0s autopkgtest [12:02:17]: starting date and time: 2024-11-13 12:02:17+0000 0s autopkgtest [12:02:17]: git checkout: 6f3be7a8 Fix armhf LXD image generation for plucky 0s autopkgtest [12:02:17]: host juju-7f2275-prod-proposed-migration-environment-15; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.kmdks6xw/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-s390x --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-15@bos03-s390x-22.secgroup --name adt-plucky-s390x-ncbi-blast+-20241113-120217-juju-7f2275-prod-proposed-migration-environment-15-875a651c-7b93-46de-b4aa-5c3121841ba9 --image adt/ubuntu-plucky-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-15 --net-id=net_prod-proposed-migration-s390x -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 100s autopkgtest [12:03:57]: testbed dpkg architecture: s390x 101s autopkgtest [12:03:58]: testbed apt version: 2.9.8 101s autopkgtest [12:03:58]: @@@@@@@@@@@@@@@@@@@@ test bed setup 101s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 102s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 102s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 102s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 102s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 102s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x Packages [85.8 kB] 102s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe s390x Packages [565 kB] 102s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse s390x Packages [16.6 kB] 102s Fetched 1689 kB in 1s (2105 kB/s) 102s Reading package lists... 104s Reading package lists... 104s Building dependency tree... 104s Reading state information... 104s Calculating upgrade... 104s The following NEW packages will be installed: 104s python3.13-gdbm 104s The following packages will be upgraded: 104s libgpgme11t64 libpython3-stdlib python3 python3-gdbm python3-minimal 105s 5 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 105s Need to get 252 kB of archives. 105s After this operation, 98.3 kB of additional disk space will be used. 105s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3-minimal s390x 3.12.7-1 [27.4 kB] 105s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3 s390x 3.12.7-1 [24.0 kB] 105s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x libpython3-stdlib s390x 3.12.7-1 [10.0 kB] 105s Get:4 http://ftpmaster.internal/ubuntu plucky/main s390x python3.13-gdbm s390x 3.13.0-2 [31.0 kB] 105s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main s390x python3-gdbm s390x 3.12.7-1 [8642 B] 105s Get:6 http://ftpmaster.internal/ubuntu plucky/main s390x libgpgme11t64 s390x 1.23.2-5ubuntu4 [151 kB] 105s Fetched 252 kB in 0s (579 kB/s) 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55510 files and directories currently installed.) 105s Preparing to unpack .../python3-minimal_3.12.7-1_s390x.deb ... 105s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 105s Setting up python3-minimal (3.12.7-1) ... 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55510 files and directories currently installed.) 105s Preparing to unpack .../python3_3.12.7-1_s390x.deb ... 105s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 106s Preparing to unpack .../libpython3-stdlib_3.12.7-1_s390x.deb ... 106s Unpacking libpython3-stdlib:s390x (3.12.7-1) over (3.12.6-0ubuntu1) ... 106s Selecting previously unselected package python3.13-gdbm. 106s Preparing to unpack .../python3.13-gdbm_3.13.0-2_s390x.deb ... 106s Unpacking python3.13-gdbm (3.13.0-2) ... 106s Preparing to unpack .../python3-gdbm_3.12.7-1_s390x.deb ... 106s Unpacking python3-gdbm:s390x (3.12.7-1) over (3.12.6-1ubuntu1) ... 106s Preparing to unpack .../libgpgme11t64_1.23.2-5ubuntu4_s390x.deb ... 106s Unpacking libgpgme11t64:s390x (1.23.2-5ubuntu4) over (1.18.0-4.1ubuntu4) ... 106s Setting up libgpgme11t64:s390x (1.23.2-5ubuntu4) ... 106s Setting up python3.13-gdbm (3.13.0-2) ... 106s Setting up libpython3-stdlib:s390x (3.12.7-1) ... 106s Setting up python3 (3.12.7-1) ... 106s Setting up python3-gdbm:s390x (3.12.7-1) ... 106s Processing triggers for man-db (2.12.1-3) ... 106s Processing triggers for libc-bin (2.40-1ubuntu3) ... 106s Reading package lists... 107s Building dependency tree... 107s Reading state information... 107s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 107s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 107s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 107s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 107s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 109s Reading package lists... 109s Reading package lists... 109s Building dependency tree... 109s Reading state information... 109s Calculating upgrade... 109s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 109s Reading package lists... 109s Building dependency tree... 109s Reading state information... 109s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 111s autopkgtest [12:04:08]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP Mon Sep 16 12:49:35 UTC 2024 111s autopkgtest [12:04:08]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 114s Get:1 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (dsc) [2498 B] 114s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (tar) [18.4 MB] 114s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (diff) [40.7 kB] 114s gpgv: Signature made Wed Aug 7 01:47:58 2024 UTC 114s gpgv: using RSA key 7C3AB9CFD230BD30DD009C591E7091B1F14A64A2 114s gpgv: Can't check signature: No public key 114s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6.dsc: no acceptable signature found 115s autopkgtest [12:04:12]: testing package ncbi-blast+ version 2.16.0+ds-6 116s autopkgtest [12:04:13]: build not needed 121s autopkgtest [12:04:18]: test run-unit-test: preparing testbed 128s Reading package lists... 