0s autopkgtest [13:49:21]: starting date and time: 2025-03-17 13:49:21+0000
  0s autopkgtest [13:49:21]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production'
  0s autopkgtest [13:49:21]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work._resocne/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:expat --apt-upgrade emboss --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=expat/2.7.0-1 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-ppc64el --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-ppc64el-13.secgroup --name adt-plucky-ppc64el-emboss-20250317-133208-juju-7f2275-prod-proposed-migration-environment-2-df000645-f292-42d8-bbed-e9fd4912e8c6 --image adt/ubuntu-plucky-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-ppc64el -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/
135s autopkgtest [13:51:36]: testbed dpkg architecture: ppc64el
135s autopkgtest [13:51:36]: testbed apt version: 2.9.33
136s autopkgtest [13:51:37]: @@@@@@@@@@@@@@@@@@@@ test bed setup
136s autopkgtest [13:51:37]: testbed release detected to be: None
137s autopkgtest [13:51:38]: updating testbed package index (apt update)
137s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB]
137s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease
137s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease
137s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease
137s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [11.5 kB]
137s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [316 kB]
138s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [37.5 kB]
138s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el Packages [57.2 kB]
138s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el c-n-f Metadata [1876 B]
138s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted ppc64el c-n-f Metadata [120 B]
138s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el Packages [237 kB]
138s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el c-n-f Metadata [12.0 kB]
138s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el Packages [3020 B]
138s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el c-n-f Metadata [216 B]
138s Fetched 803 kB in 1s (1013 kB/s)
139s Reading package lists...
139s Reading package lists...
140s Building dependency tree...
140s Reading state information...
140s Calculating upgrade...
140s Calculating upgrade...
140s The following package was automatically installed and is no longer required:
140s   python3.12-gdbm
140s Use 'sudo apt autoremove' to remove it.
140s The following packages will be upgraded:
140s   libnl-3-200 libnl-route-3-200 python3-gdbm
140s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
140s Need to get 283 kB of archives.
140s After this operation, 1024 B of additional disk space will be used.
140s Get:1 http://ftpmaster.internal/ubuntu plucky/main ppc64el libnl-route-3-200 ppc64el 3.7.0-2 [202 kB]
140s Get:2 http://ftpmaster.internal/ubuntu plucky/main ppc64el libnl-3-200 ppc64el 3.7.0-2 [72.2 kB]
140s Get:3 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3-gdbm ppc64el 3.13.2-1 [8708 B]
141s Fetched 283 kB in 0s (695 kB/s)
141s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 76362 files and directories currently installed.)
141s Preparing to unpack .../libnl-route-3-200_3.7.0-2_ppc64el.deb ...
141s Unpacking libnl-route-3-200:ppc64el (3.7.0-2) over (3.7.0-1) ...
141s Preparing to unpack .../libnl-3-200_3.7.0-2_ppc64el.deb ...
141s Unpacking libnl-3-200:ppc64el (3.7.0-2) over (3.7.0-1) ...
141s Preparing to unpack .../python3-gdbm_3.13.2-1_ppc64el.deb ...
141s Unpacking python3-gdbm:ppc64el (3.13.2-1) over (3.13.1-1) ...
141s Setting up python3-gdbm:ppc64el (3.13.2-1) ...
141s Setting up libnl-3-200:ppc64el (3.7.0-2) ...
141s Setting up libnl-route-3-200:ppc64el (3.7.0-2) ...
141s Processing triggers for libc-bin (2.41-1ubuntu1) ...
141s Reading package lists...
141s Building dependency tree...
141s Reading state information...
142s Solving dependencies...
142s The following packages will be REMOVED:
142s   linux-image-6.11.0-8-generic* linux-modules-6.11.0-8-generic*
142s   python3.12-gdbm*
142s 0 upgraded, 0 newly installed, 3 to remove and 1 not upgraded.
142s After this operation, 96.6 MB disk space will be freed.
142s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 76361 files and directories currently installed.)
142s Removing linux-image-6.11.0-8-generic (6.11.0-8.8) ...
142s I: /boot/vmlinux.old is now a symlink to vmlinux-6.14.0-10-generic
142s I: /boot/initrd.img.old is now a symlink to initrd.img-6.14.0-10-generic
142s /etc/kernel/postrm.d/initramfs-tools:
142s update-initramfs: Deleting /boot/initrd.img-6.11.0-8-generic
142s /etc/kernel/postrm.d/zz-update-grub:
142s Sourcing file `/etc/default/grub'
142s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg'
142s Generating grub configuration file ...
143s Found linux image: /boot/vmlinux-6.14.0-10-generic
143s Found initrd image: /boot/initrd.img-6.14.0-10-generic
143s Warning: os-prober will not be executed to detect other bootable partitions.
143s Systems on them will not be added to the GRUB boot configuration.
143s Check GRUB_DISABLE_OS_PROBER documentation entry.
143s Adding boot menu entry for UEFI Firmware Settings ...
143s done
143s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ...
143s Removing python3.12-gdbm (3.12.9-1) ...
143s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 75155 files and directories currently installed.)
143s Purging configuration files for linux-image-6.11.0-8-generic (6.11.0-8.8) ...
143s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ...
143s autopkgtest [13:51:44]: upgrading testbed (apt dist-upgrade and autopurge)
143s Reading package lists...
143s Building dependency tree...
143s Reading state information...
144s Calculating upgrade...Starting pkgProblemResolver with broken count: 0
144s Starting 2 pkgProblemResolver with broken count: 0
144s Done
144s Entering ResolveByKeep
144s 
144s Calculating upgrade...
144s The following packages will be upgraded:
144s   libexpat1
145s 1 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
145s Need to get 100 kB of archives.
145s After this operation, 1024 B of additional disk space will be used.
145s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el libexpat1 ppc64el 2.7.0-1 [100 kB]
145s Fetched 100 kB in 0s (267 kB/s)
145s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 75154 files and directories currently installed.)
145s Preparing to unpack .../libexpat1_2.7.0-1_ppc64el.deb ...
145s Unpacking libexpat1:ppc64el (2.7.0-1) over (2.6.4-1) ...
145s Setting up libexpat1:ppc64el (2.7.0-1) ...
145s Processing triggers for libc-bin (2.41-1ubuntu1) ...
145s Reading package lists...
146s Building dependency tree...
146s Reading state information...
146s Starting pkgProblemResolver with broken count: 0
146s Starting 2 pkgProblemResolver with broken count: 0
146s Done
146s Solving dependencies...
146s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
146s autopkgtest [13:51:47]: rebooting testbed after setup commands that affected boot
177s autopkgtest [13:52:18]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP Wed Mar 12 16:05:46 UTC 2025
180s autopkgtest [13:52:21]: @@@@@@@@@@@@@@@@@@@@ apt-source emboss
189s Get:1 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (dsc) [2655 B]
189s Get:2 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (tar) [77.4 MB]
189s Get:3 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (diff) [251 kB]
189s gpgv: Signature made Mon Apr 22 14:47:56 2024 UTC
189s gpgv:                using RSA key 4FB588A84C2DDE79A74C77876FA458DD1DB03F71
189s gpgv:                issuer "juliank@ubuntu.com"
189s gpgv: Can't check signature: No public key
189s dpkg-source: warning: cannot verify inline signature for ./emboss_6.6.0+dfsg-12ubuntu2.dsc: no acceptable signature found
197s dpkg-source: warning: diff 'src/debian/patches/no_makejar.patch' patches file src/jemboss/runJemboss.sh.in more than once
197s autopkgtest [13:52:38]: testing package emboss version 6.6.0+dfsg-12ubuntu2
198s autopkgtest [13:52:39]: build not needed
224s autopkgtest [13:53:05]: test run-unit-test: preparing testbed
224s Reading package lists...
224s Building dependency tree...
224s Reading state information...
