0s autopkgtest [10:22:58]: starting date and time: 2024-11-13 10:22:58+0000 0s autopkgtest [10:22:58]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 0s autopkgtest [10:22:58]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.xyurjc0j/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade abpoa --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest-ppc64el --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-ppc64el-23.secgroup --name adt-plucky-ppc64el-abpoa-20241113-100519-juju-7f2275-prod-proposed-migration-environment-2-6dec0d3f-95f1-47e9-b3f1-e0fc68b9df1b --image adt/ubuntu-plucky-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration-ppc64el -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 131s autopkgtest [10:25:09]: testbed dpkg architecture: ppc64el 132s autopkgtest [10:25:10]: testbed apt version: 2.9.8 132s autopkgtest [10:25:10]: @@@@@@@@@@@@@@@@@@@@ test bed setup 133s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 133s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 133s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 134s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 134s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 134s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el Packages [86.2 kB] 134s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el Packages [588 kB] 134s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el Packages [19.6 kB] 134s Fetched 1715 kB in 1s (1460 kB/s) 134s Reading package lists... 137s Reading package lists... 137s Building dependency tree... 137s Reading state information... 138s Calculating upgrade... 138s The following NEW packages will be installed: 138s python3.13-gdbm 138s The following packages will be upgraded: 138s libpython3-stdlib python3 python3-gdbm python3-minimal 138s 4 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 138s Need to get 102 kB of archives. 138s After this operation, 141 kB of additional disk space will be used. 138s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-minimal ppc64el 3.12.7-1 [27.4 kB] 138s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3 ppc64el 3.12.7-1 [24.0 kB] 138s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el libpython3-stdlib ppc64el 3.12.7-1 [10.0 kB] 138s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-gdbm ppc64el 3.13.0-2 [31.5 kB] 138s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-gdbm ppc64el 3.12.7-1 [8640 B] 139s Fetched 102 kB in 0s (298 kB/s) 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 139s Preparing to unpack .../python3-minimal_3.12.7-1_ppc64el.deb ... 139s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 139s Setting up python3-minimal (3.12.7-1) ... 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 139s Preparing to unpack .../python3_3.12.7-1_ppc64el.deb ... 139s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 139s Preparing to unpack .../libpython3-stdlib_3.12.7-1_ppc64el.deb ... 139s Unpacking libpython3-stdlib:ppc64el (3.12.7-1) over (3.12.6-0ubuntu1) ... 139s Selecting previously unselected package python3.13-gdbm. 139s Preparing to unpack .../python3.13-gdbm_3.13.0-2_ppc64el.deb ... 139s Unpacking python3.13-gdbm (3.13.0-2) ... 140s Preparing to unpack .../python3-gdbm_3.12.7-1_ppc64el.deb ... 140s Unpacking python3-gdbm:ppc64el (3.12.7-1) over (3.12.6-1ubuntu1) ... 140s Setting up python3.13-gdbm (3.13.0-2) ... 140s Setting up libpython3-stdlib:ppc64el (3.12.7-1) ... 140s Setting up python3 (3.12.7-1) ... 140s Setting up python3-gdbm:ppc64el (3.12.7-1) ... 140s Processing triggers for man-db (2.12.1-3) ... 141s Reading package lists... 141s Building dependency tree... 141s Reading state information... 141s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 142s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 142s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 142s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 142s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 143s Reading package lists... 143s Reading package lists... 143s Building dependency tree... 143s Reading state information... 144s Calculating upgrade... 144s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 144s Reading package lists... 145s Building dependency tree... 145s Reading state information... 