy.core._multiarray_umath import ( 203s ...<3 lines>... 203s ) 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 203s raise ImportError(msg) 203s ImportError: 203s 203s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 203s 203s Importing the numpy C-extensions failed. This error can happen for 203s many reasons, often due to issues with your setup or how NumPy was 203s installed. 203s 203s We have compiled some common reasons and troubleshooting tips at: 203s 203s https://numpy.org/devdocs/user/troubleshooting-importerror.html 203s 203s Please note and check the following: 203s 203s * The Python version is: Python3.13 from "/usr/bin/python3.13" 203s * The NumPy version is: "1.26.4" 203s 203s and make sure that they are the versions you expect. 203s Please carefully study the documentation linked above for further help. 203s 203s Original error was: No module named 'numpy.core._multiarray_umath' 203s 203s 203s The above exception was the direct cause of the following exception: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_MaskPrimers.py", line 17, in 203s from presto.Sequence import getDNAScoreDict, localAlignment, scoreAlignment, extractAlignment, \ 203s maskSeq, PrimerAlignment 203s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 203s import numpy as np 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 203s raise ImportError(msg) from e 203s ImportError: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_Sequence 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 203s from . import multiarray 203s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 203s from . import overrides 203s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 203s from numpy.core._multiarray_umath import ( 203s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 203s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 203s 203s During handling of the above exception, another exception occurred: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 203s from numpy.__config__ import show as show_config 203s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 203s from numpy.core._multiarray_umath import ( 203s ...<3 lines>... 203s ) 203s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 203s raise ImportError(msg) 203s ImportError: 203s 203s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 203s 203s Importing the numpy C-extensions failed. This error can happen for 203s many reasons, often due to issues with your setup or how NumPy was 203s installed. 203s 203s We have compiled some common reasons and troubleshooting tips at: 203s 203s https://numpy.org/devdocs/user/troubleshooting-importerror.html 203s 203s Please note and check the following: 203s 203s * The Python version is: Python3.13 from "/usr/bin/python3.13" 203s * The NumPy version is: "1.26.4" 203s 203s and make sure that they are the versions you expect. 203s Please carefully study the documentation linked above for further help. 203s 203s Original error was: No module named 'numpy.core._multiarray_umath' 203s 203s 203s The above exception was the direct cause of the following exception: 203s 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_Sequence.py", line 18, in 203s from presto.Sequence import getDNAScoreDict, scoreDNA, scoreSeqPair, weightSeq, \ 203s calculateSetError, meanQuality, filterQuality 203s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 203s import numpy as np 203s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 203s raise ImportError(msg) from e 203s ImportError: Error importing numpy: you should not try to import numpy from 203s its source directory; please exit the numpy source tree, and relaunch 203s your python interpreter from there. 