225s Starting pkgProblemResolver with broken count: 0
225s Starting 2 pkgProblemResolver with broken count: 0
225s Done
225s The following NEW packages will be installed:
225s   adwaita-icon-theme at-spi2-common ca-certificates-java
225s   dconf-gsettings-backend dconf-service default-jre default-jre-headless
225s   emboss emboss-data emboss-doc emboss-lib emboss-test fontconfig
225s   fontconfig-config fonts-dejavu-core fonts-dejavu-mono gtk-update-icon-cache
225s   hicolor-icon-theme java-common jemboss libaom3 libasound2-data libasound2t64
225s   libatk-bridge2.0-0t64 libatk1.0-0t64 libatspi2.0-0t64 libavahi-client3
225s   libavahi-common-data libavahi-common3 libcairo-gobject2 libcairo2 libcolord2
225s   libcups2t64 libdatrie1 libdconf1 libde265-0 libdeflate0 libepoxy0
225s   libfontconfig1 libgbm1 libgd3 libgdk-pixbuf-2.0-0 libgdk-pixbuf2.0-common
225s   libgif7 libgl1 libgl1-mesa-dri libglvnd0 libglx-mesa0 libglx0 libgomp1
225s   libgraphite2-3 libgtk-3-0t64 libgtk-3-common libharfbuzz0b
225s   libheif-plugin-aomdec libheif-plugin-libde265 libheif1 libhpdf-2.3.0
225s   libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 liblcms2-2 liblerc4
225s   libmysqlclient21 libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0
225s   libpcsclite1 libpixman-1-0 libpq5 libraqm0 libsharpyuv0 libthai-data
225s   libthai0 libtiff6 libvulkan1 libwayland-client0 libwayland-cursor0
225s   libwayland-egl1 libwayland-server0 libwebp7 libx11-xcb1 libxcb-dri3-0
225s   libxcb-glx0 libxcb-present0 libxcb-randr0 libxcb-render0 libxcb-shm0
225s   libxcb-sync1 libxcb-xfixes0 libxcomposite1 libxcursor1 libxdamage1
225s   libxfixes3 libxi6 libxinerama1 libxpm4 libxrandr2 libxrender1 libxshmfence1
225s   libxtst6 libxxf86vm1 mesa-libgallium mysql-common openjdk-21-jre
225s   openjdk-21-jre-headless x11-common
225s 0 upgraded, 108 newly installed, 0 to remove and 0 not upgraded.
225s Need to get 153 MB of archives.
225s After this operation, 893 MB of additional disk space will be used.
225s Get:1 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgdk-pixbuf2.0-common all 2.42.12+dfsg-2 [8004 B]
225s Get:2 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg-turbo8 ppc64el 2.1.5-3ubuntu2 [215 kB]
225s Get:3 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg8 ppc64el 8c-2ubuntu11 [2148 B]
225s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdeflate0 ppc64el 1.23-1 [63.4 kB]
225s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjbig0 ppc64el 2.1-6.1ubuntu2 [35.9 kB]
225s Get:6 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblerc4 ppc64el 4.0.0+ds-5ubuntu1 [298 kB]
226s Get:7 http://ftpmaster.internal/ubuntu plucky/main ppc64el libsharpyuv0 ppc64el 1.5.0-0.1 [22.3 kB]
226s Get:8 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwebp7 ppc64el 1.5.0-0.1 [315 kB]
226s Get:9 http://ftpmaster.internal/ubuntu plucky/main ppc64el libtiff6 ppc64el 4.5.1+git230720-4ubuntu4 [272 kB]
226s Get:10 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgdk-pixbuf-2.0-0 ppc64el 2.42.12+dfsg-2 [191 kB]
226s Get:11 http://ftpmaster.internal/ubuntu plucky/main ppc64el gtk-update-icon-cache ppc64el 4.17.5+ds-3ubuntu1 [55.4 kB]
226s Get:12 http://ftpmaster.internal/ubuntu plucky/main ppc64el hicolor-icon-theme all 0.18-2 [13.3 kB]
226s Get:13 http://ftpmaster.internal/ubuntu plucky/main ppc64el adwaita-icon-theme all 48.0-1 [578 kB]
226s Get:14 http://ftpmaster.internal/ubuntu plucky/main ppc64el at-spi2-common all 2.56.0-2 [9108 B]
226s Get:15 http://ftpmaster.internal/ubuntu plucky/main ppc64el ca-certificates-java all 20240118 [11.6 kB]
226s Get:16 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdconf1 ppc64el 0.40.0-5 [43.7 kB]
226s Get:17 http://ftpmaster.internal/ubuntu plucky/main ppc64el dconf-service ppc64el 0.40.0-5 [30.8 kB]
226s Get:18 http://ftpmaster.internal/ubuntu plucky/main ppc64el dconf-gsettings-backend ppc64el 0.40.0-5 [26.0 kB]
226s Get:19 http://ftpmaster.internal/ubuntu plucky/main ppc64el java-common all 0.76 [6852 B]
226s Get:20 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblcms2-2 ppc64el 2.16-2 [243 kB]
226s Get:21 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpcsclite1 ppc64el 2.3.1-1 [31.4 kB]
226s Get:22 http://ftpmaster.internal/ubuntu plucky/main ppc64el openjdk-21-jre-headless ppc64el 21.0.6+7-1 [45.6 MB]
227s Get:23 http://ftpmaster.internal/ubuntu plucky/main ppc64el default-jre-headless ppc64el 2:1.21-76 [3184 B]
227s Get:24 http://ftpmaster.internal/ubuntu plucky/main ppc64el libatk1.0-0t64 ppc64el 2.56.0-2 [59.9 kB]
227s Get:25 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxi6 ppc64el 2:1.8.2-1 [37.9 kB]
227s Get:26 http://ftpmaster.internal/ubuntu plucky/main ppc64el libatspi2.0-0t64 ppc64el 2.56.0-2 [101 kB]
227s Get:27 http://ftpmaster.internal/ubuntu plucky/main ppc64el libatk-bridge2.0-0t64 ppc64el 2.56.0-2 [77.9 kB]
227s Get:28 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-mono all 2.37-8 [502 kB]
228s Get:29 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-core all 2.37-8 [835 kB]
228s Get:30 http://ftpmaster.internal/ubuntu plucky/main ppc64el fontconfig-config ppc64el 2.15.0-2.1ubuntu1 [37.7 kB]
228s Get:31 http://ftpmaster.internal/ubuntu plucky/main ppc64el libfontconfig1 ppc64el 2.15.0-2.1ubuntu1 [188 kB]
228s Get:32 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpixman-1-0 ppc64el 0.44.0-3 [334 kB]
228s Get:33 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-render0 ppc64el 1.17.0-2 [17.2 kB]
228s Get:34 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-shm0 ppc64el 1.17.0-2 [5980 B]
228s Get:35 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxrender1 ppc64el 1:0.9.10-1.1build1 [23.1 kB]
228s Get:36 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcairo2 ppc64el 1.18.4-1 [746 kB]
228s Get:37 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcairo-gobject2 ppc64el 1.18.4-1 [128 kB]
228s Get:38 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcolord2 ppc64el 1.4.7-3 [162 kB]
228s Get:39 http://ftpmaster.internal/ubuntu plucky/main ppc64el libavahi-common-data ppc64el 0.8-16ubuntu1 [30.9 kB]
228s Get:40 http://ftpmaster.internal/ubuntu plucky/main ppc64el libavahi-common3 ppc64el 0.8-16ubuntu1 [26.0 kB]
228s Get:41 http://ftpmaster.internal/ubuntu plucky/main ppc64el libavahi-client3 ppc64el 0.8-16ubuntu1 [30.9 kB]
228s Get:42 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcups2t64 ppc64el 2.4.11-0ubuntu2 [347 kB]
228s Get:43 http://ftpmaster.internal/ubuntu plucky/main ppc64el libepoxy0 ppc64el 1.5.10-2 [234 kB]
228s Get:44 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgraphite2-3 ppc64el 1.3.14-2ubuntu1 [84.6 kB]
228s Get:45 http://ftpmaster.internal/ubuntu plucky/main ppc64el libharfbuzz0b ppc64el 10.2.0-1 [598 kB]
228s Get:46 http://ftpmaster.internal/ubuntu plucky/main ppc64el fontconfig ppc64el 2.15.0-2.1ubuntu1 [192 kB]
228s Get:47 http://ftpmaster.internal/ubuntu plucky/main ppc64el libthai-data all 0.1.29-2build1 [158 kB]
228s Get:48 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdatrie1 ppc64el 0.2.13-3build1 [22.7 kB]
228s Get:49 http://ftpmaster.internal/ubuntu plucky/main ppc64el libthai0 ppc64el 0.1.29-2build1 [21.8 kB]
228s Get:50 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpango-1.0-0 ppc64el 1.56.2-1 [278 kB]
228s Get:51 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpangoft2-1.0-0 ppc64el 1.56.2-1 [58.6 kB]
228s Get:52 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpangocairo-1.0-0 ppc64el 1.56.2-1 [30.7 kB]
228s Get:53 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwayland-client0 ppc64el 1.23.1-3 [31.7 kB]
228s Get:54 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwayland-cursor0 ppc64el 1.23.1-3 [12.0 kB]