128s Building dependency tree... 128s Reading state information... 128s Starting pkgProblemResolver with broken count: 0 128s Starting 2 pkgProblemResolver with broken count: 0 128s Done 128s The following additional packages will be installed: 128s libgomp1 libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 ncbi-blast+ 128s ncbi-blast+-legacy ncbi-data 128s The following NEW packages will be installed: 128s autopkgtest-satdep libgomp1 libmbedcrypto7t64 libmbedtls14t64 128s libmbedx509-1t64 ncbi-blast+ ncbi-blast+-legacy ncbi-data 128s 0 upgraded, 8 newly installed, 0 to remove and 0 not upgraded. 128s Need to get 19.7 MB/19.7 MB of archives. 128s After this operation, 87.3 MB of additional disk space will be used. 128s Get:1 /tmp/autopkgtest.1R9Peg/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [720 B] 128s Get:2 http://ftpmaster.internal/ubuntu plucky/main s390x libgomp1 s390x 14.2.0-8ubuntu1 [151 kB] 129s Get:3 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedcrypto7t64 s390x 2.28.8-1 [219 kB] 129s Get:4 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedx509-1t64 s390x 2.28.8-1 [46.2 kB] 129s Get:5 http://ftpmaster.internal/ubuntu plucky/universe s390x libmbedtls14t64 s390x 2.28.8-1 [84.7 kB] 129s Get:6 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 129s Get:7 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-blast+ s390x 2.16.0+ds-6 [15.2 MB] 129s Get:8 http://ftpmaster.internal/ubuntu plucky/universe s390x ncbi-blast+-legacy all 2.16.0+ds-6 [4990 B] 130s Fetched 19.7 MB in 1s (15.2 MB/s) 130s Selecting previously unselected package libgomp1:s390x. 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 55517 files and directories currently installed.) 130s Preparing to unpack .../0-libgomp1_14.2.0-8ubuntu1_s390x.deb ... 130s Unpacking libgomp1:s390x (14.2.0-8ubuntu1) ... 130s Selecting previously unselected package libmbedcrypto7t64:s390x. 130s Preparing to unpack .../1-libmbedcrypto7t64_2.28.8-1_s390x.deb ... 130s Unpacking libmbedcrypto7t64:s390x (2.28.8-1) ... 130s Selecting previously unselected package libmbedx509-1t64:s390x. 130s Preparing to unpack .../2-libmbedx509-1t64_2.28.8-1_s390x.deb ... 130s Unpacking libmbedx509-1t64:s390x (2.28.8-1) ... 130s Selecting previously unselected package libmbedtls14t64:s390x. 130s Preparing to unpack .../3-libmbedtls14t64_2.28.8-1_s390x.deb ... 130s Unpacking libmbedtls14t64:s390x (2.28.8-1) ... 130s Selecting previously unselected package ncbi-data. 130s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 130s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 130s Selecting previously unselected package ncbi-blast+. 130s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6_s390x.deb ... 130s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 130s Selecting previously unselected package ncbi-blast+-legacy. 130s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6_all.deb ... 130s Unpacking ncbi-blast+-legacy (2.16.0+ds-6) ... 130s Selecting previously unselected package autopkgtest-satdep. 130s Preparing to unpack .../7-1-autopkgtest-satdep.deb ... 130s Unpacking autopkgtest-satdep (0) ... 130s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 130s Setting up libmbedcrypto7t64:s390x (2.28.8-1) ... 130s Setting up libgomp1:s390x (14.2.0-8ubuntu1) ... 130s Setting up libmbedx509-1t64:s390x (2.28.8-1) ... 130s Setting up libmbedtls14t64:s390x (2.28.8-1) ... 130s Setting up ncbi-blast+ (2.16.0+ds-6) ... 130s Setting up ncbi-blast+-legacy (2.16.0+ds-6) ... 130s Setting up autopkgtest-satdep (0) ... 130s Processing triggers for man-db (2.12.1-3) ... 130s Processing triggers for libc-bin (2.40-1ubuntu3) ... 132s (Reading database ... 55791 files and directories currently installed.) 132s Removing autopkgtest-satdep (0) ... 133s autopkgtest [12:04:30]: test run-unit-test: [----------------------- 133s ---Creating Database-- 133s 133s 133s Building a new DB, current time: 11/13/2024 12:04:30 133s New DB name: /tmp/autopkgtest.1R9Peg/autopkgtest_tmp/testdb 133s New DB title: testdatabase.fa 133s Sequence type: Nucleotide 133s Keep MBits: T 133s Maximum file size: 3000000000B 133s Adding sequences from FASTA; added 3 sequences in 0.178575 seconds. 133s 133s 133s ---Searching Database for Hits--- 133s # BLASTN 2.16.0+ 133s # Query: gnl|MYDB|1 this is sequence 1 133s # Database: testdb 133s # Fields: query id, subject id, evalue, bit score 133s # 2 hits found 133s gnl|MYDB|1 gnl2 0.0 1299 133s gnl|MYDB|1 gnl1 0.0 1299 133s # BLAST processed 1 queries 133s Warning: [blastn] Examining 5 or more matches is recommended 133s ---Search and Fetch An Entry From Database--- 133s >gnl1 133s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 133s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 133s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 133s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 133s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 133s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 133s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 133s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 133s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 133s PASS 134s autopkgtest [12:04:31]: test run-unit-test: -----------------------] 134s autopkgtest [12:04:31]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 134s run-unit-test PASS 135s autopkgtest [12:04:32]: @@@@@@@@@@@@@@@@@@@@ summary 135s run-unit-test PASS 147s nova [W] Using flock in prodstack6-s390x 147s flock: timeout while waiting to get lock 147s Creating nova instance adt-plucky-s390x-ncbi-blast+-20241113-120217-juju-7f2275-prod-proposed-migration-environment-15-875a651c-7b93-46de-b4aa-5c3121841ba9 from image adt/ubuntu-plucky-s390x-server-20241113.img (UUID e740277e-1f72-40ae-bfbe-46030537c71c)...