203s 203s 203s ====================================================================== 203s ERROR: tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) 203s ---------------------------------------------------------------------- 203s ImportError: Failed to import test module: tests.test_UnifyHeaders 203s Traceback (most recent call last): 203s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 203s module = self._get_module_from_name(name) 203s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 203s __import__(name) 203s ~~~~~~~~~~^^^^^^ 203s File "/tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build/tests/test_UnifyHeaders.py", line 16, in 203s from presto.Multiprocessing import SeqData 203s File "/usr/lib/python3/dist-packages/presto/Multiprocessing.py", line 16, in 203s from Bio import SeqIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 203s from Bio.SeqIO import TwoBitIO 203s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 203s raise MissingPythonDependencyError( 203s ...<2 lines>... 203s ) from None 203s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 203s 203s 203s ---------------------------------------------------------------------- 203s Ran 13 tests in 0.001s 203s 203s FAILED (errors=9) 203s E: pybuild pybuild:389: test: plugin distutils failed with: exit code=1: cd /tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build; python3.13 -m unittest discover -v 203s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Vv7tPc/build.L2b/src/bin /tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build; rm /tmp/autopkgtest.Vv7tPc/build.L2b/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 203s rm: cannot remove '/tmp/autopkgtest.Vv7tPc/build.L2b/src/tests/test_ClusterSets.py': No such file or directory 203s Test file already removed or moved 203s I: pybuild base:311: cd /tmp/autopkgtest.Vv7tPc/autopkgtest_tmp/build; python3.12 -m unittest discover -v 203s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 203s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 203s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 203s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 203s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 203s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 203s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 203s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 203s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 203s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 203s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok 203s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 203s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 203s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 203s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 203s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 203s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok 203s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 203s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 203s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 203s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 203s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 203s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object. 203s warnings.warn( 203s ok 203s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 203s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 203s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 203s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 203s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok 203s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 203s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 203s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 203s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 203s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 203s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 203s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok 203s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok 203s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 203s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 203s 203s ---------------------------------------------------------------------- 203s Ran 38 tests in 0.038s 203s 203s OK (skipped=6) 203s -> test_collapseAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 203s <- test_collapseAnnotation() 0.000 203s -> test_getCoordKey() 203s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 203s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 203s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 203s <- test_getCoordKey() 0.000 203s -> test_mergeAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 203s <- test_mergeAnnotation() 0.000 203s -> test_renameAnnotation() 203s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 203s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 203s <- test_renameAnnotation() 0.000 203s -> test_calculateSetError() 203s Frequency consensus error> 203s REF> CGGCGTAA 203s SEQ1> CGGCGTAA 203s SEQ2> CCNNGTAA 203s SEQ3> CGGC--TA 203s SEQ4> CGNN--TA 203s SEQ5> CGGC--AA 203s ERROR> 0.250000 203s Quality consensus error> 203s REF> CGGCNNAA 203s SEQ1> CGGCGTAA 203s SEQ2> CCNNGTAA 203s SEQ3> CGGC--TA 203s SEQ4> CGNN--TA 203s SEQ5> CGGC--AA 203s ERROR> 0.233333 203s <- test_calculateSetError() 0.000 203s -> test_deleteSeqPositions() 203s MAX_GAP=0.4> CGGCAA 203s MAX_GAP=0.8> CGGCGTAA 203s <- test_deleteSeqPositions() 0.000 203s -> test_findGapPositions() 203s MAX_GAP=0.4> [4, 5] 203s MAX_GAP=0.8> [] 203s <- test_findGapPositions() 0.000 203s -> test_frequencyConsensus() 203s MIN_FREQ=0.2> CGGCGTAA 203s MIN_FREQ=0.8> CGGCGTNA 203s <- test_frequencyConsensus() 0.000 203s -> test_qualityConsensus() 203s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 203s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 203s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 203s <- test_qualityConsensus() 0.000 203s -> test_checkSeqEqual() 203s DNA Equality> 203s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 203s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 203s EQUAL> True 203s 203s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 203s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 203s EQUAL> False 203s 203s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 203s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 203s EQUAL> True 203s 203s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 203s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 203s EQUAL> False 203s 203s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 203s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 203s EQUAL> True 203s 203s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 203s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 203s EQUAL> True 203s 203s <- test_checkSeqEqual() 0.000 203s -> test_convert454Header() 203s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 203s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 203s <- test_convert454Header() 0.000 203s -> test_convertGenbankHeader() 203s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 203s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 203s <- test_convertGenbankHeader() 0.000 203s -> test_convertGenericHeader() 203s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 203s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 203s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 203s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 203s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 203s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 203s <- test_convertGenericHeader() 0.000 203s -> test_convertIMGTHeader() 203s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 203s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 203s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 203s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 203s OrderedDict({'ID': 'IGHV1-18*01'}) 203s OrderedDict({'ID': 'IGHV1-69*07'}) 203s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 203s OrderedDict({'ID': 'TRAV11*01'}) 203s <- test_convertIMGTHeader() 0.000 203s -> test_convertIlluminaHeader() 203s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 203s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 203s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 203s <- test_convertIlluminaHeader() 0.000 203s -> test_convertSRAHeader() 203s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 203s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 203s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 203s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 203s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 203s <- test_convertSRAHeader() 0.000 203s -> test_calculateDistances() 203s <- test_calculateDistances() 0.001 203s -> test_countMismatches() 203s <- test_countMismatches() 0.001 203s -> test_initializeMismatchDictionary() 203s <- test_initializeMismatchDictionary() 0.000 203s -> test_getFileType() 203s <- test_getFileType() 0.000 203s -> test_extractAlignment() 203s SEQ1> 203s SEQ> CCACGTTTTAGTAATTAATA 203s ALN-SEQ> CCACGTTTTAGT 203s ALN-PR> ----GTTTTAGT 203s PRIMER> GTTTTAGT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ2> 203s SEQ> CCNCGTTTTAGTAATTAATA 203s ALN-SEQ> CCNCGTTTTAGT 203s ALN-PR> ----GTTTTAGT 203s PRIMER> GTTTTAGT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ3> 203s SEQ> GGGCGTTTTAGTAATTAATA 203s ALN-SEQ> GGGCGTTTTAGT 203s ALN-PR> ----GTTTTAGT 203s PRIMER> GTTTTAGT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ4> 203s SEQ> GGNNGTTTTACTAATTAATA 203s ALN-SEQ> GGNNGTTTTACT 203s ALN-PR> ----GTTTTACT 203s PRIMER> GTTTTACT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ5> 203s SEQ> NNGCNNNNNACTAATTAATA 203s ALN-SEQ> NNGCNNNNNACT 203s ALN-PR> ----NNNNNACT 203s PRIMER> NNNNNACT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ6> 203s SEQ> GGGATANNNACTAATTAATA 203s ALN-SEQ> GGGATANNNACT 203s ALN-PR> ----TANNNACT 203s PRIMER> TANNNACT 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ7> 203s SEQ> NNNNNNNNNNNNNNNNNNNN 203s ALN-SEQ> NNNNNNNNNNNN 203s ALN-PR> ----NNNNNNNN 203s PRIMER> NNNNNNNN 203s START> 4 203s END> 12 203s GAPS> 0 203s ERROR> 0.000000 203s 203s <- test_extractAlignment() 0.000 203s -> test_localAlignment() 203s TEST Ns> 203s SEQ1> 203s SEQ> CCACGTTTTAGTAATTAATA 203s ALN-SEQ> CCACGTTTTAGTAATTAATA 203s ALN-PR> -CACGTTTT----------- 203s PRIMER> PR1 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ2> 203s SEQ> CCNCGTTTTAGTAATTAATA 203s ALN-SEQ> CCNCGTTTTAGTAATTAATA 203s ALN-PR> -CACGTTTT----------- 203s PRIMER> PR1 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.125000 203s 203s SEQ3> 203s SEQ> GGGCGTTTTAGTAATTAATA 203s ALN-SEQ> GGGCGTTTTAGTAATTAATA 203s ALN-PR> -GGCGTTTT----------- 203s PRIMER> PR2 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ4> 203s SEQ> GGNNGTTTTACTAATTAATA 203s ALN-SEQ> GGNNGTTTTACTAATTAATA 203s ALN-PR> GGC-GTTTT----------- 203s PRIMER> PR2 203s START> 0 203s END> 9 203s GAPS> 1 203s ERROR> 0.250000 203s 203s SEQ5> 203s SEQ> NNGCNNNNNACTAATTAATA 203s ALN-SEQ> NNGCNNNNNACTAATTAATA 203s ALN-PR> ------------ANATAA-- 203s PRIMER> PR3 203s START> 12 203s END> 18 203s GAPS> 0 203s ERROR> 0.375000 203s 203s SEQ6> 203s SEQ> GGGATANNNACTAATTAATA 203s ALN-SEQ> GGGATANNNACTAATTAATA 203s ALN-PR> -GGANA-------------- 203s PRIMER> PR3 203s START> 1 203s END> 6 203s GAPS> 0 203s ERROR> 0.375000 203s 203s SEQ7> 203s SEQ> NNNNNNNNNNNNNNNNNNNN 203s ALN-SEQ> None 203s ALN-PR> None 203s PRIMER> None 203s START> None 203s END> None 203s GAPS> 0 203s ERROR> 1.000000 203s 203s TEST INDELS> 203s SEQ1> 203s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 203s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 203s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 203s PRIMER> PR1 203s START> 15 203s END> 38 203s GAPS> 0 203s ERROR> 0.083333 203s 203s SEQ2> 203s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 203s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 203s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 203s PRIMER> PR1 203s START> 14 203s END> 38 203s GAPS> 2 203s ERROR> 0.208333 203s 203s SEQ3> 203s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 203s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 203s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 203s PRIMER> PR1 203s START> 15 203s END> 38 203s GAPS> 1 203s ERROR> 0.125000 203s 203s SEQ4> 203s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 203s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 203s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 203s PRIMER> PR2 203s START> 6 203s END> 19 203s GAPS> 1 203s ERROR> 0.250000 203s 203s SEQ5> 203s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 203s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 203s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 203s PRIMER> PR2 203s START> 6 203s END> 18 203s GAPS> 0 203s