0s autopkgtest [15:47:32]: starting date and time: 2025-03-15 15:47:32+0000 0s autopkgtest [15:47:32]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [15:47:32]: host juju-7f2275-prod-proposed-migration-environment-20; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.jjq6by5e/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-20@bos03-s390x-23.secgroup --name adt-plucky-s390x-ncbi-blast+-20250315-154731-juju-7f2275-prod-proposed-migration-environment-20-52837f46-0602-422b-8dfa-2c8194d790e4 --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-20 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 169s autopkgtest [15:50:21]: testbed dpkg architecture: s390x 169s autopkgtest [15:50:21]: testbed apt version: 2.9.33 169s autopkgtest [15:50:21]: @@@@@@@@@@@@@@@@@@@@ test bed setup 170s autopkgtest [15:50:22]: testbed release detected to be: None 170s autopkgtest [15:50:22]: updating testbed package index (apt update) 171s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 171s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 171s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 171s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 171s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 171s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [99.7 kB] 171s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [379 kB] 172s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [113 kB] 172s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x c-n-f Metadata [1824 B] 172s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted s390x c-n-f Metadata [116 B] 172s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [320 kB] 172s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x c-n-f Metadata [13.4 kB] 172s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [3776 B] 172s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x c-n-f Metadata [240 B] 173s Fetched 1073 kB in 2s (538 kB/s) 173s Reading package lists... 174s Reading package lists... 174s Building dependency tree... 174s Reading state information... 174s Calculating upgrade... 174s Calculating upgrade... 174s The following packages were automatically installed and are no longer required: 174s libnsl2 libpython3.12-minimal libpython3.12-stdlib libpython3.12t64 174s linux-headers-6.11.0-8 linux-headers-6.11.0-8-generic 174s linux-modules-6.11.0-8-generic linux-tools-6.11.0-8 174s linux-tools-6.11.0-8-generic 174s Use 'sudo apt autoremove' to remove them. 174s The following packages will be upgraded: 174s pinentry-curses python3-jinja2 strace 174s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 174s Need to get 652 kB of archives. 174s After this operation, 27.6 kB of additional disk space will be used. 174s Get:1 http://ftpmaster.internal/ubuntu plucky/main s390x strace s390x 6.13+ds-1ubuntu1 [500 kB] 175s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x pinentry-curses s390x 1.3.1-2ubuntu3 [42.9 kB] 175s Get:3 http://ftpmaster.internal/ubuntu plucky/main s390x python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 175s Fetched 652 kB in 1s (647 kB/s) 176s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 176s Preparing to unpack .../strace_6.13+ds-1ubuntu1_s390x.deb ... 176s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 176s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_s390x.deb ... 176s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 176s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 176s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 176s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 176s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 176s Setting up strace (6.13+ds-1ubuntu1) ... 176s Processing triggers for man-db (2.13.0-1) ... 177s Reading package lists... 177s Building dependency tree... 177s Reading state information... 177s Solving dependencies... 177s The following packages will be REMOVED: 177s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 177s linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 177s linux-modules-6.11.0-8-generic* linux-tools-6.11.0-8* 177s linux-tools-6.11.0-8-generic* 177s 0 upgraded, 0 newly installed, 9 to remove and 5 not upgraded. 177s After this operation, 167 MB disk space will be freed. 177s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81428 files and directories currently installed.) 177s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 177s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 177s Removing libpython3.12t64:s390x (3.12.9-1) ... 177s Removing libpython3.12-stdlib:s390x (3.12.9-1) ... 177s Removing libnsl2:s390x (1.3.0-3build3) ... 177s Removing libpython3.12-minimal:s390x (3.12.9-1) ... 