228s Get:55 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwayland-egl1 ppc64el 1.23.1-3 [6236 B]
228s Get:56 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcomposite1 ppc64el 1:0.4.6-1 [6816 B]
228s Get:57 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxfixes3 ppc64el 1:6.0.0-2build1 [11.8 kB]
228s Get:58 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcursor1 ppc64el 1:1.2.3-1 [27.4 kB]
228s Get:59 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxdamage1 ppc64el 1:1.1.6-1build1 [6550 B]
228s Get:60 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxinerama1 ppc64el 2:1.1.4-3build1 [6908 B]
228s Get:61 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxrandr2 ppc64el 2:1.5.4-1 [21.7 kB]
228s Get:62 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgtk-3-common all 3.24.48-3ubuntu1 [1424 kB]
228s Get:63 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgtk-3-0t64 ppc64el 3.24.48-3ubuntu1 [3380 kB]
228s Get:64 http://ftpmaster.internal/ubuntu plucky/main ppc64el libglvnd0 ppc64el 1.7.0-1build1 [72.4 kB]
228s Get:65 http://ftpmaster.internal/ubuntu plucky/main ppc64el libx11-xcb1 ppc64el 2:1.8.10-2 [8008 B]
228s Get:66 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-dri3-0 ppc64el 1.17.0-2 [7842 B]
228s Get:67 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-glx0 ppc64el 1.17.0-2 [26.3 kB]
228s Get:68 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-present0 ppc64el 1.17.0-2 [6276 B]
228s Get:69 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-xfixes0 ppc64el 1.17.0-2 [10.7 kB]
228s Get:70 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxxf86vm1 ppc64el 1:1.1.4-1build4 [11.1 kB]
228s Get:71 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-randr0 ppc64el 1.17.0-2 [19.1 kB]
228s Get:72 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-sync1 ppc64el 1.17.0-2 [9804 B]
228s Get:73 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxshmfence1 ppc64el 1.3-1build5 [4964 B]
228s Get:74 http://ftpmaster.internal/ubuntu plucky/main ppc64el mesa-libgallium ppc64el 25.0.1-2ubuntu1 [9547 kB]
229s Get:75 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwayland-server0 ppc64el 1.23.1-3 [42.4 kB]
229s Get:76 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgbm1 ppc64el 25.0.1-2ubuntu1 [39.1 kB]
229s Get:77 http://ftpmaster.internal/ubuntu plucky/main ppc64el libvulkan1 ppc64el 1.4.304.0-1 [163 kB]
229s Get:78 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgl1-mesa-dri ppc64el 25.0.1-2ubuntu1 [35.1 kB]
229s Get:79 http://ftpmaster.internal/ubuntu plucky/main ppc64el libglx-mesa0 ppc64el 25.0.1-2ubuntu1 [175 kB]
229s Get:80 http://ftpmaster.internal/ubuntu plucky/main ppc64el libglx0 ppc64el 1.7.0-1build1 [42.7 kB]
229s Get:81 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgl1 ppc64el 1.7.0-1build1 [107 kB]
229s Get:82 http://ftpmaster.internal/ubuntu plucky/main ppc64el libasound2-data all 1.2.13-1build1 [21.1 kB]
229s Get:83 http://ftpmaster.internal/ubuntu plucky/main ppc64el libasound2t64 ppc64el 1.2.13-1build1 [496 kB]
229s Get:84 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgif7 ppc64el 5.2.2-1ubuntu2 [40.7 kB]
229s Get:85 http://ftpmaster.internal/ubuntu plucky/main ppc64el x11-common all 1:7.7+23ubuntu3 [21.7 kB]
229s Get:86 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxtst6 ppc64el 2:1.2.5-1 [14.7 kB]
229s Get:87 http://ftpmaster.internal/ubuntu plucky/main ppc64el openjdk-21-jre ppc64el 21.0.6+7-1 [246 kB]
229s Get:88 http://ftpmaster.internal/ubuntu plucky/main ppc64el default-jre ppc64el 2:1.21-76 [918 B]
229s Get:89 http://ftpmaster.internal/ubuntu plucky/main ppc64el libaom3 ppc64el 3.12.0-1 [2940 kB]
229s Get:90 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif-plugin-aomdec ppc64el 1.19.7-1 [11.6 kB]
229s Get:91 http://ftpmaster.internal/ubuntu plucky/main ppc64el libde265-0 ppc64el 1.0.15-1build5 [288 kB]
229s Get:92 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif-plugin-libde265 ppc64el 1.19.7-1 [9178 B]
229s Get:93 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif1 ppc64el 1.19.7-1 [462 kB]
229s Get:94 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgomp1 ppc64el 15-20250222-0ubuntu1 [168 kB]
229s Get:95 http://ftpmaster.internal/ubuntu plucky/main ppc64el libimagequant0 ppc64el 2.18.0-1build1 [43.2 kB]
229s Get:96 http://ftpmaster.internal/ubuntu plucky/main ppc64el libraqm0 ppc64el 0.10.2-1 [19.2 kB]
229s Get:97 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxpm4 ppc64el 1:3.5.17-1build2 [49.9 kB]
229s Get:98 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgd3 ppc64el 2.3.3-12ubuntu3 [165 kB]
229s Get:99 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libhpdf-2.3.0 ppc64el 2.3.0+dfsg-1build3 [460 kB]
229s Get:100 http://ftpmaster.internal/ubuntu plucky/main ppc64el mysql-common all 5.8+1.1.1ubuntu1 [6922 B]
229s Get:101 http://ftpmaster.internal/ubuntu plucky/main ppc64el libmysqlclient21 ppc64el 8.0.40-1 [1294 kB]
229s Get:102 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpq5 ppc64el 17.4-1 [174 kB]
230s Get:103 http://ftpmaster.internal/ubuntu plucky/universe ppc64el emboss-lib ppc64el 6.6.0+dfsg-12ubuntu2 [3460 kB]
230s Get:104 http://ftpmaster.internal/ubuntu plucky/universe ppc64el emboss-data all 6.6.0+dfsg-12ubuntu2 [61.0 MB]
235s Get:105 http://ftpmaster.internal/ubuntu plucky/universe ppc64el emboss ppc64el 6.6.0+dfsg-12ubuntu2 [1041 kB]
235s Get:106 http://ftpmaster.internal/ubuntu plucky/universe ppc64el emboss-doc all 6.6.0+dfsg-12ubuntu2 [2782 kB]
235s Get:107 http://ftpmaster.internal/ubuntu plucky/universe ppc64el emboss-test all 6.6.0+dfsg-12ubuntu2 [4801 kB]
235s Get:108 http://ftpmaster.internal/ubuntu plucky/universe ppc64el jemboss all 6.6.0+dfsg-12ubuntu2 [3751 kB]
236s Fetched 153 MB in 11s (14.2 MB/s)
236s Selecting previously unselected package libgdk-pixbuf2.0-common.
236s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 75154 files and directories currently installed.)
236s Preparing to unpack .../000-libgdk-pixbuf2.0-common_2.42.12+dfsg-2_all.deb ...
236s Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-2) ...
236s Selecting previously unselected package libjpeg-turbo8:ppc64el.
236s Preparing to unpack .../001-libjpeg-turbo8_2.1.5-3ubuntu2_ppc64el.deb ...
236s Unpacking libjpeg-turbo8:ppc64el (2.1.5-3ubuntu2) ...
236s Selecting previously unselected package libjpeg8:ppc64el.
236s Preparing to unpack .../002-libjpeg8_8c-2ubuntu11_ppc64el.deb ...
236s Unpacking libjpeg8:ppc64el (8c-2ubuntu11) ...
236s Selecting previously unselected package libdeflate0:ppc64el.
236s Preparing to unpack .../003-libdeflate0_1.23-1_ppc64el.deb ...
236s Unpacking libdeflate0:ppc64el (1.23-1) ...
236s Selecting previously unselected package libjbig0:ppc64el.
236s Preparing to unpack .../004-libjbig0_2.1-6.1ubuntu2_ppc64el.deb ...
236s Unpacking libjbig0:ppc64el (2.1-6.1ubuntu2) ...
236s Selecting previously unselected package liblerc4:ppc64el.
237s Preparing to unpack .../005-liblerc4_4.0.0+ds-5ubuntu1_ppc64el.deb ...
237s Unpacking liblerc4:ppc64el (4.0.0+ds-5ubuntu1) ...
237s Selecting previously unselected package libsharpyuv0:ppc64el.
237s Preparing to unpack .../006-libsharpyuv0_1.5.0-0.1_ppc64el.deb ...
237s Unpacking libsharpyuv0:ppc64el (1.5.0-0.1) ...
237s Selecting previously unselected package libwebp7:ppc64el.
237s Preparing to unpack .../007-libwebp7_1.5.0-0.1_ppc64el.deb ...
237s Unpacking libwebp7:ppc64el (1.5.0-0.1) ...
237s Selecting previously unselected package libtiff6:ppc64el.
237s Preparing to unpack .../008-libtiff6_4.5.1+git230720-4ubuntu4_ppc64el.deb ...
237s Unpacking libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ...
237s Selecting previously unselected package libgdk-pixbuf-2.0-0:ppc64el.
237s Preparing to unpack .../009-libgdk-pixbuf-2.0-0_2.42.12+dfsg-2_ppc64el.deb ...