ERROR> 0.166667 203s 203s SEQ6> 203s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 203s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 203s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 203s PRIMER> PR2 203s START> 0 203s END> 11 203s GAPS> 1 203s ERROR> 0.250000 203s 203s SEQ7> 203s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 203s PRIMER> PR3 203s START> 2 203s END> 15 203s GAPS> 1 203s ERROR> 0.083333 203s 203s SEQ8> 203s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 203s PRIMER> PR3 203s START> 3 203s END> 15 203s GAPS> 1 203s ERROR> 0.166667 203s 203s SEQ9> 203s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 203s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 203s PRIMER> PR3 203s START> 3 203s END> 15 203s GAPS> 1 203s ERROR> 0.333333 203s 203s SEQ10> 203s SEQ> -------------------------------------------------------------- 203s ALN-SEQ> None 203s ALN-PR> None 203s PRIMER> None 203s START> None 203s END> None 203s GAPS> 0 203s ERROR> 1.000000 203s 203s <- test_localAlignment() 0.019 203s -> test_maskSeq() 203s TEST CUT> 203s ID> SEQ|PRIMER=A|BARCODE=CCA 203s SEQ> AGTAATTAATA 203s 203s TEST MASK> 203s ID> SEQ|PRIMER=A|BARCODE=CCA 203s SEQ> NNNNNNAGTAATTAATA 203s 203s TEST TRIM> 203s ID> SEQ|PRIMER=A|BARCODE=CCA 203s SEQ> CGTTTTAGTAATTAATA 203s 203s TEST TAG> 203s ID> SEQ|PRIMER=A|BARCODE=CCA 203s SEQ> CCACGTTTTAGTAATTAATA 203s 203s <- test_maskSeq() 0.001 203s -> test_scoreAlignment() 203s SEQ1> 203s SEQ> CCACGTTTTAGTAATTAATA 203s ALN-SEQ> CCACGTTTT 203s ALN-PR> -CACGTTTT 203s PRIMER> PR1 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ2> 203s SEQ> CCNCGTTTTAGTAATTAATA 203s ALN-SEQ> CCNCGTTTT 203s ALN-PR> -CACGTTTT 203s PRIMER> PR1 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.125000 203s 203s SEQ3> 203s SEQ> GGGCGTTTTAGTAATTAATA 203s ALN-SEQ> GGGCGTTTT 203s ALN-PR> -GGCGTTTT 203s PRIMER> PR2 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.000000 203s 203s SEQ4> 203s SEQ> GGNNGTTTTACTAATTAATA 203s ALN-SEQ> GGNNGTTTT 203s ALN-PR> -GGCGTTTT 203s PRIMER> PR2 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.250000 203s 203s SEQ5> 203s SEQ> NNGCNNNNNACTAATTAATA 203s ALN-SEQ> NNGCNNNNN 203s ALN-PR> -GGCGTTTT 203s PRIMER> PR2 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.750000 203s 203s SEQ6> 203s SEQ> GGGATANNNACTAATTAATA 203s ALN-SEQ> GGGATANNN 203s ALN-PR> -GGANATAA 203s PRIMER> PR3 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 0.375000 203s 203s SEQ7> 203s SEQ> NNNNNNNNNNNNNNNNNNNN 203s ALN-SEQ> NNNNNNNNN 203s ALN-PR> -CACGTTTT 203s PRIMER> None 203s START> 1 203s END> 9 203s GAPS> 0 203s ERROR> 1.000000 203s 203s <- test_scoreAlignment() 0.006 203s -> test_calculateSetError() 203s REF> CGGCGTAA 0.4347826086956522 203s REF> NNNNNNNN 1.0 203s <- test_calculateSetError() 0.000 203s -> test_filterQuality() 203s RESULT> True 25 203s RESULT> False 5 203s RESULT> False 0 203s <- test_filterQuality() 0.000 203s -> test_meanQuality() 203s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 203s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 203s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 203s <- test_meanQuality() 0.000 203s -> test_scoreDNA() 203s Default DNA Scores> 203s A==A> 1 203s A==T> 0 203s A==R> 1 203s U==T> 1 203s A==N> 1 203s N==A> 1 203s A==-> 0 203s -==A> 0 203s Symmetric DNA Scores> 203s A==A> 1 203s A==T> 0 203s A==R> 1 203s U==T> 1 203s A==N> 1 203s N==A> 1 203s A==-> 1 203s -==A> 1 203s Asymmetric DNA Scores> 203s A==A> 1 203s A==T> 0 203s A==R> 1 203s U==T> 1 203s A==N> 1 203s N==A> 0 203s A==-> 1 203s -==A> 0 203s <- test_scoreDNA() 0.000 203s -> test_scoreSeqPair() 203s Default DNA Scores> 203s SEQ1> CGGCGTAA 203s SEQ2> CGNNGTAG 203s SCORE> 7 203s WEIGHT> 8 203s ERROR> 0.125000 203s 203s SEQ1> CGGCGTAA 203s SEQ3> CGGC--AA 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ1> CGGCGTAA 203s SEQ4> CGNN--AG 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ1> CGGCGTAA 203s SEQ5> NNNNNNNN 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ6> NNNNNNAA 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ2> CGNNGTAG 203s SEQ3> CGGC--AA 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ2> CGNNGTAG 