0s autopkgtest [19:34:52]: starting date and time: 2024-11-13 19:34:52+0000 0s autopkgtest [19:34:52]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 0s autopkgtest [19:34:52]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.az6qd5dh/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-ppc64el --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-ppc64el-10.secgroup --name adt-plucky-ppc64el-presto-20241113-193452-juju-7f2275-prod-proposed-migration-environment-2-ed0003df-ecdd-4c92-908f-c78b647e8172 --image adt/ubuntu-plucky-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-ppc64el -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 100s autopkgtest [19:36:32]: testbed dpkg architecture: ppc64el 100s autopkgtest [19:36:32]: testbed apt version: 2.9.8 100s autopkgtest [19:36:32]: @@@@@@@@@@@@@@@@@@@@ test bed setup 101s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 101s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 102s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [17.2 kB] 102s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [98.3 kB] 102s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [958 kB] 102s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el Packages [108 kB] 102s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el Packages [673 kB] 102s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el Packages [20.8 kB] 102s Fetched 1956 kB in 1s (1886 kB/s) 102s Reading package lists... 105s Reading package lists... 105s Building dependency tree... 105s Reading state information... 105s Calculating upgrade... 105s The following NEW packages will be installed: 105s python3.13-gdbm 105s The following packages will be upgraded: 105s bpfcc-tools bpftrace libbpfcc libgnutls30t64 libjson-glib-1.0-0 105s libjson-glib-1.0-common libnewt0.52 libpython3-stdlib libutempter0 python3 105s python3-bpfcc python3-gdbm python3-minimal python3-newt whiptail 106s 15 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 106s Need to get 4700 kB of archives. 106s After this operation, 215 kB of additional disk space will be used. 106s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-minimal ppc64el 3.12.7-1 [27.4 kB] 106s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3 ppc64el 3.12.7-1 [24.0 kB] 106s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el libpython3-stdlib ppc64el 3.12.7-1 [10.0 kB] 106s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgnutls30t64 ppc64el 3.8.8-2ubuntu1 [1072 kB] 106s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-newt ppc64el 0.52.24-2ubuntu4 [21.8 kB] 106s Get:6 http://ftpmaster.internal/ubuntu plucky/main ppc64el libnewt0.52 ppc64el 0.52.24-2ubuntu4 [62.1 kB] 106s Get:7 http://ftpmaster.internal/ubuntu plucky/main ppc64el whiptail ppc64el 0.52.24-2ubuntu4 [19.5 kB] 106s Get:8 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-gdbm ppc64el 3.13.0-2 [31.5 kB] 106s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-gdbm ppc64el 3.12.7-1 [8640 B] 106s Get:10 http://ftpmaster.internal/ubuntu plucky/main ppc64el libbpfcc ppc64el 0.30.0+ds-1ubuntu5 [696 kB] 106s Get:11 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-bpfcc all 0.30.0+ds-1ubuntu5 [40.4 kB] 106s Get:12 http://ftpmaster.internal/ubuntu plucky/main ppc64el bpfcc-tools all 0.30.0+ds-1ubuntu5 [697 kB] 106s Get:13 http://ftpmaster.internal/ubuntu plucky/main ppc64el bpftrace ppc64el 0.21.2-2ubuntu2 [1898 kB] 106s Get:14 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjson-glib-1.0-common all 1.10.0+ds-3 [5586 B] 106s Get:15 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjson-glib-1.0-0 ppc64el 1.10.0+ds-3 [76.0 kB] 106s Get:16 http://ftpmaster.internal/ubuntu plucky/main ppc64el libutempter0 ppc64el 1.2.1-4 [9850 B] 107s Fetched 4700 kB in 1s (6248 kB/s) 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 107s Preparing to unpack .../python3-minimal_3.12.7-1_ppc64el.deb ... 107s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 108s Setting up python3-minimal (3.12.7-1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 108s Preparing to unpack .../python3_3.12.7-1_ppc64el.deb ... 108s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 108s Preparing to unpack .../libpython3-stdlib_3.12.7-1_ppc64el.deb ... 108s Unpacking libpython3-stdlib:ppc64el (3.12.7-1) over (3.12.6-0ubuntu1) ... 108s Preparing to unpack .../libgnutls30t64_3.8.8-2ubuntu1_ppc64el.deb ... 108s Unpacking libgnutls30t64:ppc64el (3.8.8-2ubuntu1) over (3.8.6-2ubuntu1) ... 108s Setting up libgnutls30t64:ppc64el (3.8.8-2ubuntu1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 108s Preparing to unpack .../00-python3-newt_0.52.24-2ubuntu4_ppc64el.deb ... 108s Unpacking python3-newt:ppc64el (0.52.24-2ubuntu4) over (0.52.24-2ubuntu3) ... 108s Preparing to unpack .../01-libnewt0.52_0.52.24-2ubuntu4_ppc64el.deb ... 108s Unpacking libnewt0.52:ppc64el (0.52.24-2ubuntu4) over (0.52.24-2ubuntu3) ... 108s Preparing to unpack .../02-whiptail_0.52.24-2ubuntu4_ppc64el.deb ... 108s Unpacking whiptail (0.52.24-2ubuntu4) over (0.52.24-2ubuntu3) ... 108s Selecting previously unselected package python3.13-gdbm. 108s Preparing to unpack .../03-python3.13-gdbm_3.13.0-2_ppc64el.deb ... 108s Unpacking python3.13-gdbm (3.13.0-2) ... 108s Preparing to unpack .../04-python3-gdbm_3.12.7-1_ppc64el.deb ... 108s Unpacking python3-gdbm:ppc64el (3.12.7-1) over (3.12.6-1ubuntu1) ... 108s Preparing to unpack .../05-libbpfcc_0.30.0+ds-1ubuntu5_ppc64el.deb ... 108s Unpacking libbpfcc:ppc64el (0.30.0+ds-1ubuntu5) over (0.30.0+ds-1ubuntu4) ... 108s Preparing to unpack .../06-python3-bpfcc_0.30.0+ds-1ubuntu5_all.deb ... 109s Unpacking python3-bpfcc (0.30.0+ds-1ubuntu5) over (0.30.0+ds-1ubuntu4) ... 109s Preparing to unpack .../07-bpfcc-tools_0.30.0+ds-1ubuntu5_all.deb ... 109s Unpacking bpfcc-tools (0.30.0+ds-1ubuntu5) over (0.30.0+ds-1ubuntu4) ... 109s Preparing to unpack .../08-bpftrace_0.21.2-2ubuntu2_ppc64el.deb ... 109s Unpacking bpftrace (0.21.2-2ubuntu2) over (0.21.2-2) ... 109s Preparing to unpack .../09-libjson-glib-1.0-common_1.10.0+ds-3_all.deb ... 109s Unpacking libjson-glib-1.0-common (1.10.0+ds-3) over (1.10.0+ds-2) ... 109s Preparing to unpack .../10-libjson-glib-1.0-0_1.10.0+ds-3_ppc64el.deb ... 109s Unpacking libjson-glib-1.0-0:ppc64el (1.10.0+ds-3) over (1.10.0+ds-2) ... 109s Preparing to unpack .../11-libutempter0_1.2.1-4_ppc64el.deb ... 109s Unpacking libutempter0:ppc64el (1.2.1-4) over (1.2.1-3build1) ... 109s Setting up libnewt0.52:ppc64el (0.52.24-2ubuntu4) ... 109s Setting up libutempter0:ppc64el (1.2.1-4) ... 109s Setting up whiptail (0.52.24-2ubuntu4) ... 109s Setting up libjson-glib-1.0-common (1.10.0+ds-3) ... 109s Setting up libbpfcc:ppc64el (0.30.0+ds-1ubuntu5) ... 109s Setting up python3.13-gdbm (3.13.0-2) ... 109s Setting up libpython3-stdlib:ppc64el (3.12.7-1) ... 109s Setting up bpftrace (0.21.2-2ubuntu2) ... 109s Setting up python3 (3.12.7-1) ... 109s Setting up python3-newt:ppc64el (0.52.24-2ubuntu4) ... 110s Setting up libjson-glib-1.0-0:ppc64el (1.10.0+ds-3) ... 110s Setting up python3-bpfcc (0.30.0+ds-1ubuntu5) ... 110s Setting up python3-gdbm:ppc64el (3.12.7-1) ... 110s Setting up bpfcc-tools (0.30.0+ds-1ubuntu5) ... 110s Processing triggers for man-db (2.12.1-3) ... 112s Processing triggers for libc-bin (2.40-1ubuntu3) ... 112s Reading package lists... 113s Building dependency tree... 113s Reading state information... 113s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 113s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 113s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 113s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 114s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 115s Reading package lists... 115s Reading package lists... 115s Building dependency tree... 115s Reading state information... 115s Calculating upgrade... 115s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 115s Reading package lists... 115s Building dependency tree... 115s Reading state information... 116s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 118s autopkgtest [19:36:50]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP Mon Sep 16 13:49:23 UTC 2024 119s autopkgtest [19:36:51]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 121s Get:1 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (dsc) [2233 B] 121s Get:2 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (tar) [362 kB] 121s Get:3 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (diff) [20.8 kB] 121s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC 121s gpgv: using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7 121s gpgv: Can't check signature: No public key 121s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found 121s autopkgtest [19:36:53]: testing package presto version 0.7.2-1 122s autopkgtest [19:36:54]: build not needed 122s autopkgtest [19:36:54]: test pybuild-autopkgtest: preparing testbed 124s Reading package lists... 124s Building dependency tree... 124s Reading state information... 124s Starting pkgProblemResolver with broken count: 0 124s Starting 2 pkgProblemResolver with broken count: 0 124s Done 125s The following additional packages will be installed: 125s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-14 125s cpp-14-powerpc64le-linux-gnu cpp-powerpc64le-linux-gnu debhelper debugedit 125s dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config 125s fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ g++-14 125s g++-14-powerpc64le-linux-gnu g++-powerpc64le-linux-gnu gcc gcc-14 125s gcc-14-powerpc64le-linux-gnu gcc-powerpc64le-linux-gnu gettext 125s intltool-debian libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 125s libdebhelper-perl libdeflate0 libfile-stripnondeterminism-perl 125s libfontconfig1 libfontenc1 libgcc-14-dev libgfortran5 libgomp1 125s libgraphite2-3 libharfbuzz0b libimagequant0 libisl23 libitm1 libjbig0 125s libjpeg-turbo8 libjpeg8 liblapack3 liblbfgsb0 liblcms2-2 liblerc4 liblsan0 125s libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 libmpc3 libopenjp2-7 125s libpixman-1-0 libpython3.13-minimal libpython3.13-stdlib libquadmath0 125s libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool libtsan2 libubsan1 125s libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 m4 125s ncbi-blast+ ncbi-data po-debconf presto pybuild-plugin-autopkgtest 125s python3-all python3-biopython python3-cairo python3-dateutil 125s python3-decorator python3-freetype python3-numpy python3-packaging 125s python3-pandas python3-pandas-lib python3-pil python3-presto 125s python3-reportlab python3-rlpycairo python3-scipy python3-six python3-tz 125s python3.13 python3.13-minimal sgml-base vsearch w3c-sgml-lib x11-common 125s xfonts-encodings xfonts-utils xml-core 125s Suggested packages: 125s autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-14-locales 125s cpp-14-doc dh-make flit python3-build python3-installer python3-wheel 125s fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre gcc-14-doc 125s gcc-multilib manpages-dev flex bison gdb gcc-doc gdb-powerpc64le-linux-gnu 125s gettext-doc libasprintf-dev libgettextpo-dev liblcms2-utils libstdc++-14-doc 125s libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc libmail-box-perl 125s python3-tk bwa clustalo clustalw dialign dssp emboss fasttree mafft muscle3 125s phylip phyml prank probcons python3-mysqldb python3-matplotlib python3-mmtf 125s python3-rdflib python3-psycopg2 raxml samtools t-coffee wise gfortran 125s python-numpy-doc python3-dev python3-pytest python-pandas-doc 125s python3-statsmodels python-pil-doc pdf-viewer python3-egenix-mxtexttools 125s python-reportlab-doc rl-accel rl-renderpm python-scipy-doc python3.13-venv 125s python3.13-doc binfmt-support sgml-base-doc 125s Recommended packages: 125s libarchive-cpio-perl libltdl-dev libmail-sendmail-perl python-biopython-doc 125s