145s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 149s autopkgtest [10:25:27]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP Mon Sep 16 13:49:23 UTC 2024 149s autopkgtest [10:25:27]: @@@@@@@@@@@@@@@@@@@@ apt-source abpoa 151s Get:1 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (dsc) [2276 B] 151s Get:2 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (tar) [163 kB] 151s Get:3 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (diff) [9836 B] 151s gpgv: Signature made Wed Sep 25 19:10:18 2024 UTC 151s gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA 151s gpgv: issuer "emollier@debian.org" 151s gpgv: Can't check signature: No public key 151s dpkg-source: warning: cannot verify inline signature for ./abpoa_1.5.3-1.dsc: no acceptable signature found 151s autopkgtest [10:25:29]: testing package abpoa version 1.5.3-1 153s autopkgtest [10:25:31]: build not needed 154s autopkgtest [10:25:32]: test run-unit-test: preparing testbed 156s Reading package lists... 156s Building dependency tree... 156s Reading state information... 157s Starting pkgProblemResolver with broken count: 0 157s Starting 2 pkgProblemResolver with broken count: 0 157s Done 157s The following additional packages will be installed: 157s abpoa fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono 157s graphviz libann0 libaom3 libcairo2 libcdt5 libcgraph6 libdatrie1 libde265-0 157s libdeflate0 libfontconfig1 libgd3 libgomp1 libgraphite2-3 libgts-0.7-5t64 157s libgvc6 libgvpr2 libharfbuzz0b libheif-plugin-aomdec libheif-plugin-libde265 157s libheif1 libice6 libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 157s liblab-gamut1 liblerc4 libltdl7 libpango-1.0-0 libpangocairo-1.0-0 157s libpangoft2-1.0-0 libpathplan4 libpixman-1-0 libraqm0 libsharpyuv0 libsm6 157s libthai-data libthai0 libtiff6 libwebp7 libxaw7 libxcb-render0 libxcb-shm0 157s libxmu6 libxpm4 libxrender1 libxt6t64 python3-pyabpoa x11-common 157s Suggested packages: 157s gsfonts graphviz-doc libgd-tools libheif-plugin-x265 157s libheif-plugin-ffmpegdec libheif-plugin-jpegdec libheif-plugin-jpegenc 157s libheif-plugin-j2kdec libheif-plugin-j2kenc libheif-plugin-kvazaar 157s libheif-plugin-rav1e libheif-plugin-svtenc 157s Recommended packages: 157s fonts-liberation libgts-bin libheif-plugin-aomenc 158s The following NEW packages will be installed: 158s abpoa autopkgtest-satdep fontconfig fontconfig-config fonts-dejavu-core 158s fonts-dejavu-mono graphviz libann0 libaom3 libcairo2 libcdt5 libcgraph6 158s libdatrie1 libde265-0 libdeflate0 libfontconfig1 libgd3 libgomp1 158s libgraphite2-3 libgts-0.7-5t64 libgvc6 libgvpr2 libharfbuzz0b 158s libheif-plugin-aomdec libheif-plugin-libde265 libheif1 libice6 158s libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 liblab-gamut1 liblerc4 158s libltdl7 libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libpathplan4 158s libpixman-1-0 libraqm0 libsharpyuv0 libsm6 libthai-data libthai0 libtiff6 158s libwebp7 libxaw7 libxcb-render0 libxcb-shm0 libxmu6 libxpm4 libxrender1 158s libxt6t64 python3-pyabpoa x11-common 158s 0 upgraded, 55 newly installed, 0 to remove and 0 not upgraded. 158s Need to get 14.5 MB/14.5 MB of archives. 158s After this operation, 42.7 MB of additional disk space will be used. 158s Get:1 /tmp/autopkgtest.RAs1Wp/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [712 B] 158s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libann0 ppc64el 1.1.2+doc-9build1 [30.1 kB] 158s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libcdt5 ppc64el 2.42.4-2build3 [27.3 kB] 158s Get:4 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libcgraph6 ppc64el 2.42.4-2build3 [53.6 kB] 158s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-mono all 2.37-8 [502 kB] 158s Get:6 http://ftpmaster.internal/ubuntu plucky/main ppc64el fonts-dejavu-core all 2.37-8 [835 kB] 159s Get:7 http://ftpmaster.internal/ubuntu plucky/main ppc64el fontconfig-config ppc64el 2.15.0-1.1ubuntu2 [37.4 kB] 159s Get:8 http://ftpmaster.internal/ubuntu plucky/main ppc64el libfontconfig1 ppc64el 2.15.0-1.1ubuntu2 [190 kB] 159s Get:9 http://ftpmaster.internal/ubuntu plucky/main ppc64el libsharpyuv0 ppc64el 1.4.0-0.1 [22.0 kB] 159s Get:10 http://ftpmaster.internal/ubuntu plucky/main ppc64el libaom3 ppc64el 3.11.0~rc1-1 [3022 kB] 159s Get:11 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif-plugin-aomdec ppc64el 1.18.1-2 [11.2 kB] 159s Get:12 http://ftpmaster.internal/ubuntu plucky/main ppc64el libde265-0 ppc64el 1.0.15-1build4 [284 kB] 159s Get:13 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif-plugin-libde265 ppc64el 1.18.1-2 [9068 B] 159s Get:14 http://ftpmaster.internal/ubuntu plucky/main ppc64el libheif1 ppc64el 1.18.1-2 [340 kB] 160s Get:15 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgomp1 