237s Unpacking libgdk-pixbuf-2.0-0:ppc64el (2.42.12+dfsg-2) ...
237s Selecting previously unselected package gtk-update-icon-cache.
237s Preparing to unpack .../010-gtk-update-icon-cache_4.17.5+ds-3ubuntu1_ppc64el.deb ...
237s No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed.
237s No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed.
237s Unpacking gtk-update-icon-cache (4.17.5+ds-3ubuntu1) ...
237s Selecting previously unselected package hicolor-icon-theme.
237s Preparing to unpack .../011-hicolor-icon-theme_0.18-2_all.deb ...
237s Unpacking hicolor-icon-theme (0.18-2) ...
237s Selecting previously unselected package adwaita-icon-theme.
237s Preparing to unpack .../012-adwaita-icon-theme_48.0-1_all.deb ...
237s Unpacking adwaita-icon-theme (48.0-1) ...
237s Selecting previously unselected package at-spi2-common.
237s Preparing to unpack .../013-at-spi2-common_2.56.0-2_all.deb ...
237s Unpacking at-spi2-common (2.56.0-2) ...
237s Selecting previously unselected package ca-certificates-java.
237s Preparing to unpack .../014-ca-certificates-java_20240118_all.deb ...
237s Unpacking ca-certificates-java (20240118) ...
237s Selecting previously unselected package libdconf1:ppc64el.
237s Preparing to unpack .../015-libdconf1_0.40.0-5_ppc64el.deb ...
237s Unpacking libdconf1:ppc64el (0.40.0-5) ...
237s Selecting previously unselected package dconf-service.
237s Preparing to unpack .../016-dconf-service_0.40.0-5_ppc64el.deb ...
237s Unpacking dconf-service (0.40.0-5) ...
237s Selecting previously unselected package dconf-gsettings-backend:ppc64el.
237s Preparing to unpack .../017-dconf-gsettings-backend_0.40.0-5_ppc64el.deb ...
237s Unpacking dconf-gsettings-backend:ppc64el (0.40.0-5) ...
237s Selecting previously unselected package java-common.
237s Preparing to unpack .../018-java-common_0.76_all.deb ...
237s Unpacking java-common (0.76) ...
237s Selecting previously unselected package liblcms2-2:ppc64el.
237s Preparing to unpack .../019-liblcms2-2_2.16-2_ppc64el.deb ...
237s Unpacking liblcms2-2:ppc64el (2.16-2) ...
237s Selecting previously unselected package libpcsclite1:ppc64el.
237s Preparing to unpack .../020-libpcsclite1_2.3.1-1_ppc64el.deb ...
237s Unpacking libpcsclite1:ppc64el (2.3.1-1) ...
237s Selecting previously unselected package openjdk-21-jre-headless:ppc64el.
237s Preparing to unpack .../021-openjdk-21-jre-headless_21.0.6+7-1_ppc64el.deb ...
237s Unpacking openjdk-21-jre-headless:ppc64el (21.0.6+7-1) ...
238s Selecting previously unselected package default-jre-headless.
238s Preparing to unpack .../022-default-jre-headless_2%3a1.21-76_ppc64el.deb ...
238s Unpacking default-jre-headless (2:1.21-76) ...
238s Selecting previously unselected package libatk1.0-0t64:ppc64el.
238s Preparing to unpack .../023-libatk1.0-0t64_2.56.0-2_ppc64el.deb ...
238s Unpacking libatk1.0-0t64:ppc64el (2.56.0-2) ...
238s Selecting previously unselected package libxi6:ppc64el.
238s Preparing to unpack .../024-libxi6_2%3a1.8.2-1_ppc64el.deb ...
238s Unpacking libxi6:ppc64el (2:1.8.2-1) ...
238s Selecting previously unselected package libatspi2.0-0t64:ppc64el.
238s Preparing to unpack .../025-libatspi2.0-0t64_2.56.0-2_ppc64el.deb ...
238s Unpacking libatspi2.0-0t64:ppc64el (2.56.0-2) ...
238s Selecting previously unselected package libatk-bridge2.0-0t64:ppc64el.
238s Preparing to unpack .../026-libatk-bridge2.0-0t64_2.56.0-2_ppc64el.deb ...
238s Unpacking libatk-bridge2.0-0t64:ppc64el (2.56.0-2) ...
238s Selecting previously unselected package fonts-dejavu-mono.
238s Preparing to unpack .../027-fonts-dejavu-mono_2.37-8_all.deb ...
238s Unpacking fonts-dejavu-mono (2.37-8) ...
238s Selecting previously unselected package fonts-dejavu-core.
238s Preparing to unpack .../028-fonts-dejavu-core_2.37-8_all.deb ...
238s Unpacking fonts-dejavu-core (2.37-8) ...
238s Selecting previously unselected package fontconfig-config.
238s Preparing to unpack .../029-fontconfig-config_2.15.0-2.1ubuntu1_ppc64el.deb ...
238s Unpacking fontconfig-config (2.15.0-2.1ubuntu1) ...
238s Selecting previously unselected package libfontconfig1:ppc64el.
238s Preparing to unpack .../030-libfontconfig1_2.15.0-2.1ubuntu1_ppc64el.deb ...
238s Unpacking libfontconfig1:ppc64el (2.15.0-2.1ubuntu1) ...
238s Selecting previously unselected package libpixman-1-0:ppc64el.
238s Preparing to unpack .../031-libpixman-1-0_0.44.0-3_ppc64el.deb ...
238s Unpacking libpixman-1-0:ppc64el (0.44.0-3) ...
238s Selecting previously unselected package libxcb-render0:ppc64el.
238s Preparing to unpack .../032-libxcb-render0_1.17.0-2_ppc64el.deb ...
238s Unpacking libxcb-render0:ppc64el (1.17.0-2) ...
238s Selecting previously unselected package libxcb-shm0:ppc64el.
238s Preparing to unpack .../033-libxcb-shm0_1.17.0-2_ppc64el.deb ...
238s Unpacking libxcb-shm0:ppc64el (1.17.0-2) ...
238s Selecting previously unselected package libxrender1:ppc64el.
238s Preparing to unpack .../034-libxrender1_1%3a0.9.10-1.1build1_ppc64el.deb ...
238s Unpacking libxrender1:ppc64el (1:0.9.10-1.1build1) ...
238s Selecting previously unselected package libcairo2:ppc64el.
238s Preparing to unpack .../035-libcairo2_1.18.4-1_ppc64el.deb ...
238s Unpacking libcairo2:ppc64el (1.18.4-1) ...
238s Selecting previously unselected package libcairo-gobject2:ppc64el.
238s Preparing to unpack .../036-libcairo-gobject2_1.18.4-1_ppc64el.deb ...
238s Unpacking libcairo-gobject2:ppc64el (1.18.4-1) ...
238s Selecting previously unselected package libcolord2:ppc64el.
238s Preparing to unpack .../037-libcolord2_1.4.7-3_ppc64el.deb ...
238s Unpacking libcolord2:ppc64el (1.4.7-3) ...
238s Selecting previously unselected package libavahi-common-data:ppc64el.
238s Preparing to unpack .../038-libavahi-common-data_0.8-16ubuntu1_ppc64el.deb ...
238s Unpacking libavahi-common-data:ppc64el (0.8-16ubuntu1) ...
238s Selecting previously unselected package libavahi-common3:ppc64el.
238s Preparing to unpack .../039-libavahi-common3_0.8-16ubuntu1_ppc64el.deb ...
238s Unpacking libavahi-common3:ppc64el (0.8-16ubuntu1) ...
238s Selecting previously unselected package libavahi-client3:ppc64el.
238s Preparing to unpack .../040-libavahi-client3_0.8-16ubuntu1_ppc64el.deb ...
238s Unpacking libavahi-client3:ppc64el (0.8-16ubuntu1) ...
238s Selecting previously unselected package libcups2t64:ppc64el.
238s Preparing to unpack .../041-libcups2t64_2.4.11-0ubuntu2_ppc64el.deb ...
238s Unpacking libcups2t64:ppc64el (2.4.11-0ubuntu2) ...
238s Selecting previously unselected package libepoxy0:ppc64el.
238s Preparing to unpack .../042-libepoxy0_1.5.10-2_ppc64el.deb ...
238s Unpacking libepoxy0:ppc64el (1.5.10-2) ...
238s Selecting previously unselected package libgraphite2-3:ppc64el.
238s Preparing to unpack .../043-libgraphite2-3_1.3.14-2ubuntu1_ppc64el.deb ...
238s Unpacking libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ...
238s Selecting previously unselected package libharfbuzz0b:ppc64el.
238s Preparing to unpack .../044-libharfbuzz0b_10.2.0-1_ppc64el.deb ...
238s Unpacking libharfbuzz0b:ppc64el (10.2.0-1) ...