python3-matplotlib python3-bottleneck python3-numexpr python3-odf 125s python3-openpyxl python3-bs4 python3-html5lib python3-lxml python3-tables 125s python3-olefile fonts-dejavu-extra 125s The following NEW packages will be installed: 125s autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential 125s cd-hit cpp cpp-14 cpp-14-powerpc64le-linux-gnu cpp-powerpc64le-linux-gnu 125s debhelper debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz 125s fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ 125s g++-14 g++-14-powerpc64le-linux-gnu g++-powerpc64le-linux-gnu gcc gcc-14 125s gcc-14-powerpc64le-linux-gnu gcc-powerpc64le-linux-gnu gettext 125s intltool-debian libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 125s libdebhelper-perl libdeflate0 libfile-stripnondeterminism-perl 125s libfontconfig1 libfontenc1 libgcc-14-dev libgfortran5 libgomp1 125s libgraphite2-3 libharfbuzz0b libimagequant0 libisl23 libitm1 libjbig0 125s libjpeg-turbo8 libjpeg8 liblapack3 liblbfgsb0 liblcms2-2 liblerc4 liblsan0 125s libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 libmpc3 libopenjp2-7 125s libpixman-1-0 libpython3.13-minimal libpython3.13-stdlib libquadmath0 125s libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool libtsan2 libubsan1 125s libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 m4 125s ncbi-blast+ ncbi-data po-debconf presto pybuild-plugin-autopkgtest 125s python3-all python3-biopython python3-cairo python3-dateutil 125s python3-decorator python3-freetype python3-numpy python3-packaging 125s python3-pandas python3-pandas-lib python3-pil python3-presto 125s python3-reportlab python3-rlpycairo python3-scipy python3-six python3-tz 125s python3.13 python3.13-minimal sgml-base vsearch w3c-sgml-lib x11-common 125s xfonts-encodings xfonts-utils xml-core 125s 0 upgraded, 111 newly installed, 0 to remove and 0 not upgraded. 125s Need to get 145 MB/145 MB of archives. 125s After this operation, 575 MB of additional disk space will be used. 125s Get:1 /tmp/autopkgtest.W1ftaf/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [824 B] 125s Get:2 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpython3.13-minimal ppc64el 3.13.0-2 [881 kB] 125s Get:3 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-minimal ppc64el 3.13.0-2 [2302 kB] 125s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el sgml-base all 1.31 [11.4 kB] 125s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el m4 ppc64el 1.4.19-4build1 [278 kB] 125s Get:6 http://ftpmaster.internal/ubuntu plucky/main ppc64el autoconf all 2.72-3 [382 kB] 125s Get:7 http://ftpmaster.internal/ubuntu plucky/main ppc64el autotools-dev all 20220109.1 [44.9 kB] 125s Get:8 http://ftpmaster.internal/ubuntu plucky/main ppc64el automake all 1:1.16.5-1.3ubuntu1 [558 kB] 125s Get:9 http://ftpmaster.internal/ubuntu plucky/main ppc64el autopoint all 0.22.5-2 [616 kB] 125s Get:10 http://ftpmaster.internal/ubuntu plucky/main ppc64el libisl23 ppc64el 0.27-1 [882 kB] 125s Get:11 http://ftpmaster.internal/ubuntu plucky/main ppc64el libmpc3 ppc64el 1.3.1-1build2 [62.1 kB] 125s Get:12 http://ftpmaster.internal/ubuntu plucky/main ppc64el cpp-14-powerpc64le-linux-gnu ppc64el 14.2.0-8ubuntu1 [10.5 MB] 126s Get:13 http://ftpmaster.internal/ubuntu plucky/main ppc64el cpp-14 ppc64el 14.2.0-8ubuntu1 [1034 B] 126s Get:14 http://ftpmaster.internal/ubuntu plucky/main ppc64el cpp-powerpc64le-linux-gnu ppc64el 4:14.1.0-2ubuntu1 [5456 B] 126s Get:15 http://ftpmaster.internal/ubuntu plucky/main ppc64el cpp ppc64el 4:14.1.0-2ubuntu1 [22.5 kB] 126s Get:16 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcc1-0 ppc64el 14.2.0-8ubuntu1 [48.1 kB] 126s Get:17 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgomp1 ppc64el 14.2.0-8ubuntu1 [161 kB] 126s Get:18 http://ftpmaster.internal/ubuntu plucky/main ppc64el libitm1 ppc64el 14.2.0-8ubuntu1 [31.9 kB] 126s Get:19 http://ftpmaster.internal/ubuntu plucky/main ppc64el libasan8 ppc64el 14.2.0-8ubuntu1 [2945 kB] 126s Get:20 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblsan0 ppc64el 14.2.0-8ubuntu1 [1322 kB] 126s Get:21 http://ftpmaster.internal/ubuntu plucky/main ppc64el libtsan2 ppc64el 14.2.0-8ubuntu1 [2695 kB] 126s Get:22 http://ftpmaster.internal/ubuntu plucky/main ppc64el libubsan1 ppc64el 14.2.0-8ubuntu1 [1191 kB] 126s Get:23 http://ftpmaster.internal/ubuntu plucky/main ppc64el libquadmath0 ppc64el 14.2.0-8ubuntu1 [158 kB] 126s Get:24 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgcc-14-dev ppc64el 14.2.0-8ubuntu1 [1619 kB] 126s Get:25 http://ftpmaster.internal/ubuntu plucky/main ppc64el gcc-14-powerpc64le-linux-gnu ppc64el 14.2.0-8ubuntu1 [20.6 MB] 127s Get:26 http://ftpmaster.internal/ubuntu plucky/main ppc64el gcc-14 ppc64el 14.2.0-8ubuntu1 [528 kB] 127s Get:27 http://ftpmaster.internal/ubuntu plucky/main ppc64el gcc-powerpc64le-linux-gnu ppc64el 4:14.1.0-2ubuntu1 [1222 B] 127s Get:28 http://ftpmaster.internal/ubuntu plucky/main ppc64el gcc ppc64el 4:14.1.0-2ubuntu1 [5006 B] 127s Get:29 http://ftpmaster.internal/ubuntu plucky/main ppc64el libstdc++-14-dev ppc64el 14.2.0-8ubuntu1 [2673 kB] 127s Get:30 http://ftpmaster.internal/ubuntu plucky/main ppc64el g++-14-powerpc64le-linux-gnu ppc64el 14.2.0-8ubuntu1 [12.0 MB] 127s Get:31 http://ftpmaster.internal/ubuntu plucky/main ppc64el g++-14 ppc64el 14.2.0-8ubuntu1 [19.9 kB] 127s Get:32 http://ftpmaster.internal/ubuntu plucky/main ppc64el g++-powerpc64le-linux-gnu ppc64el 4:14.1.0-2ubuntu1 [968 B] 127s Get:33 http://ftpmaster.internal/ubuntu plucky/main ppc64el g++ ppc64el 4:14.1.0-2ubuntu1 [1090 B] 127s Get:34 http://ftpmaster.internal/ubuntu plucky/main ppc64el build-essential ppc64el 12.10ubuntu1 [4936 B] 127s Get:35 http://ftpmaster.internal/ubuntu plucky/universe ppc64el cd-hit ppc64el 4.8.1-4 [547 kB] 127s Get:36 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdebhelper-perl all 13.20ubuntu1 [94.2 kB] 127s Get:37 http://ftpmaster.internal/ubuntu plucky/main ppc64el libtool all 2.4.7-7build1 [166 kB] 127s Get:38 http://ftpmaster.internal/ubuntu plucky/main ppc64el dh-autoreconf all 20 [16.1 kB] 127s Get:39 http://ftpmaster.internal/ubuntu plucky/main ppc64el libarchive-zip-perl all 1.68-1 [90.2 kB] 127s Get:40 http://ftpmaster.internal/ubuntu plucky/main ppc64el libfile-stripnondeterminism-perl all 1.14.0-1 [20.1 kB] 127s Get:41 http://ftpmaster.internal/ubuntu plucky/main ppc64el dh-strip-nondeterminism all 1.14.0-1 [5058 B] 127s Get:42 http://ftpmaster.internal/ubuntu plucky/main ppc64el debugedit ppc64el 1:5.1-1 [52.1 kB] 127s Get:43 http://ftpmaster.internal/ubuntu plucky/main ppc64el dwz ppc64el 0.15-1build6 [142 kB] 127s Get:44 http://ftpmaster.internal/ubuntu plucky/main ppc64el gettext ppc64el 0.22.5-2 [1082 kB] 127s Get:45 http://ftpmaster.internal/ubuntu plucky/main ppc64el intltool-debian all 0.35.0+20060710.6 [23.2 kB] 127s Get:46 http://ftpmaster.internal/ubuntu plucky/main ppc64el po-debconf all 1.0.21+nmu1 [233 kB] 127s Get:47 http://ftpmaster.internal/ubuntu plucky/main ppc64el debhelper all 13.20ubuntu1 [893 kB] 127s Get:48 http://ftpmaster.internal/ubuntu plucky/universe ppc64el dh-python all 6.20241024 [112 kB] 127s Get:49 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-mono all 2.37-8 [502 kB] 127s Get:50 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-core all 2.37-8 [835 kB] 127s Get:51 http://ftpmaster.internal/ubuntu plucky/main ppc64el libfontenc1 ppc64el 1:1.1.8-1build1 [15.8 kB] 127s Get:52 http://ftpmaster.internal/ubuntu plucky/main ppc64el x11-common all 1:7.7+23ubuntu3 [21.7 kB] 127s Get:53 http://ftpmaster.internal/ubuntu plucky/main ppc64el xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 127s Get:54 http://ftpmaster.internal/ubuntu plucky/main ppc64el xfonts-utils ppc64el 1:7.7+7 [114 kB] 127s Get:55 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-urw-base35 all 20200910-8 [11.0 MB] 128s Get:56 http://ftpmaster.internal/ubuntu plucky/main ppc64el fontconfig-config ppc64el 2.15.0-1.1ubuntu2 [37.4 kB] 128s Get:57 http://ftpmaster.internal/ubuntu plucky/main ppc64el libblas3 ppc64el 3.12.0-3build2 [222 kB] 128s Get:58 http://ftpmaster.internal/ubuntu plucky/main ppc64el libfontconfig1 ppc64el 2.15.0-1.1ubuntu2 [190 kB] 128s Get:59 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpixman-1-0 ppc64el 0.44.0-3 [334 kB] 128s Get:60 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-render0 ppc64el 1.17.0-2 [17.2 kB] 128s Get:61 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-shm0 ppc64el 1.17.0-2 [5980 B] 128s Get:62 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxrender1 ppc64el 1:0.9.10-1.1build1 [23.1 kB] 128s Get:63 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcairo2 ppc64el 1.18.2-2 [747 kB] 128s Get:64 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdeflate0 ppc64el 1.22-1 [63.3 kB] 128s Get:65 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgfortran5 ppc64el 14.2.0-8ubuntu1 [571 kB] 128s Get:66 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgraphite2-3 ppc64el 1.3.14-2ubuntu1 [84.6 kB] 128s Get:67 http://ftpmaster.internal/ubuntu plucky/main ppc64el libharfbuzz0b ppc64el 10.0.1-1 [596 kB] 128s Get:68 http://ftpmaster.internal/ubuntu plucky/main ppc64el libimagequant0 ppc64el 2.18.0-1build1 [43.2 kB] 128s Get:69 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg-turbo8 ppc64el 2.1.5-2ubuntu2 [219 kB] 128s Get:70 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg8 ppc64el 8c-2ubuntu11 [2148 B] 128s Get:71 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblapack3 ppc64el 3.12.0-3build2 [2806 kB] 128s Get:72 http://ftpmaster.internal/ubuntu plucky/universe ppc64el liblbfgsb0 ppc64el 3.0+dfsg.4-1build1 [33.0 kB] 128s Get:73 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblcms2-2 ppc64el 2.16-2 [243 kB] 128s Get:74 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblerc4 ppc64el 4.0.0+ds-4ubuntu2 [270 kB] 128s Get:75 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedcrypto7t64 ppc64el 2.28.8-1 [267 kB] 128s Get:76 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedx509-1t64 ppc64el 2.28.8-1 [51.7 kB] 128s Get:77 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedtls14t64 ppc64el 2.28.8-1 [90.6 kB] 128s Get:78 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpython3.13-stdlib ppc64el 3.13.0-2 [2148 kB] 128s Get:79 http://ftpmaster.internal/ubuntu plucky/main ppc64el libraqm0 ppc64el 0.10.1-1build1 [19.4 kB] 128s Get:80 http://ftpmaster.internal/ubuntu plucky/main ppc64el libsharpyuv0 ppc64el 1.4.0-0.1 [22.0 kB] 128s Get:81 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjbig0 ppc64el 2.1-6.1ubuntu2 [35.9 kB] 128s Get:82 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwebp7 ppc64el 1.4.0-0.1 [309 kB] 128s Get:83 http://ftpmaster.internal/ubuntu plucky/main ppc64el libtiff6 ppc64el 4.5.1+git230720-4ubuntu4 [272 kB] 128s Get:84 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwebpdemux2 ppc64el 1.4.0-0.1 [14.1 kB] 128s Get:85 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwebpmux3 ppc64el 1.4.0-0.1 [31.4 kB] 128s Get:86 http://ftpmaster.internal/ubuntu plucky/universe ppc64el ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 128s Get:87 http://ftpmaster.internal/ubuntu plucky/universe ppc64el ncbi-blast+ ppc64el 2.16.0+ds-6 [16.1 MB] 129s Get:88 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-numpy ppc64el 1:1.26.4+ds-11build1 [4434 kB] 129s Get:89 http://ftpmaster.internal/ubuntu plucky/main ppc64el libopenjp2-7 ppc64el 2.5.0-2ubuntu1 [246 kB] 129s Get:90 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-pil ppc64el 10.4.0-1ubuntu1 [581 kB] 129s Get:91 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-cairo ppc64el 1.26.1-2 [129 kB] 129s Get:92 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-freetype all 2.5.1-1 [92.3 kB] 129s Get:93 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-rlpycairo all 