ppc64el 14.2.0-8ubuntu1 [161 kB] 160s Get:16 http://ftpmaster.internal/ubuntu plucky/main ppc64el libimagequant0 ppc64el 2.18.0-1build1 [43.2 kB] 160s Get:17 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg-turbo8 ppc64el 2.1.5-2ubuntu2 [219 kB] 160s Get:18 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjpeg8 ppc64el 8c-2ubuntu11 [2148 B] 160s Get:19 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgraphite2-3 ppc64el 1.3.14-2ubuntu1 [84.6 kB] 160s Get:20 http://ftpmaster.internal/ubuntu plucky/main ppc64el libharfbuzz0b ppc64el 10.0.1-1 [596 kB] 160s Get:21 http://ftpmaster.internal/ubuntu plucky/main ppc64el libraqm0 ppc64el 0.10.1-1build1 [19.4 kB] 160s Get:22 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdeflate0 ppc64el 1.22-1 [63.3 kB] 160s Get:23 http://ftpmaster.internal/ubuntu plucky/main ppc64el libjbig0 ppc64el 2.1-6.1ubuntu2 [35.9 kB] 160s Get:24 http://ftpmaster.internal/ubuntu plucky/main ppc64el liblerc4 ppc64el 4.0.0+ds-4ubuntu2 [270 kB] 160s Get:25 http://ftpmaster.internal/ubuntu plucky/main ppc64el libwebp7 ppc64el 1.4.0-0.1 [309 kB] 160s Get:26 http://ftpmaster.internal/ubuntu plucky/main ppc64el libtiff6 ppc64el 4.5.1+git230720-4ubuntu4 [272 kB] 160s Get:27 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxpm4 ppc64el 1:3.5.17-1build2 [49.9 kB] 160s Get:28 http://ftpmaster.internal/ubuntu plucky/main ppc64el libgd3 ppc64el 2.3.3-12ubuntu3 [165 kB] 160s Get:29 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libgts-0.7-5t64 ppc64el 0.7.6+darcs121130-5.2build1 [187 kB] 160s Get:30 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpixman-1-0 ppc64el 0.44.0-3 [334 kB] 160s Get:31 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-render0 ppc64el 1.17.0-2 [17.2 kB] 160s Get:32 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxcb-shm0 ppc64el 1.17.0-2 [5980 B] 160s Get:33 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxrender1 ppc64el 1:0.9.10-1.1build1 [23.1 kB] 160s Get:34 http://ftpmaster.internal/ubuntu plucky/main ppc64el libcairo2 ppc64el 1.18.2-2 [747 kB] 160s Get:35 http://ftpmaster.internal/ubuntu plucky/main ppc64el libltdl7 ppc64el 2.4.7-7build1 [48.2 kB] 160s Get:36 http://ftpmaster.internal/ubuntu plucky/main ppc64el fontconfig ppc64el 2.15.0-1.1ubuntu2 [192 kB] 160s Get:37 http://ftpmaster.internal/ubuntu plucky/main ppc64el libthai-data all 0.1.29-2build1 [158 kB] 160s Get:38 http://ftpmaster.internal/ubuntu plucky/main ppc64el libdatrie1 ppc64el 0.2.13-3build1 [22.7 kB] 160s Get:39 http://ftpmaster.internal/ubuntu plucky/main ppc64el libthai0 ppc64el 0.1.29-2build1 [21.8 kB] 160s Get:40 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpango-1.0-0 ppc64el 1.54.0+ds-3 [272 kB] 160s Get:41 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpangoft2-1.0-0 ppc64el 1.54.0+ds-3 [57.5 kB] 160s Get:42 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpangocairo-1.0-0 ppc64el 1.54.0+ds-3 [30.6 kB] 160s Get:43 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libpathplan4 ppc64el 2.42.4-2build3 [30.5 kB] 160s Get:44 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libgvc6 ppc64el 2.42.4-2build3 [909 kB] 160s Get:45 http://ftpmaster.internal/ubuntu plucky/universe ppc64el libgvpr2 ppc64el 2.42.4-2build3 [214 kB] 160s Get:46 http://ftpmaster.internal/ubuntu plucky/universe ppc64el liblab-gamut1 ppc64el 2.42.4-2build3 [1832 kB] 160s Get:47 http://ftpmaster.internal/ubuntu plucky/main ppc64el x11-common all 1:7.7+23ubuntu3 [21.7 kB] 160s Get:48 http://ftpmaster.internal/ubuntu plucky/main ppc64el libice6 ppc64el 2:1.1.1-1 [49.9 kB] 160s Get:49 http://ftpmaster.internal/ubuntu plucky/main ppc64el libsm6 ppc64el 2:1.2.4-1 [18.4 kB] 160s Get:50 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxt6t64 ppc64el 1:1.2.1-1.2build1 [202 kB] 161s Get:51 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxmu6 ppc64el 2:1.1.3-3build2 [56.8 kB] 161s Get:52 http://ftpmaster.internal/ubuntu plucky/main ppc64el libxaw7 ppc64el 2:1.0.16-1 [230 kB] 161s Get:53 http://ftpmaster.internal/ubuntu plucky/universe ppc64el graphviz ppc64el 2.42.4-2build3 [828 kB] 161s Get:54 http://ftpmaster.internal/ubuntu plucky/universe ppc64el abpoa ppc64el 1.5.3-1 [117 kB] 161s Get:55 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-pyabpoa ppc64el 1.5.3-1 [196 kB] 161s Fetched 14.5 MB in 3s (4739 kB/s) 161s Selecting previously unselected package libann0. 161s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73774 files and directories currently installed.) 