177s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 177s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 178s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 178s Processing triggers for libc-bin (2.41-1ubuntu1) ... 178s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56328 files and directories currently installed.) 178s Purging configuration files for libpython3.12-minimal:s390x (3.12.9-1) ... 178s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 178s autopkgtest [15:50:30]: upgrading testbed (apt dist-upgrade and autopurge) 179s Reading package lists... 179s Building dependency tree... 179s Reading state information... 179s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 179s Starting 2 pkgProblemResolver with broken count: 0 179s Done 179s Entering ResolveByKeep 179s 179s Calculating upgrade... 179s The following packages will be upgraded: 179s libc-bin libc-dev-bin libc6 libc6-dev locales 180s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 180s Need to get 9512 kB of archives. 180s After this operation, 8192 B of additional disk space will be used. 180s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6-dev s390x 2.41-1ubuntu2 [1678 kB] 182s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-dev-bin s390x 2.41-1ubuntu2 [24.3 kB] 182s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc6 s390x 2.41-1ubuntu2 [2892 kB] 185s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libc-bin s390x 2.41-1ubuntu2 [671 kB] 186s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x locales all 2.41-1ubuntu2 [4246 kB] 191s Preconfiguring packages ... 191s Fetched 9512 kB in 12s (821 kB/s) 191s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 191s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_s390x.deb ... 191s Unpacking libc6-dev:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 191s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_s390x.deb ... 191s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 191s Preparing to unpack .../libc6_2.41-1ubuntu2_s390x.deb ... 191s Unpacking libc6:s390x (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 191s Setting up libc6:s390x (2.41-1ubuntu2) ... 192s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 192s Preparing to unpack .../libc-bin_2.41-1ubuntu2_s390x.deb ... 192s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 192s Setting up libc-bin (2.41-1ubuntu2) ... 192s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 192s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 192s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 192s Setting up locales (2.41-1ubuntu2) ... 192s Generating locales (this might take a while)... 193s en_US.UTF-8... done 193s Generation complete. 193s Setting up libc-dev-bin (2.41-1ubuntu2) ... 193s Setting up libc6-dev:s390x (2.41-1ubuntu2) ... 193s Processing triggers for man-db (2.13.0-1) ... 194s Processing triggers for systemd (257.3-1ubuntu3) ... 195s Reading package lists... 195s Building dependency tree... 195s Reading state information... 195s Starting pkgProblemResolver with broken count: 0 195s Starting 2 pkgProblemResolver with broken count: 0 195s Done 195s Solving dependencies... 195s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 196s autopkgtest [15:50:48]: rebooting testbed after setup commands that affected boot 216s autopkgtest [15:51:08]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP Wed Mar 12 14:53:49 UTC 2025 219s autopkgtest [15:51:11]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 241s Get:1 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (dsc) [2401 B] 241s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (tar) [18.4 MB] 241s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (diff) [40.8 kB] 241s gpgv: Signature made Thu Nov 21 15:47:04 2024 UTC 241s gpgv: using RSA key 4D0BE12F0E4776D8AACE9696E66C775AEBFE6C7D 241s gpgv: Can't check signature: No public key 241s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6build1.dsc: no acceptable signature found 242s autopkgtest [15:51:34]: testing package ncbi-blast+ version 2.16.0+ds-6build1 243s autopkgtest [15:51:35]: build not needed 249s autopkgtest [15:51:40]: test run-unit-test: preparing testbed 249s Reading package lists... 249s Building dependency tree... 249s Reading state information... 249s Starting pkgProblemResolver with broken count: 0 249s Starting 2 pkgProblemResolver with broken count: 0 249s Done 249s The following NEW packages will be installed: 249s libgomp1 libmbedcrypto16 libmbedtls21 libmbedx509-7 ncbi-blast+ 249s ncbi-blast+-legacy ncbi-data 249s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 249s Need to get 19.8 MB of archives. 