0.3.0-3 [9130 B] 129s Get:94 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-reportlab all 4.2.5-1 [1107 kB] 129s Get:95 http://ftpmaster.internal/ubuntu plucky/main ppc64el xml-core all 0.19 [20.3 kB] 129s Get:96 http://ftpmaster.internal/ubuntu plucky/universe ppc64el w3c-sgml-lib all 1.3-3 [280 kB] 129s Get:97 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-biopython ppc64el 1.84+dfsg-4 [1738 kB] 129s Get:98 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-six all 1.16.0-7 [13.1 kB] 129s Get:99 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-dateutil all 2.9.0-2 [80.3 kB] 129s Get:100 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-tz all 2024.1-2 [31.4 kB] 129s Get:101 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-pandas-lib ppc64el 2.2.3+dfsg-5 [4761 kB] 129s Get:102 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-pandas all 2.2.3+dfsg-5 [3112 kB] 129s Get:103 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-decorator all 5.1.1-5 [10.1 kB] 129s Get:104 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-scipy ppc64el 1.13.1-5 [18.3 MB] 131s Get:105 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-packaging all 24.1-1 [41.4 kB] 131s Get:106 http://ftpmaster.internal/ubuntu plucky/universe ppc64el vsearch ppc64el 2.29.1-1 [482 kB] 131s Get:107 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-presto ppc64el 0.7.2-1 [80.7 kB] 131s Get:108 http://ftpmaster.internal/ubuntu plucky/universe ppc64el presto all 0.7.2-1 [240 kB] 131s Get:109 http://ftpmaster.internal/ubuntu plucky/universe ppc64el pybuild-plugin-autopkgtest all 6.20241024 [1746 B] 131s Get:110 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13 ppc64el 3.13.0-2 [719 kB] 131s Get:111 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-all ppc64el 3.12.7-1 [888 B] 132s Fetched 145 MB in 6s (22.9 MB/s) 132s Selecting previously unselected package libpython3.13-minimal:ppc64el. 132s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73775 files and directories currently installed.) 132s Preparing to unpack .../000-libpython3.13-minimal_3.13.0-2_ppc64el.deb ... 132s Unpacking libpython3.13-minimal:ppc64el (3.13.0-2) ... 132s Selecting previously unselected package python3.13-minimal. 132s Preparing to unpack .../001-python3.13-minimal_3.13.0-2_ppc64el.deb ... 132s Unpacking python3.13-minimal (3.13.0-2) ... 132s Selecting previously unselected package sgml-base. 132s Preparing to unpack .../002-sgml-base_1.31_all.deb ... 132s Unpacking sgml-base (1.31) ... 132s Selecting previously unselected package m4. 132s Preparing to unpack .../003-m4_1.4.19-4build1_ppc64el.deb ... 132s Unpacking m4 (1.4.19-4build1) ... 132s Selecting previously unselected package autoconf. 132s Preparing to unpack .../004-autoconf_2.72-3_all.deb ... 132s Unpacking autoconf (2.72-3) ... 132s Selecting previously unselected package autotools-dev. 132s Preparing to unpack .../005-autotools-dev_20220109.1_all.deb ... 132s Unpacking autotools-dev (20220109.1) ... 132s Selecting previously unselected package automake. 132s Preparing to unpack .../006-automake_1%3a1.16.5-1.3ubuntu1_all.deb ... 132s Unpacking automake (1:1.16.5-1.3ubuntu1) ... 132s Selecting previously unselected package autopoint. 132s Preparing to unpack .../007-autopoint_0.22.5-2_all.deb ... 132s Unpacking autopoint (0.22.5-2) ... 132s Selecting previously unselected package libisl23:ppc64el. 132s Preparing to unpack .../008-libisl23_0.27-1_ppc64el.deb ... 132s Unpacking libisl23:ppc64el (0.27-1) ... 132s Selecting previously unselected package libmpc3:ppc64el. 132s Preparing to unpack .../009-libmpc3_1.3.1-1build2_ppc64el.deb ... 132s Unpacking libmpc3:ppc64el (1.3.1-1build2) ... 132s Selecting previously unselected package cpp-14-powerpc64le-linux-gnu. 132s Preparing to unpack .../010-cpp-14-powerpc64le-linux-gnu_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking cpp-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 132s Selecting previously unselected package cpp-14. 132s Preparing to unpack .../011-cpp-14_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking cpp-14 (14.2.0-8ubuntu1) ... 132s Selecting previously unselected package cpp-powerpc64le-linux-gnu. 132s Preparing to unpack .../012-cpp-powerpc64le-linux-gnu_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 132s Unpacking cpp-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 132s Selecting previously unselected package cpp. 132s Preparing to unpack .../013-cpp_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 132s Unpacking cpp (4:14.1.0-2ubuntu1) ... 132s Selecting previously unselected package libcc1-0:ppc64el. 132s Preparing to unpack .../014-libcc1-0_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking libcc1-0:ppc64el (14.2.0-8ubuntu1) ... 132s Selecting previously unselected package libgomp1:ppc64el. 132s Preparing to unpack .../015-libgomp1_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking libgomp1:ppc64el (14.2.0-8ubuntu1) ... 132s Selecting previously unselected package libitm1:ppc64el. 132s Preparing to unpack .../016-libitm1_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking libitm1:ppc64el (14.2.0-8ubuntu1) ... 132s Selecting previously unselected package libasan8:ppc64el. 132s Preparing to unpack .../017-libasan8_14.2.0-8ubuntu1_ppc64el.deb ... 132s Unpacking libasan8:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package liblsan0:ppc64el. 133s Preparing to unpack .../018-liblsan0_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking liblsan0:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package libtsan2:ppc64el. 133s Preparing to unpack .../019-libtsan2_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking libtsan2:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package libubsan1:ppc64el. 133s Preparing to unpack .../020-libubsan1_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking libubsan1:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package libquadmath0:ppc64el. 133s Preparing to unpack .../021-libquadmath0_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking libquadmath0:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package libgcc-14-dev:ppc64el. 133s Preparing to unpack .../022-libgcc-14-dev_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking libgcc-14-dev:ppc64el (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package gcc-14-powerpc64le-linux-gnu. 133s Preparing to unpack .../023-gcc-14-powerpc64le-linux-gnu_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking gcc-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package gcc-14. 133s Preparing to unpack .../024-gcc-14_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking gcc-14 (14.2.0-8ubuntu1) ... 133s Selecting previously unselected package gcc-powerpc64le-linux-gnu. 133s Preparing to unpack .../025-gcc-powerpc64le-linux-gnu_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 133s Unpacking gcc-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 133s Selecting previously unselected package gcc. 133s Preparing to unpack .../026-gcc_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 133s Unpacking gcc (4:14.1.0-2ubuntu1) ... 133s Selecting previously unselected package libstdc++-14-dev:ppc64el. 133s Preparing to unpack .../027-libstdc++-14-dev_14.2.0-8ubuntu1_ppc64el.deb ... 133s Unpacking libstdc++-14-dev:ppc64el (14.2.0-8ubuntu1) ... 134s Selecting previously unselected package g++-14-powerpc64le-linux-gnu. 134s Preparing to unpack .../028-g++-14-powerpc64le-linux-gnu_14.2.0-8ubuntu1_ppc64el.deb ... 134s Unpacking g++-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 134s Selecting previously unselected package g++-14. 134s Preparing to unpack .../029-g++-14_14.2.0-8ubuntu1_ppc64el.deb ... 134s Unpacking g++-14 (14.2.0-8ubuntu1) ... 134s Selecting previously unselected package g++-powerpc64le-linux-gnu. 134s Preparing to unpack .../030-g++-powerpc64le-linux-gnu_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 134s Unpacking g++-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 134s Selecting previously unselected package g++. 134s Preparing to unpack .../031-g++_4%3a14.1.0-2ubuntu1_ppc64el.deb ... 134s Unpacking g++ (4:14.1.0-2ubuntu1) ... 134s Selecting previously unselected package build-essential. 134s Preparing to unpack .../032-build-essential_12.10ubuntu1_ppc64el.deb ... 134s Unpacking build-essential (12.10ubuntu1) ... 134s Selecting previously unselected package cd-hit. 134s Preparing to unpack .../033-cd-hit_4.8.1-4_ppc64el.deb ... 134s Unpacking cd-hit (4.8.1-4) ... 134s Selecting previously unselected package libdebhelper-perl. 134s Preparing to unpack .../034-libdebhelper-perl_13.20ubuntu1_all.deb ... 134s Unpacking libdebhelper-perl (13.20ubuntu1) ... 134s Selecting previously unselected package libtool. 134s Preparing to unpack .../035-libtool_2.4.7-7build1_all.deb ... 134s Unpacking libtool (2.4.7-7build1) ... 134s Selecting previously unselected package dh-autoreconf. 134s Preparing to unpack .../036-dh-autoreconf_20_all.deb ... 134s Unpacking dh-autoreconf (20) ... 134s Selecting previously unselected package libarchive-zip-perl. 134s Preparing to unpack .../037-libarchive-zip-perl_1.68-1_all.deb ... 134s Unpacking libarchive-zip-perl (1.68-1) ... 134s Selecting previously unselected package libfile-stripnondeterminism-perl. 134s Preparing to unpack .../038-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... 134s Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... 134s Selecting previously unselected package dh-strip-nondeterminism. 134s Preparing to unpack .../039-dh-strip-nondeterminism_1.14.0-1_all.deb ... 134s Unpacking dh-strip-nondeterminism (1.14.0-1) ... 134s Selecting previously unselected package debugedit. 134s Preparing to unpack .../040-debugedit_1%3a5.1-1_ppc64el.deb ... 134s Unpacking debugedit (1:5.1-1) ... 134s Selecting previously unselected package dwz. 134s Preparing to unpack .../041-dwz_0.15-1build6_ppc64el.deb ... 134s Unpacking dwz (0.15-1build6) ... 134s Selecting previously unselected package gettext. 134s Preparing to unpack .../042-gettext_0.22.5-2_ppc64el.deb ... 134s Unpacking gettext (0.22.5-2) ... 135s Selecting previously unselected package intltool-debian. 135s Preparing to unpack .../043-intltool-debian_0.35.0+20060710.6_all.deb ... 135s Unpacking intltool-debian (0.35.0+20060710.6) ... 135s Selecting previously unselected package po-debconf. 135s Preparing to unpack .../044-po-debconf_1.0.21+nmu1_all.deb ... 135s Unpacking po-debconf (1.0.21+nmu1) ... 135s Selecting previously unselected package debhelper. 135s Preparing to unpack .../045-debhelper_13.20ubuntu1_all.deb ... 135s Unpacking debhelper (13.20ubuntu1) ... 135s Selecting previously unselected package dh-python. 135s Preparing to unpack .../046-dh-python_6.20241024_all.deb ... 135s Unpacking dh-python (6.20241024) ... 135s Selecting previously unselected package fonts-dejavu-mono. 135s Preparing to unpack .../047-fonts-dejavu-mono_2.37-8_all.deb ... 135s Unpacking fonts-dejavu-mono (2.37-8) ... 135s Selecting previously unselected package fonts-dejavu-core. 135s Preparing to unpack .../048-fonts-dejavu-core_2.37-8_all.deb ... 135s Unpacking fonts-dejavu-core (2.37-8) ... 135s Selecting previously unselected package libfontenc1:ppc64el. 135s Preparing to unpack .../049-libfontenc1_1%3a1.1.8-1build1_ppc64el.deb ... 135s Unpacking libfontenc1:ppc64el (1:1.1.8-1build1) ... 135s Selecting previously unselected package x11-common. 135s Preparing to unpack .../050-x11-common_1%3a7.7+23ubuntu3_all.deb ... 135s Unpacking x11-common (1:7.7+23ubuntu3) ... 135s Selecting previously unselected package xfonts-encodings. 135s Preparing to unpack .../051-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 135s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 135s Selecting previously unselected package xfonts-utils. 