161s Preparing to unpack .../00-libann0_1.1.2+doc-9build1_ppc64el.deb ... 161s Unpacking libann0 (1.1.2+doc-9build1) ... 161s Selecting previously unselected package libcdt5:ppc64el. 161s Preparing to unpack .../01-libcdt5_2.42.4-2build3_ppc64el.deb ... 161s Unpacking libcdt5:ppc64el (2.42.4-2build3) ... 161s Selecting previously unselected package libcgraph6:ppc64el. 161s Preparing to unpack .../02-libcgraph6_2.42.4-2build3_ppc64el.deb ... 161s Unpacking libcgraph6:ppc64el (2.42.4-2build3) ... 161s Selecting previously unselected package fonts-dejavu-mono. 161s Preparing to unpack .../03-fonts-dejavu-mono_2.37-8_all.deb ... 161s Unpacking fonts-dejavu-mono (2.37-8) ... 161s Selecting previously unselected package fonts-dejavu-core. 161s Preparing to unpack .../04-fonts-dejavu-core_2.37-8_all.deb ... 161s Unpacking fonts-dejavu-core (2.37-8) ... 161s Selecting previously unselected package fontconfig-config. 161s Preparing to unpack .../05-fontconfig-config_2.15.0-1.1ubuntu2_ppc64el.deb ... 162s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 162s Selecting previously unselected package libfontconfig1:ppc64el. 162s Preparing to unpack .../06-libfontconfig1_2.15.0-1.1ubuntu2_ppc64el.deb ... 162s Unpacking libfontconfig1:ppc64el (2.15.0-1.1ubuntu2) ... 162s Selecting previously unselected package libsharpyuv0:ppc64el. 162s Preparing to unpack .../07-libsharpyuv0_1.4.0-0.1_ppc64el.deb ... 162s Unpacking libsharpyuv0:ppc64el (1.4.0-0.1) ... 162s Selecting previously unselected package libaom3:ppc64el. 162s Preparing to unpack .../08-libaom3_3.11.0~rc1-1_ppc64el.deb ... 162s Unpacking libaom3:ppc64el (3.11.0~rc1-1) ... 162s Selecting previously unselected package libheif-plugin-aomdec:ppc64el. 162s Preparing to unpack .../09-libheif-plugin-aomdec_1.18.1-2_ppc64el.deb ... 162s Unpacking libheif-plugin-aomdec:ppc64el (1.18.1-2) ... 162s Selecting previously unselected package libde265-0:ppc64el. 162s Preparing to unpack .../10-libde265-0_1.0.15-1build4_ppc64el.deb ... 162s Unpacking libde265-0:ppc64el (1.0.15-1build4) ... 162s Selecting previously unselected package libheif-plugin-libde265:ppc64el. 162s Preparing to unpack .../11-libheif-plugin-libde265_1.18.1-2_ppc64el.deb ... 162s Unpacking libheif-plugin-libde265:ppc64el (1.18.1-2) ... 162s Selecting previously unselected package libheif1:ppc64el. 162s Preparing to unpack .../12-libheif1_1.18.1-2_ppc64el.deb ... 162s Unpacking libheif1:ppc64el (1.18.1-2) ... 162s Selecting previously unselected package libgomp1:ppc64el. 162s Preparing to unpack .../13-libgomp1_14.2.0-8ubuntu1_ppc64el.deb ... 162s Unpacking libgomp1:ppc64el (14.2.0-8ubuntu1) ... 162s Selecting previously unselected package libimagequant0:ppc64el. 162s Preparing to unpack .../14-libimagequant0_2.18.0-1build1_ppc64el.deb ... 162s Unpacking libimagequant0:ppc64el (2.18.0-1build1) ... 162s Selecting previously unselected package libjpeg-turbo8:ppc64el. 162s Preparing to unpack .../15-libjpeg-turbo8_2.1.5-2ubuntu2_ppc64el.deb ... 162s Unpacking libjpeg-turbo8:ppc64el (2.1.5-2ubuntu2) ... 162s Selecting previously unselected package libjpeg8:ppc64el. 162s Preparing to unpack .../16-libjpeg8_8c-2ubuntu11_ppc64el.deb ... 162s Unpacking libjpeg8:ppc64el (8c-2ubuntu11) ... 162s Selecting previously unselected package libgraphite2-3:ppc64el. 162s Preparing to unpack .../17-libgraphite2-3_1.3.14-2ubuntu1_ppc64el.deb ... 162s Unpacking libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ... 162s Selecting previously unselected package libharfbuzz0b:ppc64el. 162s Preparing to unpack .../18-libharfbuzz0b_10.0.1-1_ppc64el.deb ... 162s Unpacking libharfbuzz0b:ppc64el (10.0.1-1) ... 162s Selecting previously unselected package libraqm0:ppc64el. 162s Preparing to unpack .../19-libraqm0_0.10.1-1build1_ppc64el.deb ... 162s Unpacking libraqm0:ppc64el (0.10.1-1build1) ... 162s Selecting previously unselected package libdeflate0:ppc64el. 162s Preparing to unpack .../20-libdeflate0_1.22-1_ppc64el.deb ... 162s Unpacking libdeflate0:ppc64el (1.22-1) ... 162s Selecting previously unselected package libjbig0:ppc64el. 162s Preparing to unpack .../21-libjbig0_2.1-6.1ubuntu2_ppc64el.deb ... 162s Unpacking libjbig0:ppc64el (2.1-6.1ubuntu2) ... 162s Selecting previously unselected package liblerc4:ppc64el. 162s Preparing to unpack .../22-liblerc4_4.0.0+ds-4ubuntu2_ppc64el.deb ... 162s Unpacking liblerc4:ppc64el (4.0.0+ds-4ubuntu2) ... 162s Selecting previously unselected package libwebp7:ppc64el. 162s Preparing to unpack .../23-libwebp7_1.4.0-0.1_ppc64el.deb ... 162s Unpacking libwebp7:ppc64el (1.4.0-0.1) ... 