0s autopkgtest [18:47:12]: starting date and time: 2024-11-13 18:47:12+0000 0s autopkgtest [18:47:12]: git checkout: 6f3be7a8 Fix armhf LXD image generation for plucky 0s autopkgtest [18:47:12]: host juju-7f2275-prod-proposed-migration-environment-15; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.9tx8o_e8/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-ppc64el --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-15@bos03-ppc64el-4.secgroup --name adt-plucky-ppc64el-ncbi-blast+-20241113-184712-juju-7f2275-prod-proposed-migration-environment-15-d78ad554-9a90-4b3d-82f3-0aa75eaf5fd7 --image adt/ubuntu-plucky-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-15 --net-id=net_prod-proposed-migration-ppc64el -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 107s autopkgtest [18:48:59]: testbed dpkg architecture: ppc64el 107s autopkgtest [18:48:59]: testbed apt version: 2.9.8 107s autopkgtest [18:48:59]: @@@@@@@@@@@@@@@@@@@@ test bed setup 108s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 108s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [971 kB] 108s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [17.2 kB] 108s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 108s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [104 kB] 108s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el Packages [113 kB] 108s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el Packages [672 kB] 108s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el Packages [20.8 kB] 109s Fetched 1978 kB in 1s (2137 kB/s) 109s Reading package lists... 111s Reading package lists... 111s Building dependency tree... 111s Reading state information... 112s Calculating upgrade... 112s The following NEW packages will be installed: 112s python3.13-gdbm 112s The following packages will be upgraded: 112s libgnutls30t64 libjson-glib-1.0-0 libjson-glib-1.0-common libpython3-stdlib 112s libutempter0 python3 python3-gdbm python3-minimal 112s 8 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 112s Need to get 1265 kB of archives. 112s After this operation, 141 kB of additional disk space will be used. 112s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-minimal ppc64el 3.12.7-1 [27.4 kB] 112s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3 ppc64el 3.12.7-1 [24.0 kB] 112s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el libpython3-stdlib ppc64el 3.12.7-1 [10.0 kB] 112s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgnutls30t64 ppc64el 3.8.8-2ubuntu1 [1072 kB] 112s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-gdbm ppc64el 3.13.0-2 [31.5 kB] 112s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-gdbm ppc64el 3.12.7-1 [8640 B] 112s Get:7 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjson-glib-1.0-common all 1.10.0+ds-3 [5586 B] 112s Get:8 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjson-glib-1.0-0 ppc64el 1.10.0+ds-3 [76.0 kB] 112s Get:9 http://ftpmaster.internal/ubuntu plucky/main ppc64el libutempter0 ppc64el 1.2.1-4 [9850 B] 113s Fetched 1265 kB in 1s (1947 kB/s) 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 113s Preparing to unpack .../python3-minimal_3.12.7-1_ppc64el.deb ... 113s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 113s Setting up python3-minimal (3.12.7-1) ... 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 113s Preparing to unpack .../python3_3.12.7-1_ppc64el.deb ... 113s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 113s Preparing to unpack .../libpython3-stdlib_3.12.7-1_ppc64el.deb ... 113s Unpacking libpython3-stdlib:ppc64el (3.12.7-1) over (3.12.6-0ubuntu1) ... 113s Preparing to unpack .../libgnutls30t64_3.8.8-2ubuntu1_ppc64el.deb ... 113s Unpacking libgnutls30t64:ppc64el (3.8.8-2ubuntu1) over (3.8.6-2ubuntu1) ... 113s Setting up libgnutls30t64:ppc64el (3.8.8-2ubuntu1) ... 113s Selecting previously unselected package python3.13-gdbm. 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 114s Preparing to unpack .../python3.13-gdbm_3.13.0-2_ppc64el.deb ... 114s Unpacking python3.13-gdbm (3.13.0-2) ... 114s Preparing to unpack .../python3-gdbm_3.12.7-1_ppc64el.deb ... 114s Unpacking python3-gdbm:ppc64el (3.12.7-1) over (3.12.6-1ubuntu1) ... 