135s Preparing to unpack .../052-xfonts-utils_1%3a7.7+7_ppc64el.deb ... 135s Unpacking xfonts-utils (1:7.7+7) ... 135s Selecting previously unselected package fonts-urw-base35. 135s Preparing to unpack .../053-fonts-urw-base35_20200910-8_all.deb ... 135s Unpacking fonts-urw-base35 (20200910-8) ... 135s Selecting previously unselected package fontconfig-config. 135s Preparing to unpack .../054-fontconfig-config_2.15.0-1.1ubuntu2_ppc64el.deb ... 136s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 136s Selecting previously unselected package libblas3:ppc64el. 136s Preparing to unpack .../055-libblas3_3.12.0-3build2_ppc64el.deb ... 136s Unpacking libblas3:ppc64el (3.12.0-3build2) ... 136s Selecting previously unselected package libfontconfig1:ppc64el. 136s Preparing to unpack .../056-libfontconfig1_2.15.0-1.1ubuntu2_ppc64el.deb ... 136s Unpacking libfontconfig1:ppc64el (2.15.0-1.1ubuntu2) ... 136s Selecting previously unselected package libpixman-1-0:ppc64el. 136s Preparing to unpack .../057-libpixman-1-0_0.44.0-3_ppc64el.deb ... 136s Unpacking libpixman-1-0:ppc64el (0.44.0-3) ... 136s Selecting previously unselected package libxcb-render0:ppc64el. 136s Preparing to unpack .../058-libxcb-render0_1.17.0-2_ppc64el.deb ... 136s Unpacking libxcb-render0:ppc64el (1.17.0-2) ... 136s Selecting previously unselected package libxcb-shm0:ppc64el. 136s Preparing to unpack .../059-libxcb-shm0_1.17.0-2_ppc64el.deb ... 136s Unpacking libxcb-shm0:ppc64el (1.17.0-2) ... 136s Selecting previously unselected package libxrender1:ppc64el. 136s Preparing to unpack .../060-libxrender1_1%3a0.9.10-1.1build1_ppc64el.deb ... 136s Unpacking libxrender1:ppc64el (1:0.9.10-1.1build1) ... 136s Selecting previously unselected package libcairo2:ppc64el. 136s Preparing to unpack .../061-libcairo2_1.18.2-2_ppc64el.deb ... 136s Unpacking libcairo2:ppc64el (1.18.2-2) ... 136s Selecting previously unselected package libdeflate0:ppc64el. 136s Preparing to unpack .../062-libdeflate0_1.22-1_ppc64el.deb ... 136s Unpacking libdeflate0:ppc64el (1.22-1) ... 136s Selecting previously unselected package libgfortran5:ppc64el. 136s Preparing to unpack .../063-libgfortran5_14.2.0-8ubuntu1_ppc64el.deb ... 136s Unpacking libgfortran5:ppc64el (14.2.0-8ubuntu1) ... 136s Selecting previously unselected package libgraphite2-3:ppc64el. 136s Preparing to unpack .../064-libgraphite2-3_1.3.14-2ubuntu1_ppc64el.deb ... 136s Unpacking libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ... 136s Selecting previously unselected package libharfbuzz0b:ppc64el. 136s Preparing to unpack .../065-libharfbuzz0b_10.0.1-1_ppc64el.deb ... 136s Unpacking libharfbuzz0b:ppc64el (10.0.1-1) ... 136s Selecting previously unselected package libimagequant0:ppc64el. 136s Preparing to unpack .../066-libimagequant0_2.18.0-1build1_ppc64el.deb ... 136s Unpacking libimagequant0:ppc64el (2.18.0-1build1) ... 136s Selecting previously unselected package libjpeg-turbo8:ppc64el. 136s Preparing to unpack .../067-libjpeg-turbo8_2.1.5-2ubuntu2_ppc64el.deb ... 136s Unpacking libjpeg-turbo8:ppc64el (2.1.5-2ubuntu2) ... 136s Selecting previously unselected package libjpeg8:ppc64el. 136s Preparing to unpack .../068-libjpeg8_8c-2ubuntu11_ppc64el.deb ... 136s Unpacking libjpeg8:ppc64el (8c-2ubuntu11) ... 136s Selecting previously unselected package liblapack3:ppc64el. 136s Preparing to unpack .../069-liblapack3_3.12.0-3build2_ppc64el.deb ... 136s Unpacking liblapack3:ppc64el (3.12.0-3build2) ... 136s Selecting previously unselected package liblbfgsb0:ppc64el. 136s Preparing to unpack .../070-liblbfgsb0_3.0+dfsg.4-1build1_ppc64el.deb ... 136s Unpacking liblbfgsb0:ppc64el (3.0+dfsg.4-1build1) ... 136s Selecting previously unselected package liblcms2-2:ppc64el. 136s Preparing to unpack .../071-liblcms2-2_2.16-2_ppc64el.deb ... 136s Unpacking liblcms2-2:ppc64el (2.16-2) ... 136s Selecting previously unselected package liblerc4:ppc64el. 136s Preparing to unpack .../072-liblerc4_4.0.0+ds-4ubuntu2_ppc64el.deb ... 136s Unpacking liblerc4:ppc64el (4.0.0+ds-4ubuntu2) ... 136s Selecting previously unselected package libmbedcrypto7t64:ppc64el. 136s Preparing to unpack .../073-libmbedcrypto7t64_2.28.8-1_ppc64el.deb ... 136s Unpacking libmbedcrypto7t64:ppc64el (2.28.8-1) ... 136s Selecting previously unselected package libmbedx509-1t64:ppc64el. 136s Preparing to unpack .../074-libmbedx509-1t64_2.28.8-1_ppc64el.deb ... 136s Unpacking libmbedx509-1t64:ppc64el (2.28.8-1) ... 136s Selecting previously unselected package libmbedtls14t64:ppc64el. 136s Preparing to unpack .../075-libmbedtls14t64_2.28.8-1_ppc64el.deb ... 136s Unpacking libmbedtls14t64:ppc64el (2.28.8-1) ... 136s Selecting previously unselected package libpython3.13-stdlib:ppc64el. 136s Preparing to unpack .../076-libpython3.13-stdlib_3.13.0-2_ppc64el.deb ... 136s Unpacking libpython3.13-stdlib:ppc64el (3.13.0-2) ... 136s Selecting previously unselected package libraqm0:ppc64el. 136s Preparing to unpack .../077-libraqm0_0.10.1-1build1_ppc64el.deb ... 136s Unpacking libraqm0:ppc64el (0.10.1-1build1) ... 136s Selecting previously unselected package libsharpyuv0:ppc64el. 136s Preparing to unpack .../078-libsharpyuv0_1.4.0-0.1_ppc64el.deb ... 136s Unpacking libsharpyuv0:ppc64el (1.4.0-0.1) ... 136s Selecting previously unselected package libjbig0:ppc64el. 136s Preparing to unpack .../079-libjbig0_2.1-6.1ubuntu2_ppc64el.deb ... 136s Unpacking libjbig0:ppc64el (2.1-6.1ubuntu2) ... 137s Selecting previously unselected package libwebp7:ppc64el. 137s Preparing to unpack .../080-libwebp7_1.4.0-0.1_ppc64el.deb ... 137s Unpacking libwebp7:ppc64el (1.4.0-0.1) ... 137s Selecting previously unselected package libtiff6:ppc64el. 137s Preparing to unpack .../081-libtiff6_4.5.1+git230720-4ubuntu4_ppc64el.deb ... 137s Unpacking libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ... 137s Selecting previously unselected package libwebpdemux2:ppc64el. 137s Preparing to unpack .../082-libwebpdemux2_1.4.0-0.1_ppc64el.deb ... 137s Unpacking libwebpdemux2:ppc64el (1.4.0-0.1) ... 137s Selecting previously unselected package libwebpmux3:ppc64el. 137s Preparing to unpack .../083-libwebpmux3_1.4.0-0.1_ppc64el.deb ... 137s Unpacking libwebpmux3:ppc64el (1.4.0-0.1) ... 137s Selecting previously unselected package ncbi-data. 137s Preparing to unpack .../084-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 137s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 137s Selecting previously unselected package ncbi-blast+. 137s Preparing to unpack .../085-ncbi-blast+_2.16.0+ds-6_ppc64el.deb ... 137s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 137s Selecting previously unselected package python3-numpy. 137s Preparing to unpack .../086-python3-numpy_1%3a1.26.4+ds-11build1_ppc64el.deb ... 137s Unpacking python3-numpy (1:1.26.4+ds-11build1) ... 137s Selecting previously unselected package libopenjp2-7:ppc64el. 137s Preparing to unpack .../087-libopenjp2-7_2.5.0-2ubuntu1_ppc64el.deb ... 137s Unpacking libopenjp2-7:ppc64el (2.5.0-2ubuntu1) ... 137s Selecting previously unselected package python3-pil:ppc64el. 137s Preparing to unpack .../088-python3-pil_10.4.0-1ubuntu1_ppc64el.deb ... 137s Unpacking python3-pil:ppc64el (10.4.0-1ubuntu1) ... 137s Selecting previously unselected package python3-cairo. 138s Preparing to unpack .../089-python3-cairo_1.26.1-2_ppc64el.deb ... 138s Unpacking python3-cairo (1.26.1-2) ... 138s Selecting previously unselected package python3-freetype. 138s Preparing to unpack .../090-python3-freetype_2.5.1-1_all.deb ... 138s Unpacking python3-freetype (2.5.1-1) ... 138s Selecting previously unselected package python3-rlpycairo. 138s Preparing to unpack .../091-python3-rlpycairo_0.3.0-3_all.deb ... 138s Unpacking python3-rlpycairo (0.3.0-3) ... 138s Selecting previously unselected package python3-reportlab. 138s Preparing to unpack .../092-python3-reportlab_4.2.5-1_all.deb ... 138s Unpacking python3-reportlab (4.2.5-1) ... 138s Selecting previously unselected package xml-core. 138s Preparing to unpack .../093-xml-core_0.19_all.deb ... 138s Unpacking xml-core (0.19) ... 138s Selecting previously unselected package w3c-sgml-lib. 138s Preparing to unpack .../094-w3c-sgml-lib_1.3-3_all.deb ... 138s Unpacking w3c-sgml-lib (1.3-3) ... 138s Selecting previously unselected package python3-biopython. 138s Preparing to unpack .../095-python3-biopython_1.84+dfsg-4_ppc64el.deb ... 138s Unpacking python3-biopython (1.84+dfsg-4) ... 138s Selecting previously unselected package python3-six. 138s Preparing to unpack .../096-python3-six_1.16.0-7_all.deb ... 138s Unpacking python3-six (1.16.0-7) ... 138s Selecting previously unselected package python3-dateutil. 138s Preparing to unpack .../097-python3-dateutil_2.9.0-2_all.deb ... 138s Unpacking python3-dateutil (2.9.0-2) ... 138s Selecting previously unselected package python3-tz. 138s Preparing to unpack .../098-python3-tz_2024.1-2_all.deb ... 138s Unpacking python3-tz (2024.1-2) ... 138s Selecting previously unselected package python3-pandas-lib:ppc64el. 138s Preparing to unpack .../099-python3-pandas-lib_2.2.3+dfsg-5_ppc64el.deb ... 138s Unpacking python3-pandas-lib:ppc64el (2.2.3+dfsg-5) ... 138s Selecting previously unselected package python3-pandas. 138s Preparing to unpack .../100-python3-pandas_2.2.3+dfsg-5_all.deb ... 138s Unpacking python3-pandas (2.2.3+dfsg-5) ... 138s Selecting previously unselected package python3-decorator. 138s Preparing to unpack .../101-python3-decorator_5.1.1-5_all.deb ... 138s Unpacking python3-decorator (5.1.1-5) ... 138s Selecting previously unselected package python3-scipy. 138s Preparing to unpack .../102-python3-scipy_1.13.1-5_ppc64el.deb ... 138s Unpacking python3-scipy (1.13.1-5) ... 139s Selecting previously unselected package python3-packaging. 139s Preparing to unpack .../103-python3-packaging_24.1-1_all.deb ... 139s Unpacking python3-packaging (24.1-1) ... 139s Selecting previously unselected package vsearch. 139s Preparing to unpack .../104-vsearch_2.29.1-1_ppc64el.deb ... 139s Unpacking vsearch (2.29.1-1) ... 139s Selecting previously unselected package python3-presto. 139s Preparing to unpack .../105-python3-presto_0.7.2-1_ppc64el.deb ... 139s Unpacking python3-presto (0.7.2-1) ... 139s Selecting previously unselected package presto. 139s Preparing to unpack .../106-presto_0.7.2-1_all.deb ... 139s Unpacking presto (0.7.2-1) ... 139s Selecting previously unselected package pybuild-plugin-autopkgtest. 139s Preparing to unpack .../107-pybuild-plugin-autopkgtest_6.20241024_all.deb ... 139s Unpacking pybuild-plugin-autopkgtest (6.20241024) ... 139s Selecting previously unselected package python3.13. 139s Preparing to unpack .../108-python3.13_3.13.0-2_ppc64el.deb ... 139s Unpacking python3.13 (3.13.0-2) ... 139s Selecting previously unselected package python3-all. 139s Preparing to unpack .../109-python3-all_3.12.7-1_ppc64el.deb ... 139s Unpacking python3-all (3.12.7-1) ... 139s Selecting previously unselected package autopkgtest-satdep. 139s Preparing to unpack .../110-1-autopkgtest-satdep.deb ... 139s Unpacking autopkgtest-satdep (0) ... 139s Setting up dh-python (6.20241024) ... 139s Setting up libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ... 139s Setting up liblcms2-2:ppc64el (2.16-2) ... 139s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 139s Setting up libpixman-1-0:ppc64el (0.44.0-3) ... 139s Setting up libsharpyuv0:ppc64el (1.4.0-0.1) ... 139s Setting up liblerc4:ppc64el (4.0.0+ds-4ubuntu2) ... 139s Setting up libmbedcrypto7t64:ppc64el (2.28.8-1) ... 139s Setting up libxrender1:ppc64el (1:0.9.10-1.1build1) ... 139s Setting up libxcb-render0:ppc64el (1.17.0-2) ... 139s Setting up libarchive-zip-perl (1.68-1) ... 139s Setting up vsearch (2.29.1-1) ... 139s Setting up libdebhelper-perl (13.20ubuntu1) ... 139s Setting up x11-common (1:7.7+23ubuntu3) ... 140s Setting up libdeflate0:ppc64el (1.22-1) ... 