238s Selecting previously unselected package fontconfig.
238s Preparing to unpack .../045-fontconfig_2.15.0-2.1ubuntu1_ppc64el.deb ...
238s Unpacking fontconfig (2.15.0-2.1ubuntu1) ...
238s Selecting previously unselected package libthai-data.
238s Preparing to unpack .../046-libthai-data_0.1.29-2build1_all.deb ...
238s Unpacking libthai-data (0.1.29-2build1) ...
238s Selecting previously unselected package libdatrie1:ppc64el.
238s Preparing to unpack .../047-libdatrie1_0.2.13-3build1_ppc64el.deb ...
238s Unpacking libdatrie1:ppc64el (0.2.13-3build1) ...
238s Selecting previously unselected package libthai0:ppc64el.
238s Preparing to unpack .../048-libthai0_0.1.29-2build1_ppc64el.deb ...
238s Unpacking libthai0:ppc64el (0.1.29-2build1) ...
238s Selecting previously unselected package libpango-1.0-0:ppc64el.
238s Preparing to unpack .../049-libpango-1.0-0_1.56.2-1_ppc64el.deb ...
238s Unpacking libpango-1.0-0:ppc64el (1.56.2-1) ...
238s Selecting previously unselected package libpangoft2-1.0-0:ppc64el.
238s Preparing to unpack .../050-libpangoft2-1.0-0_1.56.2-1_ppc64el.deb ...
238s Unpacking libpangoft2-1.0-0:ppc64el (1.56.2-1) ...
239s Selecting previously unselected package libpangocairo-1.0-0:ppc64el.
239s Preparing to unpack .../051-libpangocairo-1.0-0_1.56.2-1_ppc64el.deb ...
239s Unpacking libpangocairo-1.0-0:ppc64el (1.56.2-1) ...
239s Selecting previously unselected package libwayland-client0:ppc64el.
239s Preparing to unpack .../052-libwayland-client0_1.23.1-3_ppc64el.deb ...
239s Unpacking libwayland-client0:ppc64el (1.23.1-3) ...
239s Selecting previously unselected package libwayland-cursor0:ppc64el.
239s Preparing to unpack .../053-libwayland-cursor0_1.23.1-3_ppc64el.deb ...
239s Unpacking libwayland-cursor0:ppc64el (1.23.1-3) ...
239s Selecting previously unselected package libwayland-egl1:ppc64el.
239s Preparing to unpack .../054-libwayland-egl1_1.23.1-3_ppc64el.deb ...
239s Unpacking libwayland-egl1:ppc64el (1.23.1-3) ...
239s Selecting previously unselected package libxcomposite1:ppc64el.
239s Preparing to unpack .../055-libxcomposite1_1%3a0.4.6-1_ppc64el.deb ...
239s Unpacking libxcomposite1:ppc64el (1:0.4.6-1) ...
239s Selecting previously unselected package libxfixes3:ppc64el.
239s Preparing to unpack .../056-libxfixes3_1%3a6.0.0-2build1_ppc64el.deb ...
239s Unpacking libxfixes3:ppc64el (1:6.0.0-2build1) ...
239s Selecting previously unselected package libxcursor1:ppc64el.
239s Preparing to unpack .../057-libxcursor1_1%3a1.2.3-1_ppc64el.deb ...
239s Unpacking libxcursor1:ppc64el (1:1.2.3-1) ...
239s Selecting previously unselected package libxdamage1:ppc64el.
239s Preparing to unpack .../058-libxdamage1_1%3a1.1.6-1build1_ppc64el.deb ...
239s Unpacking libxdamage1:ppc64el (1:1.1.6-1build1) ...
239s Selecting previously unselected package libxinerama1:ppc64el.
239s Preparing to unpack .../059-libxinerama1_2%3a1.1.4-3build1_ppc64el.deb ...
239s Unpacking libxinerama1:ppc64el (2:1.1.4-3build1) ...
239s Selecting previously unselected package libxrandr2:ppc64el.
239s Preparing to unpack .../060-libxrandr2_2%3a1.5.4-1_ppc64el.deb ...
239s Unpacking libxrandr2:ppc64el (2:1.5.4-1) ...
239s Selecting previously unselected package libgtk-3-common.
239s Preparing to unpack .../061-libgtk-3-common_3.24.48-3ubuntu1_all.deb ...
239s Unpacking libgtk-3-common (3.24.48-3ubuntu1) ...
239s Selecting previously unselected package libgtk-3-0t64:ppc64el.
239s Preparing to unpack .../062-libgtk-3-0t64_3.24.48-3ubuntu1_ppc64el.deb ...
239s Unpacking libgtk-3-0t64:ppc64el (3.24.48-3ubuntu1) ...
239s Selecting previously unselected package libglvnd0:ppc64el.
239s Preparing to unpack .../063-libglvnd0_1.7.0-1build1_ppc64el.deb ...
239s Unpacking libglvnd0:ppc64el (1.7.0-1build1) ...
239s Selecting previously unselected package libx11-xcb1:ppc64el.
239s Preparing to unpack .../064-libx11-xcb1_2%3a1.8.10-2_ppc64el.deb ...
239s Unpacking libx11-xcb1:ppc64el (2:1.8.10-2) ...
239s Selecting previously unselected package libxcb-dri3-0:ppc64el.
239s Preparing to unpack .../065-libxcb-dri3-0_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-dri3-0:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxcb-glx0:ppc64el.
239s Preparing to unpack .../066-libxcb-glx0_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-glx0:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxcb-present0:ppc64el.
239s Preparing to unpack .../067-libxcb-present0_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-present0:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxcb-xfixes0:ppc64el.
239s Preparing to unpack .../068-libxcb-xfixes0_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-xfixes0:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxxf86vm1:ppc64el.
239s Preparing to unpack .../069-libxxf86vm1_1%3a1.1.4-1build4_ppc64el.deb ...
239s Unpacking libxxf86vm1:ppc64el (1:1.1.4-1build4) ...
239s Selecting previously unselected package libxcb-randr0:ppc64el.
239s Preparing to unpack .../070-libxcb-randr0_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-randr0:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxcb-sync1:ppc64el.
239s Preparing to unpack .../071-libxcb-sync1_1.17.0-2_ppc64el.deb ...
239s Unpacking libxcb-sync1:ppc64el (1.17.0-2) ...
239s Selecting previously unselected package libxshmfence1:ppc64el.
239s Preparing to unpack .../072-libxshmfence1_1.3-1build5_ppc64el.deb ...
239s Unpacking libxshmfence1:ppc64el (1.3-1build5) ...
239s Selecting previously unselected package mesa-libgallium:ppc64el.
239s Preparing to unpack .../073-mesa-libgallium_25.0.1-2ubuntu1_ppc64el.deb ...
239s Unpacking mesa-libgallium:ppc64el (25.0.1-2ubuntu1) ...
239s Selecting previously unselected package libwayland-server0:ppc64el.
239s Preparing to unpack .../074-libwayland-server0_1.23.1-3_ppc64el.deb ...
239s Unpacking libwayland-server0:ppc64el (1.23.1-3) ...
239s Selecting previously unselected package libgbm1:ppc64el.
239s Preparing to unpack .../075-libgbm1_25.0.1-2ubuntu1_ppc64el.deb ...
239s Unpacking libgbm1:ppc64el (25.0.1-2ubuntu1) ...
239s Selecting previously unselected package libvulkan1:ppc64el.
239s Preparing to unpack .../076-libvulkan1_1.4.304.0-1_ppc64el.deb ...
239s Unpacking libvulkan1:ppc64el (1.4.304.0-1) ...
239s Selecting previously unselected package libgl1-mesa-dri:ppc64el.
239s Preparing to unpack .../077-libgl1-mesa-dri_25.0.1-2ubuntu1_ppc64el.deb ...
239s Unpacking libgl1-mesa-dri:ppc64el (25.0.1-2ubuntu1) ...
239s Selecting previously unselected package libglx-mesa0:ppc64el.
239s Preparing to unpack .../078-libglx-mesa0_25.0.1-2ubuntu1_ppc64el.deb ...
239s Unpacking libglx-mesa0:ppc64el (25.0.1-2ubuntu1) ...
239s Selecting previously unselected package libglx0:ppc64el.
239s Preparing to unpack .../079-libglx0_1.7.0-1build1_ppc64el.deb ...
239s Unpacking libglx0:ppc64el (1.7.0-1build1) ...
239s Selecting previously unselected package libgl1:ppc64el.
239s Preparing to unpack .../080-libgl1_1.7.0-1build1_ppc64el.deb ...
239s Unpacking libgl1:ppc64el (1.7.0-1build1) ...
239s Selecting previously unselected package libasound2-data.
239s Preparing to unpack .../081-libasound2-data_1.2.13-1build1_all.deb ...