162s Selecting previously unselected package libtiff6:ppc64el. 162s Preparing to unpack .../24-libtiff6_4.5.1+git230720-4ubuntu4_ppc64el.deb ... 162s Unpacking libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ... 162s Selecting previously unselected package libxpm4:ppc64el. 162s Preparing to unpack .../25-libxpm4_1%3a3.5.17-1build2_ppc64el.deb ... 162s Unpacking libxpm4:ppc64el (1:3.5.17-1build2) ... 162s Selecting previously unselected package libgd3:ppc64el. 162s Preparing to unpack .../26-libgd3_2.3.3-12ubuntu3_ppc64el.deb ... 162s Unpacking libgd3:ppc64el (2.3.3-12ubuntu3) ... 162s Selecting previously unselected package libgts-0.7-5t64:ppc64el. 162s Preparing to unpack .../27-libgts-0.7-5t64_0.7.6+darcs121130-5.2build1_ppc64el.deb ... 162s Unpacking libgts-0.7-5t64:ppc64el (0.7.6+darcs121130-5.2build1) ... 163s Selecting previously unselected package libpixman-1-0:ppc64el. 163s Preparing to unpack .../28-libpixman-1-0_0.44.0-3_ppc64el.deb ... 163s Unpacking libpixman-1-0:ppc64el (0.44.0-3) ... 163s Selecting previously unselected package libxcb-render0:ppc64el. 163s Preparing to unpack .../29-libxcb-render0_1.17.0-2_ppc64el.deb ... 163s Unpacking libxcb-render0:ppc64el (1.17.0-2) ... 163s Selecting previously unselected package libxcb-shm0:ppc64el. 163s Preparing to unpack .../30-libxcb-shm0_1.17.0-2_ppc64el.deb ... 163s Unpacking libxcb-shm0:ppc64el (1.17.0-2) ... 163s Selecting previously unselected package libxrender1:ppc64el. 163s Preparing to unpack .../31-libxrender1_1%3a0.9.10-1.1build1_ppc64el.deb ... 163s Unpacking libxrender1:ppc64el (1:0.9.10-1.1build1) ... 163s Selecting previously unselected package libcairo2:ppc64el. 163s Preparing to unpack .../32-libcairo2_1.18.2-2_ppc64el.deb ... 163s Unpacking libcairo2:ppc64el (1.18.2-2) ... 163s Selecting previously unselected package libltdl7:ppc64el. 163s Preparing to unpack .../33-libltdl7_2.4.7-7build1_ppc64el.deb ... 163s Unpacking libltdl7:ppc64el (2.4.7-7build1) ... 163s Selecting previously unselected package fontconfig. 163s Preparing to unpack .../34-fontconfig_2.15.0-1.1ubuntu2_ppc64el.deb ... 163s Unpacking fontconfig (2.15.0-1.1ubuntu2) ... 163s Selecting previously unselected package libthai-data. 163s Preparing to unpack .../35-libthai-data_0.1.29-2build1_all.deb ... 163s Unpacking libthai-data (0.1.29-2build1) ... 163s Selecting previously unselected package libdatrie1:ppc64el. 163s Preparing to unpack .../36-libdatrie1_0.2.13-3build1_ppc64el.deb ... 163s Unpacking libdatrie1:ppc64el (0.2.13-3build1) ... 163s Selecting previously unselected package libthai0:ppc64el. 163s Preparing to unpack .../37-libthai0_0.1.29-2build1_ppc64el.deb ... 163s Unpacking libthai0:ppc64el (0.1.29-2build1) ... 163s Selecting previously unselected package libpango-1.0-0:ppc64el. 163s Preparing to unpack .../38-libpango-1.0-0_1.54.0+ds-3_ppc64el.deb ... 163s Unpacking libpango-1.0-0:ppc64el (1.54.0+ds-3) ... 163s Selecting previously unselected package libpangoft2-1.0-0:ppc64el. 163s Preparing to unpack .../39-libpangoft2-1.0-0_1.54.0+ds-3_ppc64el.deb ... 163s Unpacking libpangoft2-1.0-0:ppc64el (1.54.0+ds-3) ... 163s Selecting previously unselected package libpangocairo-1.0-0:ppc64el. 163s Preparing to unpack .../40-libpangocairo-1.0-0_1.54.0+ds-3_ppc64el.deb ... 163s Unpacking libpangocairo-1.0-0:ppc64el (1.54.0+ds-3) ... 163s Selecting previously unselected package libpathplan4:ppc64el. 163s Preparing to unpack .../41-libpathplan4_2.42.4-2build3_ppc64el.deb ... 163s Unpacking libpathplan4:ppc64el (2.42.4-2build3) ... 163s Selecting previously unselected package libgvc6. 163s Preparing to unpack .../42-libgvc6_2.42.4-2build3_ppc64el.deb ... 163s Unpacking libgvc6 (2.42.4-2build3) ... 163s Selecting previously unselected package libgvpr2:ppc64el. 163s Preparing to unpack .../43-libgvpr2_2.42.4-2build3_ppc64el.deb ... 163s Unpacking libgvpr2:ppc64el (2.42.4-2build3) ... 163s Selecting previously unselected package liblab-gamut1:ppc64el. 163s Preparing to unpack .../44-liblab-gamut1_2.42.4-2build3_ppc64el.deb ... 163s Unpacking liblab-gamut1:ppc64el (2.42.4-2build3) ... 163s Selecting previously unselected package x11-common. 163s Preparing to unpack .../45-x11-common_1%3a7.7+23ubuntu3_all.deb ... 163s Unpacking x11-common (1:7.7+23ubuntu3) ... 163s Selecting previously unselected package libice6:ppc64el. 163s Preparing to unpack .../46-libice6_2%3a1.1.1-1_ppc64el.deb ... 163s Unpacking libice6:ppc64el (2:1.1.1-1) ... 163s Selecting previously unselected package libsm6:ppc64el. 163s Preparing to unpack .../47-libsm6_2%3a1.2.4-1_ppc64el.deb ... 