140s Setting up m4 (1.4.19-4build1) ... 140s Setting up libxcb-shm0:ppc64el (1.17.0-2) ... 140s Setting up libgomp1:ppc64el (14.2.0-8ubuntu1) ... 140s Setting up python3-freetype (2.5.1-1) ... 140s Setting up libjbig0:ppc64el (2.1-6.1ubuntu2) ... 140s Setting up python3-tz (2024.1-2) ... 140s Setting up python3-six (1.16.0-7) ... 141s Setting up libpython3.13-minimal:ppc64el (3.13.0-2) ... 141s Setting up python3-decorator (5.1.1-5) ... 141s Setting up libfontenc1:ppc64el (1:1.1.8-1build1) ... 141s Setting up autotools-dev (20220109.1) ... 141s Setting up libblas3:ppc64el (3.12.0-3build2) ... 141s update-alternatives: using /usr/lib/powerpc64le-linux-gnu/blas/libblas.so.3 to provide /usr/lib/powerpc64le-linux-gnu/libblas.so.3 (libblas.so.3-powerpc64le-linux-gnu) in auto mode 141s Setting up python3-packaging (24.1-1) ... 141s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 141s Setting up libquadmath0:ppc64el (14.2.0-8ubuntu1) ... 141s Setting up libimagequant0:ppc64el (2.18.0-1build1) ... 141s Setting up fonts-dejavu-mono (2.37-8) ... 141s Setting up libmpc3:ppc64el (1.3.1-1build2) ... 141s Setting up autopoint (0.22.5-2) ... 141s Setting up fonts-dejavu-core (2.37-8) ... 141s Setting up libjpeg-turbo8:ppc64el (2.1.5-2ubuntu2) ... 141s Setting up libgfortran5:ppc64el (14.2.0-8ubuntu1) ... 141s Setting up autoconf (2.72-3) ... 141s Setting up libwebp7:ppc64el (1.4.0-0.1) ... 141s Setting up libubsan1:ppc64el (14.2.0-8ubuntu1) ... 141s Setting up dwz (0.15-1build6) ... 141s Setting up libasan8:ppc64el (14.2.0-8ubuntu1) ... 141s Setting up debugedit (1:5.1-1) ... 141s Setting up libopenjp2-7:ppc64el (2.5.0-2ubuntu1) ... 141s Setting up python3.13-minimal (3.13.0-2) ... 142s Setting up libharfbuzz0b:ppc64el (10.0.1-1) ... 142s Setting up python3-dateutil (2.9.0-2) ... 143s Setting up sgml-base (1.31) ... 143s Setting up libtsan2:ppc64el (14.2.0-8ubuntu1) ... 143s Setting up libisl23:ppc64el (0.27-1) ... 143s Setting up libwebpmux3:ppc64el (1.4.0-0.1) ... 143s Setting up libpython3.13-stdlib:ppc64el (3.13.0-2) ... 143s Setting up libcc1-0:ppc64el (14.2.0-8ubuntu1) ... 143s Setting up liblsan0:ppc64el (14.2.0-8ubuntu1) ... 143s Setting up libitm1:ppc64el (14.2.0-8ubuntu1) ... 143s Setting up cd-hit (4.8.1-4) ... 143s Setting up libjpeg8:ppc64el (8c-2ubuntu11) ... 143s Setting up automake (1:1.16.5-1.3ubuntu1) ... 143s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode 143s Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... 143s Setting up liblapack3:ppc64el (3.12.0-3build2) ... 143s update-alternatives: using /usr/lib/powerpc64le-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/powerpc64le-linux-gnu/liblapack.so.3 (liblapack.so.3-powerpc64le-linux-gnu) in auto mode 143s Setting up gettext (0.22.5-2) ... 143s Setting up libmbedx509-1t64:ppc64el (2.28.8-1) ... 143s Setting up python3.13 (3.13.0-2) ... 144s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 144s Setting up libwebpdemux2:ppc64el (1.4.0-0.1) ... 144s Setting up python3-all (3.12.7-1) ... 144s Setting up xfonts-utils (1:7.7+7) ... 144s Setting up intltool-debian (0.35.0+20060710.6) ... 144s Setting up libraqm0:ppc64el (0.10.1-1build1) ... 144s Setting up cpp-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 144s Setting up python3-numpy (1:1.26.4+ds-11build1) ... 149s Setting up cpp-14 (14.2.0-8ubuntu1) ... 149s Setting up dh-strip-nondeterminism (1.14.0-1) ... 149s Setting up libmbedtls14t64:ppc64el (2.28.8-1) ... 149s Setting up libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ... 149s Setting up xml-core (0.19) ... 149s Setting up libfontconfig1:ppc64el (2.15.0-1.1ubuntu2) ... 149s Setting up libgcc-14-dev:ppc64el (14.2.0-8ubuntu1) ... 149s Setting up libstdc++-14-dev:ppc64el (14.2.0-8ubuntu1) ... 149s Setting up cpp-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 149s Setting up gcc-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 149s Setting up liblbfgsb0:ppc64el (3.0+dfsg.4-1build1) ... 149s Setting up python3-scipy (1.13.1-5) ... 158s Setting up g++-14-powerpc64le-linux-gnu (14.2.0-8ubuntu1) ... 158s Setting up po-debconf (1.0.21+nmu1) ... 158s Setting up python3-pandas-lib:ppc64el (2.2.3+dfsg-5) ... 158s Setting up fonts-urw-base35 (20200910-8) ... 158s Setting up libcairo2:ppc64el (1.18.2-2) ... 158s Setting up gcc-14 (14.2.0-8ubuntu1) ... 158s Setting up ncbi-blast+ (2.16.0+ds-6) ... 158s Setting up python3-pil:ppc64el (10.4.0-1ubuntu1) ... 159s Setting up python3-pandas (2.2.3+dfsg-5) ... 171s Setting up gcc-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 171s Setting up cpp (4:14.1.0-2ubuntu1) ... 171s Setting up g++-14 (14.2.0-8ubuntu1) ... 171s Setting up g++-powerpc64le-linux-gnu (4:14.1.0-2ubuntu1) ... 171s Setting up python3-cairo (1.26.1-2) ... 171s Setting up libtool (2.4.7-7build1) ... 171s Setting up gcc (4:14.1.0-2ubuntu1) ... 171s Setting up dh-autoreconf (20) ... 171s Setting up python3-rlpycairo (0.3.0-3) ... 171s Setting up python3-reportlab (4.2.5-1) ... 173s Setting up g++ (4:14.1.0-2ubuntu1) ... 173s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 173s Setting up build-essential (12.10ubuntu1) ... 173s Setting up debhelper (13.20ubuntu1) ... 173s Setting up pybuild-plugin-autopkgtest (6.20241024) ... 173s Processing triggers for libc-bin (2.40-1ubuntu3) ... 173s Processing triggers for systemd (256.5-2ubuntu4) ... 173s Processing triggers for man-db (2.12.1-3) ... 175s Processing triggers for install-info (7.1.1-1) ... 175s Processing triggers for sgml-base (1.31) ... 175s Setting up w3c-sgml-lib (1.3-3) ... 207s Setting up python3-biopython (1.84+dfsg-4) ... 210s Setting up python3-presto (0.7.2-1) ... 210s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 210s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 210s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 210s header['SPECIES'] = re.sub('\s', '_', fields[2]) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 210s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 210s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 210s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 210s version = re.sub('\.linux.*$','',version) 210s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 210s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 210s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 210s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 210s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 210s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 210s header['SPECIES'] = re.sub('\s', '_', fields[2]) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 210s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 210s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 210s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 210s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 210s version = re.sub('\.linux.*$','',version) 210s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 210s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 210s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 210s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 210s Setting up presto (0.7.2-1) ... 210s Setting up autopkgtest-satdep (0) ... 214s (Reading database ... 83773 files and directories currently installed.) 214s Removing autopkgtest-satdep (0) ... 214s autopkgtest [19:38:26]: test pybuild-autopkgtest: pybuild-autopkgtest 214s autopkgtest [19:38:26]: test pybuild-autopkgtest: [----------------------- 215s pybuild-autopkgtest 215s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.W1ftaf/build.3vB/src/bin /tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build; rm /tmp/autopkgtest.W1ftaf/build.3vB/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 215s I: pybuild base:311: cd /tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build; python3.13 -m unittest discover -v 216s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 216s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 216s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 216s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 216s tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) ... ERROR 216s tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) ... ERROR 216s tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) ... ERROR 216s tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) ... ERROR 216s tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) ... ERROR 216s tests.test_IO (unittest.loader._FailedTest.tests.test_IO) ... ERROR 216s tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) ... ERROR 216s tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) ... ERROR 216s tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) ... ERROR 216s 216s ====================================================================== 216s ERROR: tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_AssemblePairs 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_AssemblePairs.py", line 12, in 216s import pandas as pd 216s File "/usr/lib/python3/dist-packages/pandas/__init__.py", line 19, in 216s raise ImportError( 216s "Unable to import required dependencies:\n" + "\n".join(_missing_dependencies) 216s ) 216s ImportError: Unable to import required dependencies: 216s numpy: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_BuildConsensus 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 216s from . import multiarray 216s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 216s from . import overrides 216s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 216s from numpy.core._multiarray_umath import ( 216s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 216s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 216s 216s During handling of the above exception, another exception occurred: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 216s from numpy.__config__ import show as show_config 216s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 216s from numpy.core._multiarray_umath import ( 216s ...<3 lines>... 216s ) 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 216s raise ImportError(msg) 216s ImportError: 216s 216s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 216s 216s Importing the numpy C-extensions failed. This error can happen for 216s many reasons, often due to issues with your setup or how NumPy was 216s installed. 216s 216s We have compiled some common reasons and troubleshooting tips at: 216s 216s https://numpy.org/devdocs/user/troubleshooting-importerror.html 216s 216s Please note and check the following: 216s 216s * The Python version is: Python3.13 from "/usr/bin/python3.13" 216s * The NumPy version is: "1.26.4" 216s 216s and make sure that they are the versions you expect. 216s Please carefully study the documentation linked above for further help. 216s 216s Original error was: No module named 'numpy.core._multiarray_umath' 216s 216s 216s The above exception was the direct cause of the following exception: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_BuildConsensus.py", line 16, in 216s from presto.Sequence import calculateSetError, deleteSeqPositions, findGapPositions, \ 216s frequencyConsensus, qualityConsensus 216s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 216s import numpy as np 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 216s raise ImportError(msg) from e 216s ImportError: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_CollapseSeq 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 216s from . import multiarray 216s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 216s from . import overrides 216s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 216s from numpy.core._multiarray_umath import ( 216s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 216s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 216s 216s During handling of the above exception, another exception occurred: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 216s from numpy.