239s Unpacking libasound2-data (1.2.13-1build1) ...
239s Selecting previously unselected package libasound2t64:ppc64el.
239s Preparing to unpack .../082-libasound2t64_1.2.13-1build1_ppc64el.deb ...
239s Unpacking libasound2t64:ppc64el (1.2.13-1build1) ...
239s Selecting previously unselected package libgif7:ppc64el.
239s Preparing to unpack .../083-libgif7_5.2.2-1ubuntu2_ppc64el.deb ...
239s Unpacking libgif7:ppc64el (5.2.2-1ubuntu2) ...
239s Selecting previously unselected package x11-common.
239s Preparing to unpack .../084-x11-common_1%3a7.7+23ubuntu3_all.deb ...
239s Unpacking x11-common (1:7.7+23ubuntu3) ...
239s Selecting previously unselected package libxtst6:ppc64el.
239s Preparing to unpack .../085-libxtst6_2%3a1.2.5-1_ppc64el.deb ...
239s Unpacking libxtst6:ppc64el (2:1.2.5-1) ...
239s Selecting previously unselected package openjdk-21-jre:ppc64el.
239s Preparing to unpack .../086-openjdk-21-jre_21.0.6+7-1_ppc64el.deb ...
239s Unpacking openjdk-21-jre:ppc64el (21.0.6+7-1) ...
239s Selecting previously unselected package default-jre.
239s Preparing to unpack .../087-default-jre_2%3a1.21-76_ppc64el.deb ...
239s Unpacking default-jre (2:1.21-76) ...
239s Selecting previously unselected package libaom3:ppc64el.
239s Preparing to unpack .../088-libaom3_3.12.0-1_ppc64el.deb ...
239s Unpacking libaom3:ppc64el (3.12.0-1) ...
239s Selecting previously unselected package libheif-plugin-aomdec:ppc64el.
239s Preparing to unpack .../089-libheif-plugin-aomdec_1.19.7-1_ppc64el.deb ...
239s Unpacking libheif-plugin-aomdec:ppc64el (1.19.7-1) ...
239s Selecting previously unselected package libde265-0:ppc64el.
239s Preparing to unpack .../090-libde265-0_1.0.15-1build5_ppc64el.deb ...
239s Unpacking libde265-0:ppc64el (1.0.15-1build5) ...
240s Selecting previously unselected package libheif-plugin-libde265:ppc64el.
240s Preparing to unpack .../091-libheif-plugin-libde265_1.19.7-1_ppc64el.deb ...
240s Unpacking libheif-plugin-libde265:ppc64el (1.19.7-1) ...
240s Selecting previously unselected package libheif1:ppc64el.
240s Preparing to unpack .../092-libheif1_1.19.7-1_ppc64el.deb ...
240s Unpacking libheif1:ppc64el (1.19.7-1) ...
240s Selecting previously unselected package libgomp1:ppc64el.
240s Preparing to unpack .../093-libgomp1_15-20250222-0ubuntu1_ppc64el.deb ...
240s Unpacking libgomp1:ppc64el (15-20250222-0ubuntu1) ...
240s Selecting previously unselected package libimagequant0:ppc64el.
240s Preparing to unpack .../094-libimagequant0_2.18.0-1build1_ppc64el.deb ...
240s Unpacking libimagequant0:ppc64el (2.18.0-1build1) ...
240s Selecting previously unselected package libraqm0:ppc64el.
240s Preparing to unpack .../095-libraqm0_0.10.2-1_ppc64el.deb ...
240s Unpacking libraqm0:ppc64el (0.10.2-1) ...
240s Selecting previously unselected package libxpm4:ppc64el.
240s Preparing to unpack .../096-libxpm4_1%3a3.5.17-1build2_ppc64el.deb ...
240s Unpacking libxpm4:ppc64el (1:3.5.17-1build2) ...
240s Selecting previously unselected package libgd3:ppc64el.
240s Preparing to unpack .../097-libgd3_2.3.3-12ubuntu3_ppc64el.deb ...
240s Unpacking libgd3:ppc64el (2.3.3-12ubuntu3) ...
240s Selecting previously unselected package libhpdf-2.3.0:ppc64el.
240s Preparing to unpack .../098-libhpdf-2.3.0_2.3.0+dfsg-1build3_ppc64el.deb ...
240s Unpacking libhpdf-2.3.0:ppc64el (2.3.0+dfsg-1build3) ...
240s Selecting previously unselected package mysql-common.
240s Preparing to unpack .../099-mysql-common_5.8+1.1.1ubuntu1_all.deb ...
240s Unpacking mysql-common (5.8+1.1.1ubuntu1) ...
240s Selecting previously unselected package libmysqlclient21:ppc64el.
240s Preparing to unpack .../100-libmysqlclient21_8.0.40-1_ppc64el.deb ...
240s Unpacking libmysqlclient21:ppc64el (8.0.40-1) ...
240s Selecting previously unselected package libpq5:ppc64el.
240s Preparing to unpack .../101-libpq5_17.4-1_ppc64el.deb ...
240s Unpacking libpq5:ppc64el (17.4-1) ...
240s Selecting previously unselected package emboss-lib.
240s Preparing to unpack .../102-emboss-lib_6.6.0+dfsg-12ubuntu2_ppc64el.deb ...
240s Unpacking emboss-lib (6.6.0+dfsg-12ubuntu2) ...
240s Selecting previously unselected package emboss-data.
240s Preparing to unpack .../103-emboss-data_6.6.0+dfsg-12ubuntu2_all.deb ...
240s Unpacking emboss-data (6.6.0+dfsg-12ubuntu2) ...
244s Selecting previously unselected package emboss.
244s Preparing to unpack .../104-emboss_6.6.0+dfsg-12ubuntu2_ppc64el.deb ...
244s Unpacking emboss (6.6.0+dfsg-12ubuntu2) ...
244s Selecting previously unselected package emboss-doc.
244s Preparing to unpack .../105-emboss-doc_6.6.0+dfsg-12ubuntu2_all.deb ...
244s Unpacking emboss-doc (6.6.0+dfsg-12ubuntu2) ...
244s Selecting previously unselected package emboss-test.
244s Preparing to unpack .../106-emboss-test_6.6.0+dfsg-12ubuntu2_all.deb ...
244s Unpacking emboss-test (6.6.0+dfsg-12ubuntu2) ...
244s Selecting previously unselected package jemboss.
244s Preparing to unpack .../107-jemboss_6.6.0+dfsg-12ubuntu2_all.deb ...
244s Unpacking jemboss (6.6.0+dfsg-12ubuntu2) ...
245s Setting up libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ...
245s Setting up libxcb-dri3-0:ppc64el (1.17.0-2) ...
245s Setting up liblcms2-2:ppc64el (2.16-2) ...
245s Setting up libpixman-1-0:ppc64el (0.44.0-3) ...
245s Setting up libsharpyuv0:ppc64el (1.5.0-0.1) ...
245s Setting up libwayland-server0:ppc64el (1.23.1-3) ...
245s Setting up libaom3:ppc64el (3.12.0-1) ...
245s Setting up libx11-xcb1:ppc64el (2:1.8.10-2) ...
245s Setting up mysql-common (5.8+1.1.1ubuntu1) ...
245s update-alternatives: using /etc/mysql/my.cnf.fallback to provide /etc/mysql/my.cnf (my.cnf) in auto mode
245s Setting up libmysqlclient21:ppc64el (8.0.40-1) ...
245s Setting up libhpdf-2.3.0:ppc64el (2.3.0+dfsg-1build3) ...
245s Setting up libxdamage1:ppc64el (1:1.1.6-1build1) ...
245s Setting up libxcb-xfixes0:ppc64el (1.17.0-2) ...
245s Setting up liblerc4:ppc64el (4.0.0+ds-5ubuntu1) ...
245s Setting up libxpm4:ppc64el (1:3.5.17-1build2) ...
245s Setting up hicolor-icon-theme (0.18-2) ...
245s Setting up libxi6:ppc64el (2:1.8.2-1) ...
245s Setting up java-common (0.76) ...
245s Setting up libxrender1:ppc64el (1:0.9.10-1.1build1) ...
245s Setting up libdatrie1:ppc64el (0.2.13-3build1) ...
245s Setting up libxcb-render0:ppc64el (1.17.0-2) ...
245s Setting up libglvnd0:ppc64el (1.7.0-1build1) ...
245s Setting up libxcb-glx0:ppc64el (1.17.0-2) ...
245s Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-2) ...
245s Setting up x11-common (1:7.7+23ubuntu3) ...
245s Setting up libpq5:ppc64el (17.4-1) ...
245s Setting up libdeflate0:ppc64el (1.23-1) ...
245s Setting up libxcb-shm0:ppc64el (1.17.0-2) ...
245s Setting up libgomp1:ppc64el (15-20250222-0ubuntu1) ...