249s After this operation, 87.6 MB of additional disk space will be used. 249s Get:1 http://ftpmaster.internal/ubuntu plucky/main s390x libgomp1 s390x 15-20250222-0ubuntu1 [152 kB] 250s Get:2 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedcrypto16 s390x 3.6.2-3ubuntu1 [261 kB] 250s Get:3 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedx509-7 s390x 3.6.2-3ubuntu1 [34.9 kB] 250s Get:4 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedtls21 s390x 3.6.2-3ubuntu1 [122 kB] 250s Get:5 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 255s Get:6 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-blast+ s390x 2.16.0+ds-6build1 [15.2 MB] 271s Get:7 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-blast+-legacy all 2.16.0+ds-6build1 [4984 B] 271s Fetched 19.8 MB in 22s (909 kB/s) 271s Selecting previously unselected package libgomp1:s390x. 271s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 56326 files and directories currently installed.) 271s Preparing to unpack .../0-libgomp1_15-20250222-0ubuntu1_s390x.deb ... 271s Unpacking libgomp1:s390x (15-20250222-0ubuntu1) ... 271s Selecting previously unselected package libmbedcrypto16:s390x. 271s Preparing to unpack .../1-libmbedcrypto16_3.6.2-3ubuntu1_s390x.deb ... 271s Unpacking libmbedcrypto16:s390x (3.6.2-3ubuntu1) ... 271s Selecting previously unselected package libmbedx509-7:s390x. 271s Preparing to unpack .../2-libmbedx509-7_3.6.2-3ubuntu1_s390x.deb ... 271s Unpacking libmbedx509-7:s390x (3.6.2-3ubuntu1) ... 271s Selecting previously unselected package libmbedtls21:s390x. 271s Preparing to unpack .../3-libmbedtls21_3.6.2-3ubuntu1_s390x.deb ... 271s Unpacking libmbedtls21:s390x (3.6.2-3ubuntu1) ... 271s Selecting previously unselected package ncbi-data. 271s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 271s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 272s Selecting previously unselected package ncbi-blast+. 272s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6build1_s390x.deb ... 272s Unpacking ncbi-blast+ (2.16.0+ds-6build1) ... 272s Selecting previously unselected package ncbi-blast+-legacy. 272s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6build1_all.deb ... 272s Unpacking ncbi-blast+-legacy (2.16.0+ds-6build1) ... 272s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 272s Setting up libgomp1:s390x (15-20250222-0ubuntu1) ... 272s Setting up libmbedcrypto16:s390x (3.6.2-3ubuntu1) ... 272s Setting up libmbedx509-7:s390x (3.6.2-3ubuntu1) ... 272s Setting up libmbedtls21:s390x (3.6.2-3ubuntu1) ... 272s Setting up ncbi-blast+ (2.16.0+ds-6build1) ... 272s Setting up ncbi-blast+-legacy (2.16.0+ds-6build1) ... 272s Processing triggers for man-db (2.13.0-1) ... 272s Processing triggers for libc-bin (2.41-1ubuntu2) ... 274s autopkgtest [15:52:06]: test run-unit-test: [----------------------- 274s ---Creating Database-- 274s 274s 274s Building a new DB, current time: 03/15/2025 15:52:06 274s New DB name: /tmp/autopkgtest.6Uc79I/autopkgtest_tmp/testdb 274s New DB title: testdatabase.fa 274s Sequence type: Nucleotide 274s Keep MBits: T 274s Maximum file size: 3000000000B 274s Adding sequences from FASTA; added 3 sequences in 0.279558 seconds. 274s 274s 274s ---Searching Database for Hits--- 274s Warning: [blastn] Examining 5 or more matches is recommended 274s # BLASTN 2.16.0+ 274s # Query: gnl|MYDB|1 this is sequence 1 274s # Database: testdb 274s # Fields: query id, subject id, evalue, bit score 274s # 2 hits found 274s gnl|MYDB|1 gnl2 0.0 1299 274s gnl|MYDB|1 gnl1 0.0 1299 274s # BLAST processed 1 queries 274s ---Search and Fetch An Entry From Database--- 274s >gnl1 274s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 274s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 274s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 274s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 274s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 274s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 274s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 274s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 274s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 274s PASS 275s autopkgtest [15:52:07]: test run-unit-test: -----------------------] 275s run-unit-test PASS 275s autopkgtest [15:52:07]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 276s autopkgtest [15:52:08]: @@@@@@@@@@@@@@@@@@@@ summary 276s run-unit-test PASS 283s nova [W] Using flock in prodstack6-s390x 283s Creating nova instance adt-plucky-s390x-ncbi-blast+-20250315-154731-juju-7f2275-prod-proposed-migration-environment-20-52837f46-0602-422b-8dfa-2c8194d790e4 from image adt/ubuntu-plucky-s390x-server-20250315.img (UUID 3d3557fa-fd0f-4bba-9b89-8d5964e09f61)... 283s nova [W] Timed out waiting for 4e2175b5-d34a-4712-8a32-30d0f55349f1 to get deleted.