__config__ import show as show_config 216s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 216s from numpy.core._multiarray_umath import ( 216s ...<3 lines>... 216s ) 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 216s raise ImportError(msg) 216s ImportError: 216s 216s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 216s 216s Importing the numpy C-extensions failed. This error can happen for 216s many reasons, often due to issues with your setup or how NumPy was 216s installed. 216s 216s We have compiled some common reasons and troubleshooting tips at: 216s 216s https://numpy.org/devdocs/user/troubleshooting-importerror.html 216s 216s Please note and check the following: 216s 216s * The Python version is: Python3.13 from "/usr/bin/python3.13" 216s * The NumPy version is: "1.26.4" 216s 216s and make sure that they are the versions you expect. 216s Please carefully study the documentation linked above for further help. 216s 216s Original error was: No module named 'numpy.core._multiarray_umath' 216s 216s 216s The above exception was the direct cause of the following exception: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_CollapseSeq.py", line 17, in 216s from presto.Sequence import checkSeqEqual 216s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 216s import numpy as np 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 216s raise ImportError(msg) from e 216s ImportError: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_ConvertHeaders 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_ConvertHeaders.py", line 18, in 216s import ConvertHeaders 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/../bin/ConvertHeaders.py", line 15, in 216s from Bio import SeqIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 216s from Bio.SeqIO import TwoBitIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 216s raise MissingPythonDependencyError( 216s ...<2 lines>... 216s ) from None 216s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 216s 216s 216s ====================================================================== 216s ERROR: tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_EstimateError 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 216s from . import multiarray 216s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 216s from . import overrides 216s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 216s from numpy.core._multiarray_umath import ( 216s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 216s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 216s 216s During handling of the above exception, another exception occurred: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 216s from numpy.__config__ import show as show_config 216s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 216s from numpy.core._multiarray_umath import ( 216s ...<3 lines>... 216s ) 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 216s raise ImportError(msg) 216s ImportError: 216s 216s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 216s 216s Importing the numpy C-extensions failed. This error can happen for 216s many reasons, often due to issues with your setup or how NumPy was 216s installed. 216s 216s We have compiled some common reasons and troubleshooting tips at: 216s 216s https://numpy.org/devdocs/user/troubleshooting-importerror.html 216s 216s Please note and check the following: 216s 216s * The Python version is: Python3.13 from "/usr/bin/python3.13" 216s * The NumPy version is: "1.26.4" 216s 216s and make sure that they are the versions you expect. 216s Please carefully study the documentation linked above for further help. 216s 216s Original error was: No module named 'numpy.core._multiarray_umath' 216s 216s 216s The above exception was the direct cause of the following exception: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_EstimateError.py", line 11, in 216s import numpy as np 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 216s raise ImportError(msg) from e 216s ImportError: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_IO (unittest.loader._FailedTest.tests.test_IO) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_IO 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_IO.py", line 15, in 216s from presto.IO import getFileType, readSeqFile 216s File "/usr/lib/python3/dist-packages/presto/IO.py", line 15, in 216s from Bio import SeqIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 216s from Bio.SeqIO import TwoBitIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 216s raise MissingPythonDependencyError( 216s ...<2 lines>... 216s ) from None 216s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 216s 216s 216s ====================================================================== 216s ERROR: tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_MaskPrimers 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 216s from . import multiarray 216s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 216s from . import overrides 216s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 216s from numpy.core._multiarray_umath import ( 216s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 216s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 216s 216s During handling of the above exception, another exception occurred: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 216s from numpy.__config__ import show as show_config 216s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 216s from numpy.core._multiarray_umath import ( 216s ...<3 lines>... 216s ) 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 216s raise ImportError(msg) 216s ImportError: 216s 216s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 216s 216s Importing the numpy C-extensions failed. This error can happen for 216s many reasons, often due to issues with your setup or how NumPy was 216s installed. 216s 216s We have compiled some common reasons and troubleshooting tips at: 216s 216s https://numpy.org/devdocs/user/troubleshooting-importerror.html 216s 216s Please note and check the following: 216s 216s * The Python version is: Python3.13 from "/usr/bin/python3.13" 216s * The NumPy version is: "1.26.4" 216s 216s and make sure that they are the versions you expect. 216s Please carefully study the documentation linked above for further help. 216s 216s Original error was: No module named 'numpy.core._multiarray_umath' 216s 216s 216s The above exception was the direct cause of the following exception: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_MaskPrimers.py", line 17, in 216s from presto.Sequence import getDNAScoreDict, localAlignment, scoreAlignment, extractAlignment, \ 216s maskSeq, PrimerAlignment 216s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 216s import numpy as np 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 216s raise ImportError(msg) from e 216s ImportError: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_Sequence 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 216s from . im-> test_collapseAnnotation() 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 216s <- test_collapseAnnotation() 0.000 216s -> test_getCoordKey() 216s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 216s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 216s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 216s <- test_getCoordKey() 0.000 216s -> test_mergeAnnotation() 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 216s <- test_mergeAnnotation() 0.000 216s -> test_renameAnnotation() 216s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 216s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 216s <- test_renameAnnotation() 0.000 216s Test file already removed or moved 216s port multiarray 216s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 216s from . import overrides 216s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 216s from numpy.core._multiarray_umath import ( 216s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 216s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 216s 216s During handling of the above exception, another exception occurred: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 216s from numpy.__config__ import show as show_config 216s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 216s from numpy.core._multiarray_umath import ( 216s ...<3 lines>... 216s ) 216s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 216s raise ImportError(msg) 216s ImportError: 216s 216s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 216s 216s Importing the numpy C-extensions failed. This error can happen for 216s many reasons, often due to issues with your setup or how NumPy was 216s installed. 216s 216s We have compiled some common reasons and troubleshooting tips at: 216s 216s https://numpy.org/devdocs/user/troubleshooting-importerror.html 216s 216s Please note and check the following: 216s 216s * The Python version is: Python3.13 from "/usr/bin/python3.13" 216s * The NumPy version is: "1.26.4" 216s 216s and make sure that they are the versions you expect. 216s Please carefully study the documentation linked above for further help. 216s 216s Original error was: No module named 'numpy.core._multiarray_umath' 216s 216s 216s The above exception was the direct cause of the following exception: 216s 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_Sequence.py", line 18, in 216s from presto.Sequence import getDNAScoreDict, scoreDNA, scoreSeqPair, weightSeq, \ 216s calculateSetError, meanQuality, filterQuality 216s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 216s import numpy as np 216s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 216s raise ImportError(msg) from e 216s ImportError: Error importing numpy: you should not try to import numpy from 216s its source directory; please exit the numpy source tree, and relaunch 216s your python interpreter from there. 216s 216s 216s ====================================================================== 216s ERROR: tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) 216s ---------------------------------------------------------------------- 216s ImportError: Failed to import test module: tests.test_UnifyHeaders 216s Traceback (most recent call last): 216s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 216s module = self._get_module_from_name(name) 216s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 216s __import__(name) 216s ~~~~~~~~~~^^^^^^ 216s File "/tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build/tests/test_UnifyHeaders.py", line 16, in 216s from presto.Multiprocessing import SeqData 216s File "/usr/lib/python3/dist-packages/presto/Multiprocessing.py", line 16, in 216s from Bio import SeqIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 216s from Bio.SeqIO import TwoBitIO 216s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 216s raise MissingPythonDependencyError( 216s ...<2 lines>... 