245s Setting up emboss-data (6.6.0+dfsg-12ubuntu2) ...
245s Setting up libjbig0:ppc64el (2.1-6.1ubuntu2) ...
245s Setting up libcolord2:ppc64el (1.4.7-3) ...
245s Setting up libxxf86vm1:ppc64el (1:1.1.4-1build4) ...
245s Setting up emboss-doc (6.6.0+dfsg-12ubuntu2) ...
245s Setting up libxcb-present0:ppc64el (1.17.0-2) ...
245s Setting up libdconf1:ppc64el (0.40.0-5) ...
245s Setting up libasound2-data (1.2.13-1build1) ...
245s Setting up libasound2t64:ppc64el (1.2.13-1build1) ...
245s Setting up libepoxy0:ppc64el (1.5.10-2) ...
245s Setting up libxfixes3:ppc64el (1:6.0.0-2build1) ...
245s Setting up libxcb-sync1:ppc64el (1.17.0-2) ...
245s Setting up libavahi-common-data:ppc64el (0.8-16ubuntu1) ...
245s Setting up libatspi2.0-0t64:ppc64el (2.56.0-2) ...
245s Setting up libxinerama1:ppc64el (2:1.1.4-3build1) ...
245s Setting up libimagequant0:ppc64el (2.18.0-1build1) ...
245s Setting up fonts-dejavu-mono (2.37-8) ...
245s Setting up libxrandr2:ppc64el (2:1.5.4-1) ...
245s Setting up fonts-dejavu-core (2.37-8) ...
245s Setting up libpcsclite1:ppc64el (2.3.1-1) ...
245s Setting up emboss-test (6.6.0+dfsg-12ubuntu2) ...
245s Setting up libjpeg-turbo8:ppc64el (2.1.5-3ubuntu2) ...
245s Setting up libvulkan1:ppc64el (1.4.304.0-1) ...
245s Setting up libwebp7:ppc64el (1.5.0-0.1) ...
245s Setting up libgif7:ppc64el (5.2.2-1ubuntu2) ...
245s Setting up libxshmfence1:ppc64el (1.3-1build5) ...
245s Setting up at-spi2-common (2.56.0-2) ...
245s Setting up libxcb-randr0:ppc64el (1.17.0-2) ...
245s Setting up libharfbuzz0b:ppc64el (10.2.0-1) ...
245s Setting up libthai-data (0.1.29-2build1) ...
245s Setting up libwayland-egl1:ppc64el (1.23.1-3) ...
245s Setting up ca-certificates-java (20240118) ...
245s No JRE found. Skipping Java certificates setup.
245s Setting up libde265-0:ppc64el (1.0.15-1build5) ...
245s Setting up libxcomposite1:ppc64el (1:0.4.6-1) ...
245s Setting up libwayland-client0:ppc64el (1.23.1-3) ...
245s Setting up libjpeg8:ppc64el (8c-2ubuntu11) ...
245s Setting up mesa-libgallium:ppc64el (25.0.1-2ubuntu1) ...
245s Setting up libatk1.0-0t64:ppc64el (2.56.0-2) ...
245s Setting up openjdk-21-jre-headless:ppc64el (21.0.6+7-1) ...
245s update-alternatives: using /usr/lib/jvm/java-21-openjdk-ppc64el/bin/java to provide /usr/bin/java (java) in auto mode
245s update-alternatives: using /usr/lib/jvm/java-21-openjdk-ppc64el/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode
245s update-alternatives: using /usr/lib/jvm/java-21-openjdk-ppc64el/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode
245s update-alternatives: using /usr/lib/jvm/java-21-openjdk-ppc64el/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode
245s update-alternatives: using /usr/lib/jvm/java-21-openjdk-ppc64el/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode
245s Setting up libgbm1:ppc64el (25.0.1-2ubuntu1) ...
245s Setting up fontconfig-config (2.15.0-2.1ubuntu1) ...
245s Setting up libxtst6:ppc64el (2:1.2.5-1) ...
245s Setting up libxcursor1:ppc64el (1:1.2.3-1) ...
245s Setting up libgl1-mesa-dri:ppc64el (25.0.1-2ubuntu1) ...
245s Setting up libavahi-common3:ppc64el (0.8-16ubuntu1) ...
245s Setting up dconf-service (0.40.0-5) ...
245s Setting up libthai0:ppc64el (0.1.29-2build1) ...
245s Setting up libraqm0:ppc64el (0.10.2-1) ...
245s Setting up libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ...
245s Setting up libwayland-cursor0:ppc64el (1.23.1-3) ...
245s Setting up libgdk-pixbuf-2.0-0:ppc64el (2.42.12+dfsg-2) ...
245s Setting up libfontconfig1:ppc64el (2.15.0-2.1ubuntu1) ...
245s Setting up libavahi-client3:ppc64el (0.8-16ubuntu1) ...
245s Setting up libatk-bridge2.0-0t64:ppc64el (2.56.0-2) ...
245s Setting up gtk-update-icon-cache (4.17.5+ds-3ubuntu1) ...
245s Setting up fontconfig (2.15.0-2.1ubuntu1) ...
247s Regenerating fonts cache... done.
247s Setting up libglx-mesa0:ppc64el (25.0.1-2ubuntu1) ...
247s Setting up libglx0:ppc64el (1.7.0-1build1) ...
247s Setting up dconf-gsettings-backend:ppc64el (0.40.0-5) ...
247s Setting up libpango-1.0-0:ppc64el (1.56.2-1) ...
247s Setting up libcairo2:ppc64el (1.18.4-1) ...
247s Setting up libgl1:ppc64el (1.7.0-1build1) ...
247s Setting up adwaita-icon-theme (48.0-1) ...
248s update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode
248s Setting up libcairo-gobject2:ppc64el (1.18.4-1) ...
248s Setting up libpangoft2-1.0-0:ppc64el (1.56.2-1) ...
248s Setting up libcups2t64:ppc64el (2.4.11-0ubuntu2) ...
248s Setting up libgtk-3-common (3.24.48-3ubuntu1) ...
248s Setting up libpangocairo-1.0-0:ppc64el (1.56.2-1) ...
248s Setting up libheif-plugin-aomdec:ppc64el (1.19.7-1) ...
248s Setting up libheif-plugin-libde265:ppc64el (1.19.7-1) ...
248s Setting up libheif1:ppc64el (1.19.7-1) ...
248s Setting up libgd3:ppc64el (2.3.3-12ubuntu3) ...
248s Setting up emboss-lib (6.6.0+dfsg-12ubuntu2) ...
248s Setting up emboss (6.6.0+dfsg-12ubuntu2) ...
248s Processing triggers for libc-bin (2.41-1ubuntu1) ...
248s Processing triggers for man-db (2.13.0-1) ...
249s Processing triggers for libglib2.0-0t64:ppc64el (2.84.0-1) ...
249s Setting up libgtk-3-0t64:ppc64el (3.24.48-3ubuntu1) ...
249s Processing triggers for shared-mime-info (2.4-5) ...
249s Warning: program compiled against libxml 212 using older 209
250s Processing triggers for ca-certificates-java (20240118) ...