203s SEQ4> CGNN--AG 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ2> CGNNGTAG 203s SEQ5> NNNNNNNN 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ2> CGNNGTAG 203s SEQ6> NNNNNNAA 203s SCORE> 7 203s WEIGHT> 8 203s ERROR> 0.125000 203s 203s SEQ2> CGNNGTAG 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ2> CGNNGTAG 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ3> CGGC--AA 203s SEQ4> CGNN--AG 203s SCORE> 7 203s WEIGHT> 8 203s ERROR> 0.125000 203s 203s SEQ3> CGGC--AA 203s SEQ5> NNNNNNNN 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ6> NNNNNNAA 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ7> -------- 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ3> CGGC--AA 203s SEQ8> CG------ 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ4> CGNN--AG 203s SEQ5> NNNNNNNN 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ4> CGNN--AG 203s SEQ6> NNNNNNAA 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ4> CGNN--AG 203s SEQ7> -------- 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ4> CGNN--AG 203s SEQ8> CG------ 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ5> NNNNNNNN 203s SEQ6> NNNNNNAA 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ6> NNNNNNAA 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ6> NNNNNNAA 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ7> -------- 203s SEQ8> CG------ 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s Asymmetric DNA Scores> 203s SEQ1> CGGCGTAA 203s SEQ2> CGNNGTAG 203s SCORE> 7 203s WEIGHT> 8 203s ERROR> 0.125000 203s 203s SEQ1> CGGCGTAA 203s SEQ3> CGGC--AA 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ4> CGNN--AG 203s SCORE> 7 203s WEIGHT> 8 203s ERROR> 0.125000 203s 203s SEQ1> CGGCGTAA 203s SEQ5> NNNNNNNN 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ6> NNNNNNAA 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ7> -------- 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ8> CG------ 203s SCORE> 8 203s WEIGHT> 8 203s ERROR> 0.000000 203s 203s SEQ2> CGNNGTAG 203s SEQ3> CGGC--AA 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ2> CGNNGTAG 203s SEQ4> CGNN--AG 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ2> CGNNGTAG 203s SEQ5> NNNNNNNN 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ2> CGNNGTAG 203s SEQ6> NNNNNNAA 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ2> CGNNGTAG 203s SEQ7> -------- 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ2> CGNNGTAG 203s SEQ8> CG------ 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ4> CGNN--AG 203s SCORE> 5 203s WEIGHT> 8 203s ERROR> 0.375000 203s 203s SEQ3> CGGC--AA 203s SEQ5> NNNNNNNN 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ6> NNNNNNAA 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ7> -------- 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ3> CGGC--AA 203s SEQ8> CG------ 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ4> CGNN--AG 203s SEQ5> NNNNNNNN 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ4> CGNN--AG 203s SEQ6> NNNNNNAA 203s SCORE> 3 203s WEIGHT> 8 203s ERROR> 0.625000 203s 203s SEQ4> CGNN--AG 203s SEQ7> -------- 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ4> CGNN--AG 203s SEQ8> CG------ 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ5> NNNNNNNN 203s SEQ6> NNNNNNAA 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ8> CG------ 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ6> NNNNNNAA 203s SEQ7> -------- 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ6> NNNNNNAA 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ7> -------- 203s SEQ8> CG------ 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s Masked DNA Scores> 203s SEQ1> CGGCGTAA 203s SEQ2> CGNNGTAG 203s SCORE> 5 203s WEIGHT> 6 203s ERROR> 0.166667 203s 203s SEQ1> CGGCGTAA 203s SEQ3> CGGC--AA 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s SEQ1> CGGCGTAA 203s SEQ4> CGNN--AG 203s SCORE> 3 203s WEIGHT> 6 203s ERROR> 0.500000 203s 203s SEQ1> CGGCGTAA 203s SEQ5> NNNNNNNN 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ6> NNNNNNAA 203s SCORE> 2 203s WEIGHT> 2 203s ERROR> 0.