163s Unpacking libsm6:ppc64el (2:1.2.4-1) ... 163s Selecting previously unselected package libxt6t64:ppc64el. 163s Preparing to unpack .../48-libxt6t64_1%3a1.2.1-1.2build1_ppc64el.deb ... 163s Unpacking libxt6t64:ppc64el (1:1.2.1-1.2build1) ... 163s Selecting previously unselected package libxmu6:ppc64el. 163s Preparing to unpack .../49-libxmu6_2%3a1.1.3-3build2_ppc64el.deb ... 163s Unpacking libxmu6:ppc64el (2:1.1.3-3build2) ... 163s Selecting previously unselected package libxaw7:ppc64el. 163s Preparing to unpack .../50-libxaw7_2%3a1.0.16-1_ppc64el.deb ... 163s Unpacking libxaw7:ppc64el (2:1.0.16-1) ... 163s Selecting previously unselected package graphviz. 163s Preparing to unpack .../51-graphviz_2.42.4-2build3_ppc64el.deb ... 163s Unpacking graphviz (2.42.4-2build3) ... 163s Selecting previously unselected package abpoa. 163s Preparing to unpack .../52-abpoa_1.5.3-1_ppc64el.deb ... 163s Unpacking abpoa (1.5.3-1) ... 163s Selecting previously unselected package python3-pyabpoa. 163s Preparing to unpack .../53-python3-pyabpoa_1.5.3-1_ppc64el.deb ... 163s Unpacking python3-pyabpoa (1.5.3-1) ... 163s Selecting previously unselected package autopkgtest-satdep. 163s Preparing to unpack .../54-1-autopkgtest-satdep.deb ... 163s Unpacking autopkgtest-satdep (0) ... 163s Setting up libgraphite2-3:ppc64el (1.3.14-2ubuntu1) ... 163s Setting up libpixman-1-0:ppc64el (0.44.0-3) ... 163s Setting up libsharpyuv0:ppc64el (1.4.0-0.1) ... 163s Setting up libaom3:ppc64el (3.11.0~rc1-1) ... 163s Setting up liblerc4:ppc64el (4.0.0+ds-4ubuntu2) ... 163s Setting up libxpm4:ppc64el (1:3.5.17-1build2) ... 163s Setting up libxrender1:ppc64el (1:0.9.10-1.1build1) ... 163s Setting up libdatrie1:ppc64el (0.2.13-3build1) ... 163s Setting up python3-pyabpoa (1.5.3-1) ... 163s Setting up libxcb-render0:ppc64el (1.17.0-2) ... 163s Setting up liblab-gamut1:ppc64el (2.42.4-2build3) ... 163s Setting up x11-common (1:7.7+23ubuntu3) ... 164s Setting up libdeflate0:ppc64el (1.22-1) ... 164s Setting up libxcb-shm0:ppc64el (1.17.0-2) ... 164s Setting up libgomp1:ppc64el (14.2.0-8ubuntu1) ... 164s Setting up libjbig0:ppc64el (2.1-6.1ubuntu2) ... 164s Setting up libpathplan4:ppc64el (2.42.4-2build3) ... 164s Setting up libann0 (1.1.2+doc-9build1) ... 164s Setting up libimagequant0:ppc64el (2.18.0-1build1) ... 164s Setting up fonts-dejavu-mono (2.37-8) ... 164s Setting up fonts-dejavu-core (2.37-8) ... 164s Setting up libjpeg-turbo8:ppc64el (2.1.5-2ubuntu2) ... 164s Setting up libltdl7:ppc64el (2.4.7-7build1) ... 164s Setting up libwebp7:ppc64el (1.4.0-0.1) ... 164s Setting up libharfbuzz0b:ppc64el (10.0.1-1) ... 164s Setting up libthai-data (0.1.29-2build1) ... 164s Setting up libgts-0.7-5t64:ppc64el (0.7.6+darcs121130-5.2build1) ... 164s Setting up libcdt5:ppc64el (2.42.4-2build3) ... 164s Setting up libcgraph6:ppc64el (2.42.4-2build3) ... 164s Setting up libde265-0:ppc64el (1.0.15-1build4) ... 164s Setting up libjpeg8:ppc64el (8c-2ubuntu11) ... 164s Setting up libice6:ppc64el (2:1.1.1-1) ... 164s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 164s Setting up libthai0:ppc64el (0.1.29-2build1) ... 164s Setting up libraqm0:ppc64el (0.10.1-1build1) ... 164s Setting up libgvpr2:ppc64el (2.42.4-2build3) ... 164s Setting up libtiff6:ppc64el (4.5.1+git230720-4ubuntu4) ... 164s Setting up libfontconfig1:ppc64el (2.15.0-1.1ubuntu2) ... 164s Setting up libsm6:ppc64el (2:1.2.4-1) ... 164s Setting up fontconfig (2.15.0-1.1ubuntu2) ... 166s Regenerating fonts cache... done. 166s Setting up libpango-1.0-0:ppc64el (1.54.0+ds-3) ... 166s Setting up libcairo2:ppc64el (1.18.2-2) ... 166s Setting up libxt6t64:ppc64el (1:1.2.1-1.2build1) ... 166s Setting up libpangoft2-1.0-0:ppc64el (1.54.0+ds-3) ... 166s Setting up libpangocairo-1.0-0:ppc64el (1.54.0+ds-3) ... 166s Setting up libxmu6:ppc64el (2:1.1.3-3build2) ... 166s Setting up libxaw7:ppc64el (2:1.0.16-1) ... 166s Setting up libheif-plugin-aomdec:ppc64el (1.18.1-2) ... 166s Setting up libheif-plugin-libde265:ppc64el (1.18.1-2) ... 166s Setting up libheif1:ppc64el (1.18.1-2) ... 166s Setting up libgd3:ppc64el (2.3.3-12ubuntu3) ... 166s Setting up libgvc6 (2.42.4-2build3) ... 166s Setting up graphviz (2.42.4-2build3) ... 166s Setting up abpoa (1.5.3-1) ... 166s Setting up autopkgtest-satdep (0) ... 166s Processing triggers for libc-bin (2.40-1ubuntu3) ... 166s Processing triggers for man-db (2.12.1-3) ... 171s (Reading database ... 74356 files and directories currently installed.) 171s Removing autopkgtest-satdep (0) ... 