114s Preparing to unpack .../libjson-glib-1.0-common_1.10.0+ds-3_all.deb ... 114s Unpacking libjson-glib-1.0-common (1.10.0+ds-3) over (1.10.0+ds-2) ... 114s Preparing to unpack .../libjson-glib-1.0-0_1.10.0+ds-3_ppc64el.deb ... 114s Unpacking libjson-glib-1.0-0:ppc64el (1.10.0+ds-3) over (1.10.0+ds-2) ... 114s Preparing to unpack .../libutempter0_1.2.1-4_ppc64el.deb ... 114s Unpacking libutempter0:ppc64el (1.2.1-4) over (1.2.1-3build1) ... 114s Setting up libutempter0:ppc64el (1.2.1-4) ... 114s Setting up libjson-glib-1.0-common (1.10.0+ds-3) ... 114s Setting up python3.13-gdbm (3.13.0-2) ... 114s Setting up libpython3-stdlib:ppc64el (3.12.7-1) ... 114s Setting up python3 (3.12.7-1) ... 114s Setting up libjson-glib-1.0-0:ppc64el (1.10.0+ds-3) ... 114s Setting up python3-gdbm:ppc64el (3.12.7-1) ... 114s Processing triggers for man-db (2.12.1-3) ... 115s Processing triggers for libc-bin (2.40-1ubuntu3) ... 115s Reading package lists... 115s Building dependency tree... 115s Reading state information... 116s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 116s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 116s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 116s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 116s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 118s Reading package lists... 118s Reading package lists... 118s Building dependency tree... 118s Reading state information... 118s Calculating upgrade... 118s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 118s Reading package lists... 118s Building dependency tree... 118s Reading state information... 118s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 121s autopkgtest [18:49:13]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP Mon Sep 16 13:49:23 UTC 2024 121s autopkgtest [18:49:13]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 124s Get:1 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (dsc) [2498 B] 124s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (tar) [18.4 MB] 124s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (diff) [40.7 kB] 124s gpgv: Signature made Wed Aug 7 01:47:58 2024 UTC 124s gpgv: using RSA key 7C3AB9CFD230BD30DD009C591E7091B1F14A64A2 124s gpgv: Can't check signature: No public key 124s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6.dsc: no acceptable signature found 126s autopkgtest [18:49:18]: testing package ncbi-blast+ version 2.16.0+ds-6 126s autopkgtest [18:49:18]: build not needed 133s autopkgtest [18:49:25]: test run-unit-test: preparing testbed 142s Reading package lists... 142s Building dependency tree... 142s Reading state information... 142s Starting pkgProblemResolver with broken count: 0 142s Starting 2 pkgProblemResolver with broken count: 0 142s Done 142s The following additional packages will be installed: 142s libgomp1 libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 ncbi-blast+ 142s ncbi-blast+-legacy ncbi-data 142s The following NEW packages will be installed: 142s autopkgtest-satdep libgomp1 libmbedcrypto7t64 libmbedtls14t64 142s libmbedx509-1t64 ncbi-blast+ ncbi-blast+-legacy ncbi-data 142s 0 upgraded, 8 newly installed, 0 to remove and 0 not upgraded. 142s Need to get 20.6 MB/20.6 MB of archives. 142s After this operation, 100 MB of additional disk space will be used. 142s Get:1 /tmp/autopkgtest.q3xhL1/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [716 B] 142s Get:2 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgomp1 ppc64el 14.2.0-8ubuntu1 [161 kB] 142s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedcrypto7t64 ppc64el 2.28.8-1 [267 kB] 142s Get:4 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedx509-1t64 ppc64el 2.28.8-1 [51.7 kB] 142s Get:5 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libmbedtls14t64 ppc64el 2.28.8-1 [90.6 kB] 142s Get:6 http://ftpmaster.internal/ubuntu plucky/universe ppc64el ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 142s Get:7 http://ftpmaster.internal/ubuntu plucky/universe ppc64el ncbi-blast+ ppc64el 2.16.0+ds-6 [16.1 MB] 143s Get:8 http://ftpmaster.internal/ubuntu plucky/universe ppc64el ncbi-blast+-legacy all 2.16.0+ds-6 [4990 B] 143s Fetched 20.6 MB in 1s (14.6 MB/s) 143s Selecting previously unselected package libgomp1:ppc64el. 143s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73774 files and directories currently installed.) 