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 8 203s ERROR> 1.000000 203s 203s SEQ1> CGGCGTAA 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ2> CGNNGTAG 203s SEQ3> CGGC--AA 203s SCORE> 3 203s WEIGHT> 6 203s ERROR> 0.500000 203s 203s SEQ2> CGNNGTAG 203s SEQ4> CGNN--AG 203s SCORE> 4 203s WEIGHT> 6 203s ERROR> 0.333333 203s 203s SEQ2> CGNNGTAG 203s SEQ5> NNNNNNNN 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ2> CGNNGTAG 203s SEQ6> NNNNNNAA 203s SCORE> 1 203s WEIGHT> 2 203s ERROR> 0.500000 203s 203s SEQ2> CGNNGTAG 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 6 203s ERROR> 1.000000 203s 203s SEQ2> CGNNGTAG 203s SEQ8> CG------ 203s SCORE> 2 203s WEIGHT> 6 203s ERROR> 0.666667 203s 203s SEQ3> CGGC--AA 203s SEQ4> CGNN--AG 203s SCORE> 5 203s WEIGHT> 6 203s ERROR> 0.166667 203s 203s SEQ3> CGGC--AA 203s SEQ5> NNNNNNNN 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ3> CGGC--AA 203s SEQ6> NNNNNNAA 203s SCORE> 2 203s WEIGHT> 2 203s ERROR> 0.000000 203s 203s SEQ3> CGGC--AA 203s SEQ7> -------- 203s SCORE> 2 203s WEIGHT> 8 203s ERROR> 0.750000 203s 203s SEQ3> CGGC--AA 203s SEQ8> CG------ 203s SCORE> 4 203s WEIGHT> 8 203s ERROR> 0.500000 203s 203s SEQ4> CGNN--AG 203s SEQ5> NNNNNNNN 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ4> CGNN--AG 203s SEQ6> NNNNNNAA 203s SCORE> 1 203s WEIGHT> 2 203s ERROR> 0.500000 203s 203s SEQ4> CGNN--AG 203s SEQ7> -------- 203s SCORE> 2 203s WEIGHT> 6 203s ERROR> 0.666667 203s 203s SEQ4> CGNN--AG 203s SEQ8> CG------ 203s SCORE> 4 203s WEIGHT> 6 203s ERROR> 0.333333 203s 203s SEQ5> NNNNNNNN 203s SEQ6> NNNNNNAA 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ5> NNNNNNNN 203s SEQ8> CG------ 203s SCORE> 0 203s WEIGHT> 0 203s ERROR> 1.000000 203s 203s SEQ6> NNNNNNAA 203s SEQ7> -------- 203s SCORE> 0 203s WEIGHT> 2 203s ERROR> 1.000000 203s 203s SEQ6> NNNNNNAA 203s SEQ8> CG------ 203s SCORE> 0 203s WEIGHT> 2 203s ERROR> 1.000000 203s 203s SEQ7> -------- 203s SEQ8> CG------ 203s SCORE> 6 203s WEIGHT> 8 203s ERROR> 0.250000 203s 203s <- test_scoreSeqPair() 0.005 203s -> test_weightDNA() 203s DNA Weight> 203s SEQ1> 8 203s SEQ2> 6 203s SEQ3> 8 203s SEQ4> 6 203s SEQ5> 0 203s SEQ6> 2 203s SEQ7> 8 203s SEQ8> 8 203s AA Weight> 203s SEQ1> 8 203s SEQ2> 6 203s SEQ3> 8 203s SEQ4> 6 203s <- test_weightDNA() 0.000 203s -> test_consensusUnify() 203s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 203s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 203s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 203s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 203s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 203s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 203s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 203s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 203s <- test_consensusUnify() 0.000 203s -> test_deletionUnify() 203s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 203s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 203s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 203s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 203s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 203s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 203s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 203s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 203s <- test_deletionUnify() 0.000 204s pybuild-autopkgtest: error: pybuild --autopkgtest -i python{version} -p "3.13 3.12" returned exit code 13 204s make: *** [/tmp/aFb5jVSBBz/run:4: pybuild-autopkgtest] Error 25 204s pybuild-autopkgtest: error: /tmp/aFb5jVSBBz/run pybuild-autopkgtest returned exit code 2 204s autopkgtest [12:25:05]: test pybuild-autopkgtest: -----------------------] 211s autopkgtest [12:25:12]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 211s pybuild-autopkgtest FAIL non-zero exit status 25 213s autopkgtest [12:25:14]: @@@@@@@@@@@@@@@@@@@@ summary 213s pybuild-autopkgtest FAIL non-zero exit status 25 233s virt: nova [W] Using flock in prodstack6-s390x 233s virt: Creating nova instance adt-plucky-s390x-presto-20241113-122141-juju-7f2275-prod-proposed-migration-environment-2-d72101fc-9565-452f-9cc4-4d3c3733a531 from image adt/ubuntu-plucky-s390x-server-20241113.img (UUID e740277e-1f72-40ae-bfbe-46030537c71c)...