172s autopkgtest [10:25:50]: test run-unit-test: [----------------------- 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' avx2 = dispatch ']' 172s + '[' avx2 = generic ']' 172s + grep -q avx2 /proc/cpuinfo 172s + continue 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' avx = dispatch ']' 172s + '[' avx = generic ']' 172s + grep -q avx /proc/cpuinfo 172s + continue 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' sse4.1 = dispatch ']' 172s + '[' sse4.1 = generic ']' 172s + grep -q sse4.1 /proc/cpuinfo 172s + continue 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' ssse3 = dispatch ']' 172s + '[' ssse3 = generic ']' 172s + grep -q ssse3 /proc/cpuinfo 172s + continue 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' sse3 = dispatch ']' 172s + '[' sse3 = generic ']' 172s + grep -q sse3 /proc/cpuinfo 172s + continue 172s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 172s + '[' generic = dispatch ']' 172s + '[' generic = generic ']' 172s + command -v abpoa.generic 172s + BINARY=abpoa.generic 172s + abpoa.generic --version 172s 1.5.3 172s + abpoa.generic --help 172s 172s abpoa: adaptive banded Partial Order Alignment 172s 172s Version: 1.5.3 Contact: yangao@ds.dfci.harvard.edu 172s 172s Usage: abpoa [options] > cons.fa/msa.fa/abpoa.gfa 172s 172s Options: 172s Alignment: 172s -m --aln-mode INT alignment mode [0] 172s 0: global, 1: local, 2: extension 172s -M --match INT match score [2] 172s -X --mismatch INT mismatch penalty [4] 172s -t --matrix FILE scoring matrix file, '-M' and '-X' are not used when '-t' is used [Null] 172s e.g., 'HOXD70.mtx, BLOSUM62.mtx' 172s -O --gap-open INT(,INT) gap opening penalty (O1,O2) [4,24] 172s -E --gap-ext INT(,INT) gap extension penalty (E1,E2) [2,1] 172s abPOA provides three gap penalty modes, cost of a g-long gap: 172s - convex (default): min{O1+g*E1, O2+g*E2} 172s - affine (set O2 as 0): O1+g*E1 172s - linear (set O1 as 0): g*E1 172s -s --amb-strand ambiguous strand mode [False] 172s for each input sequence, try the reverse complement if the current 172s alignment score is too low, and pick the strand with a higher score 172s Adaptive banded DP: 172s -b --extra-b INT first adaptive banding parameter [10] 172s set b as < 0 to disable adaptive banded DP 172s -f --extra-f FLOAT second adaptive banding parameter [0.01] 172s the number of extra bases added on both sites of the band is 172s b+f*L, where L is the length of the aligned sequence 172s Minimizer-based seeding and partition (only effective in global alignment mode): 172s -S --seeding enable minimizer-based seeding and anchoring [False] 172s -k --k-mer INT minimizer k-mer size [19] 172s -w --window INT minimizer window size [10] 172s -n --min-poa-win INT min. size of window to perform POA [500] 172s -p --progressive build guide tree and perform progressive partial order alignment [False] 172s Input/Output: 172s -Q --use-qual-weight take base quality score from FASTQ input file as graph edge weight for consensus calling [False] 172s effective only when input sequences are in FASTQ format and consensus calling with heaviest bundling 172s -c --amino-acid input sequences are amino acid (default is nucleotide) [False] 172s -l --in-list input file is a list of sequence file names [False] 172s each line is one sequence file containing a set of sequences 172s which will be aligned by abPOA to generate a consensus sequence 172s -i --incrmnt FILE incrementally align sequences to an existing graph/MSA [Null] 172s graph could be in GFA or MSA format generated by abPOA 172s -o --output FILE output to FILE [stdout] 172s -r --result INT output result mode [0] 172s - 0: consensus in FASTA format 172s - 1: MSA in PIR format 172s - 2: both 0 & 1 172s - 3: graph in GFA format 172s - 4: graph with consensus path in GFA format 172s - 5: consensus in FASTQ format 172s -a --cons-algrm INT consensus algorithm [0] 172s - 0: heaviest bundling path in partial order graph 172s - 1: most frequent bases at each position 172s -d --maxnum-cons INT max. number of consensus sequence to generate [1] 172s -q --min-freq FLOAT min. frequency of each consensus sequence (only effective when -d/--num-cons > 1) [0.25] 172s -g --out-pog FILE dump final alignment graph to FILE (.pdf/.png) [Null] 172s 172s -h --help print this help usage information 172s -v --version show version number 172s -V --verbose INT verbose level (0-2). 