143s Preparing to unpack .../0-libgomp1_14.2.0-8ubuntu1_ppc64el.deb ... 143s Unpacking libgomp1:ppc64el (14.2.0-8ubuntu1) ... 143s Selecting previously unselected package libmbedcrypto7t64:ppc64el. 143s Preparing to unpack .../1-libmbedcrypto7t64_2.28.8-1_ppc64el.deb ... 143s Unpacking libmbedcrypto7t64:ppc64el (2.28.8-1) ... 143s Selecting previously unselected package libmbedx509-1t64:ppc64el. 143s Preparing to unpack .../2-libmbedx509-1t64_2.28.8-1_ppc64el.deb ... 143s Unpacking libmbedx509-1t64:ppc64el (2.28.8-1) ... 143s Selecting previously unselected package libmbedtls14t64:ppc64el. 143s Preparing to unpack .../3-libmbedtls14t64_2.28.8-1_ppc64el.deb ... 143s Unpacking libmbedtls14t64:ppc64el (2.28.8-1) ... 143s Selecting previously unselected package ncbi-data. 143s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 143s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 143s Selecting previously unselected package ncbi-blast+. 143s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6_ppc64el.deb ... 143s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 144s Selecting previously unselected package ncbi-blast+-legacy. 144s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6_all.deb ... 144s Unpacking ncbi-blast+-legacy (2.16.0+ds-6) ... 144s Selecting previously unselected package autopkgtest-satdep. 144s Preparing to unpack .../7-1-autopkgtest-satdep.deb ... 144s Unpacking autopkgtest-satdep (0) ... 144s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 144s Setting up libmbedcrypto7t64:ppc64el (2.28.8-1) ... 144s Setting up libgomp1:ppc64el (14.2.0-8ubuntu1) ... 144s Setting up libmbedx509-1t64:ppc64el (2.28.8-1) ... 144s Setting up libmbedtls14t64:ppc64el (2.28.8-1) ... 144s Setting up ncbi-blast+ (2.16.0+ds-6) ... 144s Setting up ncbi-blast+-legacy (2.16.0+ds-6) ... 144s Setting up autopkgtest-satdep (0) ... 144s Processing triggers for man-db (2.12.1-3) ... 144s Processing triggers for libc-bin (2.40-1ubuntu3) ... 147s (Reading database ... 74048 files and directories currently installed.) 147s Removing autopkgtest-satdep (0) ... 147s autopkgtest [18:49:39]: test run-unit-test: [----------------------- 148s ---Creating Database-- 148s 148s 148s Building a new DB, current time: 11/13/2024 18:49:40 148s New DB name: /tmp/autopkgtest.q3xhL1/autopkgtest_tmp/testdb 148s New DB title: testdatabase.fa 148s Sequence type: Nucleotide 148s Keep MBits: T 148s Maximum file size: 3000000000B 148s Adding sequences from FASTA; added 3 sequences in 0.19901 seconds. 148s 148s 148s ---Searching Database for Hits--- 148s Warning: [blastn] Examining 5 or more matches is recommended 148s # BLASTN 2.16.0+ 148s # Query: gnl|MYDB|1 this is sequence 1 148s # Database: testdb 148s # Fields: query id, subject id, evalue, bit score 148s # 2 hits found 148s gnl|MYDB|1 gnl2 0.0 1299 148s gnl|MYDB|1 gnl1 0.0 1299 148s # BLAST processed 1 queries 148s ---Search and Fetch An Entry From Database--- 148s >gnl1 148s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 148s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 148s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 148s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 148s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 148s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 148s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 148s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 148s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 148s PASS 148s autopkgtest [18:49:40]: test run-unit-test: -----------------------] 149s autopkgtest [18:49:41]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 149s run-unit-test PASS 149s autopkgtest [18:49:41]: @@@@@@@@@@@@@@@@@@@@ summary 149s run-unit-test PASS 154s nova [W] Using flock in prodstack6-ppc64el 154s Creating nova instance adt-plucky-ppc64el-ncbi-blast+-20241113-184712-juju-7f2275-prod-proposed-migration-environment-15-d78ad554-9a90-4b3d-82f3-0aa75eaf5fd7 from image adt/ubuntu-plucky-ppc64el-server-20241113.img (UUID 0c5715b6-5cca-4485-b8bf-b85dfd917a5f)...