250s Adding debian:ACCVRAIZ1.pem
250s Adding debian:AC_RAIZ_FNMT-RCM.pem
250s Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem
250s Adding debian:ANF_Secure_Server_Root_CA.pem
250s Adding debian:Actalis_Authentication_Root_CA.pem
250s Adding debian:AffirmTrust_Commercial.pem
250s Adding debian:AffirmTrust_Networking.pem
250s Adding debian:AffirmTrust_Premium.pem
250s Adding debian:AffirmTrust_Premium_ECC.pem
250s Adding debian:Amazon_Root_CA_1.pem
250s Adding debian:Amazon_Root_CA_2.pem
250s Adding debian:Amazon_Root_CA_3.pem
250s Adding debian:Amazon_Root_CA_4.pem
250s Adding debian:Atos_TrustedRoot_2011.pem
250s Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem
250s Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem
250s Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem
250s Adding debian:BJCA_Global_Root_CA1.pem
250s Adding debian:BJCA_Global_Root_CA2.pem
250s Adding debian:Baltimore_CyberTrust_Root.pem
250s Adding debian:Buypass_Class_2_Root_CA.pem
250s Adding debian:Buypass_Class_3_Root_CA.pem
250s Adding debian:CA_Disig_Root_R2.pem
250s Adding debian:CFCA_EV_ROOT.pem
250s Adding debian:COMODO_Certification_Authority.pem
250s Adding debian:COMODO_ECC_Certification_Authority.pem
250s Adding debian:COMODO_RSA_Certification_Authority.pem
250s Adding debian:Certainly_Root_E1.pem
250s Adding debian:Certainly_Root_R1.pem
250s Adding debian:Certigna.pem
250s Adding debian:Certigna_Root_CA.pem
250s Adding debian:Certum_EC-384_CA.pem
250s Adding debian:Certum_Trusted_Network_CA.pem
250s Adding debian:Certum_Trusted_Network_CA_2.pem
250s Adding debian:Certum_Trusted_Root_CA.pem
250s Adding debian:CommScope_Public_Trust_ECC_Root-01.pem
250s Adding debian:CommScope_Public_Trust_ECC_Root-02.pem
250s Adding debian:CommScope_Public_Trust_RSA_Root-01.pem
250s Adding debian:CommScope_Public_Trust_RSA_Root-02.pem
250s Adding debian:Comodo_AAA_Services_root.pem
250s Adding debian:D-TRUST_BR_Root_CA_1_2020.pem
250s Adding debian:D-TRUST_EV_Root_CA_1_2020.pem
250s Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem
250s Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem
250s Adding debian:DigiCert_Assured_ID_Root_CA.pem
250s Adding debian:DigiCert_Assured_ID_Root_G2.pem
250s Adding debian:DigiCert_Assured_ID_Root_G3.pem
250s Adding debian:DigiCert_Global_Root_CA.pem
250s Adding debian:DigiCert_Global_Root_G2.pem
250s Adding debian:DigiCert_Global_Root_G3.pem
250s Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem
250s Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem
250s Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem
250s Adding debian:DigiCert_Trusted_Root_G4.pem
250s Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem
250s Adding debian:Entrust_Root_Certification_Authority.pem
250s Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem
250s Adding debian:Entrust_Root_Certification_Authority_-_G2.pem
250s Adding debian:Entrust_Root_Certification_Authority_-_G4.pem
250s Adding debian:FIRMAPROFESIONAL_CA_ROOT-A_WEB.pem
250s Adding debian:GDCA_TrustAUTH_R5_ROOT.pem
250s Adding debian:GLOBALTRUST_2020.pem
250s Adding debian:GTS_Root_R1.pem
250s Adding debian:GTS_Root_R2.pem
250s Adding debian:GTS_Root_R3.pem
250s Adding debian:GTS_Root_R4.pem
250s Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem
250s Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem
250s Adding debian:GlobalSign_Root_CA.pem
250s Adding debian:GlobalSign_Root_CA_-_R3.pem
250s Adding debian:GlobalSign_Root_CA_-_R6.pem
250s Adding debian:GlobalSign_Root_E46.pem
250s Adding debian:GlobalSign_Root_R46.pem
250s Adding debian:Go_Daddy_Class_2_CA.pem
250s Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem
250s Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem
250s Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem
250s Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem
250s Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem
250s Adding debian:HiPKI_Root_CA_-_G1.pem
250s Adding debian:Hongkong_Post_Root_CA_3.pem
250s Adding debian:ISRG_Root_X1.pem
250s Adding debian:ISRG_Root_X2.pem
250s Adding debian:IdenTrust_Commercial_Root_CA_1.pem
250s Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem
250s Adding debian:Izenpe.com.pem
250s Adding debian:Microsec_e-Szigno_Root_CA_2009.pem
250s Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem
250s Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem
250s Adding debian:NAVER_Global_Root_Certification_Authority.pem
250s Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem
250s Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem
250s Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem
250s Adding debian:QuoVadis_Root_CA_1_G3.pem
250s Adding debian:QuoVadis_Root_CA_2.pem
250s Adding debian:QuoVadis_Root_CA_2_G3.pem
250s Adding debian:QuoVadis_Root_CA_3.pem
250s Adding debian:QuoVadis_Root_CA_3_G3.pem
250s Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem
250s Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem
250s Adding debian:SSL.com_Root_Certification_Authority_ECC.pem
250s Adding debian:SSL.com_Root_Certification_Authority_RSA.pem
250s Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem
250s Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem
250s Adding debian:SZAFIR_ROOT_CA2.pem
250s Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem
250s Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem
250s Adding debian:SecureSign_RootCA11.pem
250s Adding debian:SecureSign_Root_CA12.pem
250s Adding debian:SecureSign_Root_CA14.pem
250s Adding debian:SecureSign_Root_CA15.pem
250s Adding debian:SecureTrust_CA.pem
250s Adding debian:Secure_Global_CA.pem
250s Adding debian:Security_Communication_ECC_RootCA1.pem
250s Adding debian:Security_Communication_RootCA2.pem
250s Adding debian:Security_Communication_RootCA3.pem
250s Adding debian:Starfield_Class_2_CA.pem
250s Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem
250s Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem
250s Adding debian:SwissSign_Gold_CA_-_G2.pem
250s Adding debian:SwissSign_Silver_CA_-_G2.pem
250s Adding debian:T-TeleSec_GlobalRoot_Class_2.pem
250s Adding debian:T-TeleSec_GlobalRoot_Class_3.pem
250s Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem
250s Adding debian:TWCA_CYBER_Root_CA.pem
250s Adding debian:TWCA_Global_Root_CA.pem
250s Adding debian:TWCA_Root_Certification_Authority.pem
250s Adding debian:Telekom_Security_TLS_ECC_Root_2020.pem
250s Adding debian:Telekom_Security_TLS_RSA_Root_2023.pem
250s Adding debian:TeliaSonera_Root_CA_v1.pem
250s Adding debian:Telia_Root_CA_v2.pem
250s Adding debian:TrustAsia_Global_Root_CA_G3.pem
250s Adding debian:TrustAsia_Global_Root_CA_G4.pem
250s Adding debian:Trustwave_Global_Certification_Authority.pem
250s Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem
250s Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem
250s Adding debian:TunTrust_Root_CA.pem
250s Adding debian:UCA_Extended_Validation_Root.pem
250s Adding debian:UCA_Global_G2_Root.pem
250s Adding debian:USERTrust_ECC_Certification_Authority.pem
250s Adding debian:USERTrust_RSA_Certification_Authority.pem
250s Adding debian:XRamp_Global_CA_Root.pem
250s Adding debian:certSIGN_ROOT_CA.pem
250s Adding debian:certSIGN_Root_CA_G2.pem
250s Adding debian:e-Szigno_Root_CA_2017.pem
250s Adding debian:ePKI_Root_Certification_Authority.pem
250s Adding debian:emSign_ECC_Root_CA_-_C3.pem
250s Adding debian:emSign_ECC_Root_CA_-_G3.pem
250s Adding debian:emSign_Root_CA_-_C1.pem
250s Adding debian:emSign_Root_CA_-_G1.pem
250s Adding debian:vTrus_ECC_Root_CA.pem
250s Adding debian:vTrus_Root_CA.pem
250s done.
250s Setting up openjdk-21-jre:ppc64el (21.0.6+7-1) ...
250s Setting up default-jre-headless (2:1.21-76) ...
250s Setting up default-jre (2:1.21-76) ...
250s Setting up jemboss (6.6.0+dfsg-12ubuntu2) ...
250s Processing triggers for libc-bin (2.41-1ubuntu1) ...
253s autopkgtest [13:53:34]: test run-unit-test: [-----------------------
253s >ACGTseq SI000001 Simple 60-base sequence for testing USAs
253s AAAAACCCCCGGGGTTTTAAACCCGGTTACTGCCAATTTGGGCCCCAAAATTTTTGGGGG
253s >TCGAseq SI000002 Simple 60-base sequence for testing USAs
253s TTTTTCCCCCGGGGAAAATTTCCCGGAATCAGCCTTAAAGGGCCCCTTTTAAAAAGGGGG
253s >TGACseq SI000003 Simple 60-base sequence for testing USAs
253s TTTTTGGGGGAAAACCCCTTTGGGAACCTGCAGGTTCCCAAAGGGGTTTTCCCCCAAAAA
253s >AGTCseq SI000004 Simple 60-base sequence for testing USAs
253s AAAAAGGGGGTTTTCCCCAAAGGGTTCCAGCTGGAACCCTTTGGGGAAAACCCCCTTTTT
253s Read and write (return) sequences
253s PASS
254s autopkgtest [13:53:35]: test run-unit-test: -----------------------]
254s autopkgtest [13:53:35]: test run-unit-test:  - - - - - - - - - - results - - - - - - - - - -
254s run-unit-test        PASS
255s autopkgtest [13:53:36]: @@@@@@@@@@@@@@@@@@@@ summary
255s run-unit-test        PASS
273s nova [W] Using flock in prodstack6-ppc64el
273s Creating nova instance adt-plucky-ppc64el-emboss-20250317-133208-juju-7f2275-prod-proposed-migration-environment-2-df000645-f292-42d8-bbed-e9fd4912e8c6 from image adt/ubuntu-plucky-ppc64el-server-20250317.img (UUID c1d02fec-ea8c-451a-a91a-0102b60da108)...
273s nova [W] Timed out waiting for bebb4236-c6f8-4c02-bf91-2b3b35b0e69e to get deleted.