216s ) from None 216s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 216s 216s 216s ---------------------------------------------------------------------- 216s Ran 13 tests in 0.002s 216s 216s FAILED (errors=9) 216s E: pybuild pybuild:389: test: plugin distutils failed with: exit code=1: cd /tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build; python3.13 -m unittest discover -v 216s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.W1ftaf/build.3vB/src/bin /tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build; rm /tmp/autopkgtest.W1ftaf/build.3vB/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 216s rm: cannot remove '/tmp/autopkgtest.W1ftaf/build.3vB/src/tests/test_ClusterSets.py': No such file or directory 216s I: pybuild base:311: cd /tmp/autopkgtest.W1ftaf/autopkgtest_tmp/build; python3.12 -m unittest discover -v 217s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 217s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 217s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 217s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 217s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 217s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 217s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 217s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 217s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 217s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 217s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok 217s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 217s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 217s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 217s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 217s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 217s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok 217s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 217s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 217s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 217s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 217s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 217s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object. 217s warnings.warn( 217s ok 217s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 217s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 217s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 217s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 217s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... -> test_collapseAnnotation() 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 217s <- test_collapseAnnotation() 0.000 217s -> test_getCoordKey() 217s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 217s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 217s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 217s <- test_getCoordKey() 0.000 217s -> test_mergeAnnotation() 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 217s <- test_mergeAnnotation() 0.000 217s -> test_renameAnnotation() 217s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 217s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 217s <- test_renameAnnotation() 0.000 217s -> test_calculateSetError() 217s Frequency consensus error> 217s REF> CGGCGTAA 217s SEQ1> CGGCGTAA 217s SEQ2> CCNNGTAA 217s SEQ3> CGGC--TA 217s SEQ4> CGNN--TA 217s SEQ5> CGGC--AA 217s ERROR> 0.250000 217s Quality consensus error> 217s REF> CGGCNNAA 217s SEQ1> CGGCGTAA 217s SEQ2> CCNNGTAA 217s SEQ3> CGGC--TA 217s SEQ4> CGNN--TA 217s SEQ5> CGGC--AA 217s ERROR> 0.233333 217s <- test_calculateSetError() 0.000 217s -> test_deleteSeqPositions() 217s MAX_GAP=0.4> CGGCAA 217s MAX_GAP=0.8> CGGCGTAA 217s <- test_deleteSeqPositions() 0.000 217s -> test_findGapPositions() 217s MAX_GAP=0.4> [4, 5] 217s MAX_GAP=0.8> [] 217s <- test_findGapPositions() 0.000 217s -> test_frequencyConsensus() 217s MIN_FREQ=0.2> CGGCGTAA 217s MIN_FREQ=0.8> CGGCGTNA 217s <- test_frequencyConsensus() 0.000 217s -> test_qualityConsensus() 217s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 217s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 217s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 217s <- test_qualityConsensus() 0.000 217s -> test_checkSeqEqual() 217s DNA Equality> 217s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 217s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 217s EQUAL> True 217s 217s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 217s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 217s EQUAL> False 217s 217s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 217s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 217s EQUAL> True 217s 217s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 217s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 217s EQUAL> False 217s 217s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 217s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 217s EQUAL> True 217s 217s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 217s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 217s EQUAL> True 217s 217s <- test_checkSeqEqual() 0.000 217s -> test_convert454Header() 217s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 217s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 217s <- test_convert454Header() 0.000 217s -> test_convertGenbankHeader() 217s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 217s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 217s <- test_convertGenbankHeader() 0.000 217s -> test_convertGenericHeader() 217s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 217s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 217s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 217s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 217s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 217s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 217s <- test_convertGenericHeader() 0.000 217s -> test_convertIMGTHeader() 217s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 217s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 217s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 217s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 217s OrderedDict({'ID': 'IGHV1-18*01'}) 217s OrderedDict({'ID': 'IGHV1-69*07'}) 217s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 217s OrderedDict({'ID': 'TRAV11*01'}) 217s <- test_convertIMGTHeader() 0.000 217s -> test_convertIlluminaHeader() 217s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 217s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 217s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 217s <- test_convertIlluminaHeader() 0.000 217s -> test_convertSRAHeader() 217s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 217s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 217s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 217s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 217s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 217s <- test_convertSRAHeader() 0.000 217s -> test_calculateDistances() 217s <- test_calculateDistances() 0.001 217s -> test_countMismatches() 217s <- test_countMismatches() 0.002 217s -> test_initializeMismatchDictionary() 217s <- test_initializeMismatchDictionary() 0.000 217s -> test_getFileType() 217s <- test_getFileType() 0.000 217s -> test_extractAlignment() 217s SEQ1> 217s SEQ> CCACGTTTTAGTAATTAATA 217s ALN-SEQ> CCACGTTTTAGT 217s ALN-PR> ----GTTTTAGT 217s PRIMER> GTTTTAGT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ2> 217s SEQ> CCNCGTTTTAGTAATTAATA 217s ALN-SEQ> CCNCGTTTTAGT 217s ALN-PR> ----GTTTTAGT 217s PRIMER> GTTTTAGT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ3> 217s SEQ> GGGCGTTTTAGTAATTAATA 217s ALN-SEQ> GGGCGTTTTAGT 217s ALN-PR> ----GTTTTAGT 217s PRIMER> GTTTTAGT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ4> 217s SEQ> GGNNGTTTTACTAATTAATA 217s ALN-SEQ> GGNNGTTTTACT 217s ALN-PR> ----GTTTTACT 217s PRIMER> GTTTTACT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ5> 217s SEQ> NNGCNNNNNACTAATTAATA 217s ALN-SEQ> NNGCNNNNNACT 217s ALN-PR> ----NNNNNACT 217s PRIMER> NNNNNACT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ6> 217s SEQ> GGGATANNNACTAATTAATA 217s ALN-SEQ> GGGATANNNACT 217s ALN-PR> ----TANNNACT 217s PRIMER> TANNNACT 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ7> 217s SEQ> NNNNNNNNNNNNNNNNNNNN 217s ALN-SEQ> NNNNNNNNNNNN 217s ALN-PR> ----NNNNNNNN 217s PRIMER> NNNNNNNN 217s START> 4 217s END> 12 217s GAPS> 0 217s ERROR> 0.000000 217s 217s <- test_extractAlignment() 0.000 217s -> test_localAlignment() 217s TEST Ns> 217s SEQ1> 217s SEQ> CCACGTTTTAGTAATTAATA 217s ALN-SEQ> CCACGTTTTAGTAATTAATA 217s ALN-PR> -CACGTTTT----------- 217s PRIMER> PR1 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ2> 217s SEQ> CCNCGTTTTAGTAATTAATA 217s ALN-SEQ> CCNCGTTTTAGTAATTAATA 217s ALN-PR> -CACGTTTT----------- 217s PRIMER> PR1 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.125000 217s 217s SEQ3> 217s SEQ> GGGCGTTTTAGTAATTAATA 217s ALN-SEQ> GGGCGTTTTAGTAATTAATA 217s ALN-PR> -GGCGTTTT----------- 217s PRIMER> PR2 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ4> 217s SEQ> GGNNGTTTTACTAATTAATA 217s ALN-SEQ> GGNNGTTTTACTAATTAATA 217s ALN-PR> GGC-GTTTT----------- 217s PRIMER> PR2 217s START> 0 217s END> 9 217s GAPS> 1 217s ERROR> 0.250000 217s ok 217s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 217s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 217s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 217s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 217s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 217s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 217s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok 217s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... 217s SEQ5> 217s SEQ> NNGCNNNNNACTAATTAATA 217s ALN-SEQ> NNGCNNNNNACTAATTAATA 217s ALN-PR> ------------ANATAA-- 217s PRIMER> PR3 217s START> 12 217s END> 18 217s GAPS> 0 217s ERROR> 0.375000 217s 217s SEQ6> 217s SEQ> GGGATANNNACTAATTAATA 217s ALN-SEQ> GGGATANNNACTAATTAATA 217s ALN-PR> -GGANA-------------- 217s PRIMER> PR3 217s START> 1 217s END> 6 217s GAPS> 0 217s ERROR> 0.375000 217s 217s SEQ7> 217s SEQ> NNNNNNNNNNNNNNNNNNNN 217s ALN-SEQ> None 217s ALN-PR> None 217s PRIMER> None 217s START> None 217s END> None 217s GAPS> 0 217s ERROR> 1.000000 217s 217s TEST INDELS> 217s SEQ1> 217s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 217s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 217s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 217s PRIMER> PR1 217s START> 15 217s END> 38 217s GAPS> 0 217s ERROR> 0.083333 217s 217s SEQ2> 217s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 217s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 217s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 217s PRIMER> PR1 217s START> 14 217s END> 38 217s GAPS> 2 217s ERROR> 0.208333 217s 217s SEQ3> 217s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 217s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 217s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 217s PRIMER> PR1 217s START> 15 217s END> 38 217s GAPS> 1 217s ERROR> 0.125000 217s 217s SEQ4> 217s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 217s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 217s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 217s PRIMER> PR2 217s START> 6 217s END> 19 217s GAPS> 1 217s ERROR> 0.250000 217s 217s SEQ5> 217s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 217s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 217s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 217s PRIMER> PR2 217s START> 6 217s END> 18 217s GAPS> 0 217s ERROR> 0.166667 217s 217s SEQ6> 217s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 217s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 217s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 217s PRIMER> PR2 217s START> 0 217s END> 11 217s GAPS> 1 217s ERROR> 0.250000 217s 217s SEQ7> 217s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 217s PRIMER> PR3 217s START> 2 217s END> 15 217s GAPS> 1 217s ERROR> 0.083333 217s 217s SEQ8> 217s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 217s PRIMER> PR3 217s START> 3 217s END> 15 217s GAPS> 1 217s ERROR> 0.166667 217s 217s SEQ9> 217s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 217s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 217s PRIMER> PR3 217s START> 3 217s END> 15 217s GAPS> 1 217s ERROR> 0.333333 217s 217s SEQ10> 217s SEQ> -------------------------------------------------------------- 217s ALN-SEQ> None 217s ALN-PR> None 217s PRIMER> None 217s START> None 217s END> None 217s GAPS> 0 217s ERROR> 1.000000 217s 217s <- test_localAlignment() 0.038 217s -> test_maskSeq() 217s TEST CUT> 217s ID> SEQ|PRIMER=A|BARCODE=CCA 217s SEQ> AGTAATTAATA 217s 217s TEST MASK> 217s ID> SEQ|PRIMER=A|BARCODE=CCA 217s SEQ> NNNNNNAGTAATTAATA 217s 217s TEST TRIM> 217s ID> SEQ|PRIMER=A|BARCODE=CCA 217s SEQ> CGTTTTAGTAATTAATA 217s 217s TEST TAG> 217s ID> SEQ|PRIMER=A|BARCODE=CCA 217s SEQ> CCACGTTTTAGTAATTAATA 217s 217s <- test_maskSeq() 0.002 217s -> test_scoreAlignment() 217s SEQ1> 217s SEQ> CCACGTTTTAGTAATTAATA 217s ALN-SEQ> CCACGTTTT 217s ALN-PR> -CACGTTTT 217s PRIMER> PR1 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ2> 217s SEQ> CCNCGTTTTAGTAATTAATA 217s ALN-SEQ> CCNCGTTTT 217s ALN-PR> -CACGTTTT 217s PRIMER> PR1 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.125000 217s 217s SEQ3> 217s SEQ> GGGCGTTTTAGTAATTAATA 217s ALN-SEQ> GGGCGTTTT 217s ALN-PR> -GGCGTTTT 217s PRIMER> PR2 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.000000 217s 217s SEQ4> 217s SEQ> GGNNGTTTTACTAATTAATA 217s ALN-SEQ> GGNNGTTTT 217s ALN-PR> -GGCGTTTT 217s PRIMER> PR2 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.250000 217s 217s SEQ5> 217s SEQ> NNGCNNNNNACTAATTAATA 217s ALN-SEQ> NNGCNNNNN 217s ALN-PR> -GGCGTTTT 217s PRIMER> PR2 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.750000 217s 217s SEQ6> 217s SEQ> GGGATANNNACTAATTAATA 217s ALN-SEQ> GGGATANNN 217s ALN-PR> -GGANATAA 217s PRIMER> PR3 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 0.375000 217s 217s SEQ7> 217s SEQ> NNNNNNNNNNNNNNNNNNNN 217s ALN-SEQ> NNNNNNNNN 217s ALN-PR> -CACGTTTT 217s PRIMER> None 217s START> 1 217s END> 9 217s GAPS> 0 217s ERROR> 1.000000 217s 217s <- test_scoreAlignment() 0.011 217s -> test_calculateSetError() 217s REF> CGGCGTAA 0.4347826086956522 217s REF> NNNNNNNN 1.0 217s <- test_calculateSetError() 0.000 217s -> test_filterQuality() 217s RESULT> True 25 217s RESULT> False 5 217s RESULT> False 0 217s <- test_filterQuality() 0.000 217s -> test_meanQuality() 217s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 217s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 217s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 217s <- test_meanQuality() 0.000 217s -> test_scoreDNA() 217s Default DNA Scores> 217s A==A> 1 217s A==T> 0 217s A==R> 1 217s U==T> 1 217s A==N> 1 217s N==A> 1 217s A==-> 0 217s -==A> 0 217s Symmetric DNA Scores> 217s A==A> 1 217s A==T> 0 217s A==R> 1 217s U==T> 1 217s A==N> 1 217s N==A> 1 217s A==-> 1 217s -==A> 1 217s Asymmetric DNA Scores> 217s A==A> 1 217s A==T> 0 217s A==R> 1 217s U==T> 1 217s A==N> 1 217s N==A> 0 217s A==-> 1 217s -==A> 0 217s <- test_scoreDNA() 0.001 217s -> test_scoreSeqPair() 217s Default DNA Scores> 217s SEQ1> CGGCGTAA 217s SEQ2> CGNNGTAG 217s SCORE> 7 217s WEIGHT> 8 217s ERROR> 0.125000 217s 217s SEQ1> CGGCGTAA 217s SEQ3> CGGC--AA 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ1> CGGCGTAA 217s SEQ4> CGNN--AG 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ1> CGGCGTAA 217s SEQ5> NNNNNNNN 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ6> NNNNNNAA 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ2> CGNNGTAG 217s SEQ3> CGGC--AA 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ2> CGNNGTAG 217s SEQ4> CGNN--AG 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ2> CGNNGTAG 217s SEQ5> NNNNNNNN 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ2> CGNNGTAG 217s SEQ6> NNNNNNAA 217s SCORE> 7 217s WEIGHT> 8 217s ERROR> 0.125000 217s 217s SEQ2> CGNNGTAG 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ2> CGNNGTAG 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ3> CGGC--AA 217s SEQ4> CGNN--AG 217s SCORE> 7 217s WEIGHT> 8 217s ERROR> 0.125000 217s 217s SEQ3> CGGC--AA 217s SEQ5> NNNNNNNN 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ6> NNNNNNAA 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ7> -------- 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ3> CGGC--AA 217s SEQ8> CG------ 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ4> CGNN--AG 217s SEQ5> NNNNNNNN 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ4> CGNN--AG 217s SEQ6> NNNNNNAA 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ4> CGNN--AG 217s SEQ7> -------- 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ4> CGNN--AG 217s SEQ8> CG------ 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ5> NNNNNNNN 217s SEQ6> NNNNNNAA 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ6> NNNNNNAA 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ6> NNNNNNAA 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ7> -------- 217s SEQ8> CG------ 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s Asymmetric DNA Scores> 217s SEQ1> CGGCGTAA 217s SEQ2> CGNNGTAG 217s SCORE> 7 217s WEIGHT> 8 217s ERROR> 0.125000 217s 217s SEQ1> CGGCGTAA 217s SEQ3> CGGC--AA 217s SCORE> 8ok 217s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 217s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 217s 217s ---------------------------------------------------------------------- 217s Ran 38 tests in 0.071s 217s 217s OK (skipped=6) 217s 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ4> CGNN--AG 217s SCORE> 7 217s WEIGHT> 8 217s ERROR> 0.125000 217s 217s SEQ1> CGGCGTAA 217s SEQ5> NNNNNNNN 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ6> NNNNNNAA 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ7> -------- 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ8> CG------ 217s SCORE> 8 217s WEIGHT> 8 217s ERROR> 0.000000 217s 217s SEQ2> CGNNGTAG 217s SEQ3> CGGC--AA 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ2> CGNNGTAG 217s SEQ4> CGNN--AG 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ2> CGNNGTAG 217s SEQ5> NNNNNNNN 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ2> CGNNGTAG 217s SEQ6> NNNNNNAA 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ2> CGNNGTAG 217s SEQ7> -------- 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ2> CGNNGTAG 217s SEQ8> CG------ 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ4> CGNN--AG 217s SCORE> 5 217s WEIGHT> 8 217s ERROR> 0.375000 217s 217s SEQ3> CGGC--AA 217s SEQ5> NNNNNNNN 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ6> NNNNNNAA 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ7> -------- 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ3> CGGC--AA 217s SEQ8> CG------ 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ4> CGNN--AG 217s SEQ5> NNNNNNNN 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ4> CGNN--AG 217s SEQ6> NNNNNNAA 217s SCORE> 3 217s WEIGHT> 8 217s ERROR> 0.625000 217s 217s SEQ4> CGNN--AG 217s SEQ7> -------- 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ4> CGNN--AG 217s SEQ8> CG------ 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ5> NNNNNNNN 217s SEQ6> NNNNNNAA 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ8> CG------ 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ6> NNNNNNAA 217s SEQ7> -------- 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ6> NNNNNNAA 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ7> -------- 217s SEQ8> CG------ 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s Masked DNA Scores> 217s SEQ1> CGGCGTAA 217s SEQ2> CGNNGTAG 217s SCORE> 5 217s WEIGHT> 6 217s ERROR> 0.166667 217s 217s SEQ1> CGGCGTAA 217s SEQ3> CGGC--AA 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s SEQ1> CGGCGTAA 217s SEQ4> CGNN--AG 217s SCORE> 3 217s WEIGHT> 6 217s ERROR> 0.500000 217s 217s SEQ1> CGGCGTAA 217s SEQ5> NNNNNNNN 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ6> NNNNNNAA 217s SCORE> 2 217s WEIGHT> 2 217s ERROR> 0.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 8 217s ERROR> 1.000000 217s 217s SEQ1> CGGCGTAA 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ2> CGNNGTAG 217s SEQ3> CGGC--AA 217s SCORE> 3 217s WEIGHT> 6 217s ERROR> 0.500000 217s 217s SEQ2> CGNNGTAG 217s SEQ4> CGNN--AG 217s SCORE> 4 217s WEIGHT> 6 217s ERROR> 0.333333 217s 217s SEQ2> CGNNGTAG 217s SEQ5> NNNNNNNN 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ2> CGNNGTAG 217s SEQ6> NNNNNNAA 217s SCORE> 1 217s WEIGHT> 2 217s ERROR> 0.500000 217s 217s SEQ2> CGNNGTAG 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 6 217s ERROR> 1.000000 217s 217s SEQ2> CGNNGTAG 217s SEQ8> CG------ 217s SCORE> 2 217s WEIGHT> 6 217s ERROR> 0.666667 217s 217s SEQ3> CGGC--AA 217s SEQ4> CGNN--AG 217s SCORE> 5 217s WEIGHT> 6 217s ERROR> 0.166667 217s 217s SEQ3> CGGC--AA 217s SEQ5> NNNNNNNN 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ3> CGGC--AA 217s SEQ6> NNNNNNAA 217s SCORE> 2 217s WEIGHT> 2 217s ERROR> 0.000000 217s 217s SEQ3> CGGC--AA 217s SEQ7> -------- 217s SCORE> 2 217s WEIGHT> 8 217s ERROR> 0.750000 217s 217s SEQ3> CGGC--AA 217s SEQ8> CG------ 217s SCORE> 4 217s WEIGHT> 8 217s ERROR> 0.500000 217s 217s SEQ4> CGNN--AG 217s SEQ5> NNNNNNNN 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ4> CGNN--AG 217s SEQ6> NNNNNNAA 217s SCORE> 1 217s WEIGHT> 2 217s ERROR> 0.500000 217s 217s SEQ4> CGNN--AG 217s SEQ7> -------- 217s SCORE> 2 217s WEIGHT> 6 217s ERROR> 0.666667 217s 217s SEQ4> CGNN--AG 217s SEQ8> CG------ 217s SCORE> 4 217s WEIGHT> 6 217s ERROR> 0.333333 217s 217s SEQ5> NNNNNNNN 217s SEQ6> NNNNNNAA 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ5> NNNNNNNN 217s SEQ8> CG------ 217s SCORE> 0 217s WEIGHT> 0 217s ERROR> 1.000000 217s 217s SEQ6> NNNNNNAA 217s SEQ7> -------- 217s SCORE> 0 217s WEIGHT> 2 217s ERROR> 1.000000 217s 217s SEQ6> NNNNNNAA 217s SEQ8> CG------ 217s SCORE> 0 217s WEIGHT> 2 217s ERROR> 1.000000 217s 217s SEQ7> -------- 217s SEQ8> CG------ 217s SCORE> 6 217s WEIGHT> 8 217s ERROR> 0.250000 217s 217s <- test_scoreSeqPair() 0.008 217s -> test_weightDNA() 217s DNA Weight> 217s SEQ1> 8 217s SEQ2> 6 217s SEQ3> 8 217s SEQ4> 6 217s SEQ5> 0 217s SEQ6> 2 217s SEQ7> 8 217s SEQ8> 8 217s AA Weight> 217s SEQ1> 8 217s SEQ2> 6 217s SEQ3> 8 217s SEQ4> 6 217s <- test_weightDNA() 0.000 217s -> test_consensusUnify() 217s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 217s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 217s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 217s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 217s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 217s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 217s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 217s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 217s <- test_consensusUnify() 0.001 217s -> test_deletionUnify() 217s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 217s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 217s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 217s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 217s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 217s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 217s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 217s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 217s <- test_deletionUnify() 0.000 217s pybuild-autopkgtest: error: pybuild --autopkgtest -i python{version} -p "3.13 3.12" returned exit code 13 217s make: *** [/tmp/mCAlBH_9h_/run:4: pybuild-autopkgtest] Error 25 217s pybuild-autopkgtest: error: /tmp/mCAlBH_9h_/run pybuild-autopkgtest returned exit code 2 217s autopkgtest [19:38:29]: test pybuild-autopkgtest: -----------------------] 218s autopkgtest [19:38:30]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 218s pybuild-autopkgtest FAIL non-zero exit status 25 218s autopkgtest [19:38:30]: @@@@@@@@@@@@@@@@@@@@ summary 218s pybuild-autopkgtest FAIL non-zero exit status 25 222s virt: nova [W] Using flock in prodstack6-ppc64el 222s virt: Creating nova instance adt-plucky-ppc64el-presto-20241113-193452-juju-7f2275-prod-proposed-migration-environment-2-ed0003df-ecdd-4c92-908f-c78b647e8172 from image adt/ubuntu-plucky-ppc64el-server-20241113.img (UUID 0c5715b6-5cca-4485-b8bf-b85dfd917a5f)...