0: none, 1: information, 2: debug [0] 172s 172s + test 1 = 1 172s + abpoa.generic ./test_data/seq.fa 172s [main] CMD: abpoa.generic ./test_data/seq.fa 172s [abpoa_main] Real time: 0.000 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - cons.fa 172s + abpoa.generic ./test_data/heter.fa 172s [main] CMD: abpoa.generic ./test_data/heter.fa 172s [abpoa_main] Real time: 0.009 sec; CPU: 0.009 sec; Peak RSS: 0.009 GB. 172s + abpoa.generic -r1 ./test_data/seq.fa 172s [main] CMD: abpoa.generic -r1 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.000 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - out.msa 172s + abpoa.generic -r2 ./test_data/seq.fa 172s [main] CMD: abpoa.generic -r2 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.000 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - out_cons.msa 172s + abpoa.generic -r3 ./test_data/seq.fa 172s [main] CMD: abpoa.generic -r3 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.000 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - out.gfa 172s + abpoa.generic -r4 ./test_data/seq.fa 172s [main] CMD: abpoa.generic -r4 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.000 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - out4.gfa 172s + cp out.gfa in.gfa 172s + cp out.msa in.msa 172s + abpoa.generic -i in.gfa ./test_data/seq.fa -r3 172s [main] CMD: abpoa.generic -i in.gfa -r3 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.001 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 172s + diff - out.gfa 172s + abpoa.generic -i in.msa ./test_data/seq.fa -r1 172s [main] CMD: abpoa.generic -i in.msa -r1 ./test_data/seq.fa 172s [abpoa_main] Real time: 0.001 sec; CPU: 0.002 sec; Peak RSS: 0.002 GB. 172s + diff - out.msa 172s + abpoa.generic ./test_data/seq.fa -g poa.png 172s [main] CMD: abpoa.generic -g poa.png ./test_data/seq.fa 173s [abpoa_main] Real time: 0.533 sec; CPU: 0.001 sec; Peak RSS: 0.002 GB. 173s + diff - cons.fa 173s + abpoa.generic ./test_data/heter.fa -d2 173s [main] CMD: abpoa.generic -d2 ./test_data/heter.fa 173s [abpoa_main] Real time: 0.010 sec; CPU: 0.010 sec; Peak RSS: 0.009 GB.>Consensus_sequence_1 0,2,3,4,10,13,14 173s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 173s >Consensus_sequence_2 1,5,6,7,8,9,11,12 173s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCATCCCCACCGCCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 173s 173s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 173s + '[' dispatch = dispatch ']' 173s + BINARY=abpoa 173s + abpoa --version 173s 1.5.3 173s + abpoa --help 173s 173s abpoa: adaptive banded Partial Order Alignment 173s 173s Version: 1.5.3 Contact: yangao@ds.dfci.harvard.edu 173s 173s Usage: abpoa [options] > cons.fa/msa.fa/abpoa.gfa 173s 173s Options: 173s Alignment: 173s -m --aln-mode INT alignment mode [0] 173s 0: global, 1: local, 2: extension 173s -M --match INT match score [2] 173s -X --mismatch INT mismatch penalty [4] 173s -t --matrix FILE scoring matrix file, '-M' and '-X' are not used when '-t' is used [Null] 173s e.g., 'HOXD70.mtx, BLOSUM62.mtx' 173s -O --gap-open INT(,INT) gap opening penalty (O1,O2) [4,24] 173s -E --gap-ext INT(,INT) gap extension penalty (E1,E2) [2,1] 173s abPOA provides three gap penalty modes, cost of a g-long gap: 173s - convex (default): min{O1+g*E1, O2+g*E2} 173s - affine (set O2 as 0): O1+g*E1 173s - linear (set O1 as 0): g*E1 173s -s --amb-strand ambiguous strand mode [False] 173s for each input sequence, try the reverse complement if the current 173s alignment score is too low, and pick the strand with a higher score 173s Adaptive banded DP: 173s -b --extra-b INT first adaptive banding parameter [10] 173s set b as < 0 to disable adaptive banded DP 173s -f --extra-f FLOAT second adaptive banding parameter [0.01] 173s the number of extra bases added on both sites of the band is 173s b+f*L, where L is the length of the aligned sequence 173s Minimizer-based seeding and partition (only effective in global alignment mode): 173s -S --seeding enable minimizer-based seeding and anchoring [False] 173s -k --k-mer INT minimizer k-mer size [19] 173s -w --window INT minimizer window size [10] 173s -n --min-poa-win INT min. size of window to perform POA [500] 173s -p --progressive build guide tree and perform progressive partial order alignment [False] 173s Input/Output: 173s -Q --use-qual-weight take base quality score from FASTQ input file as graph edge weight for consensus calling [False] 173s effective only when input sequences are in FASTQ format and consensus calling with heaviest bundling 173s -c --amino-acid input sequences are amino acid (default is nucleotide) [False] 173s -l --in-list input file is a list of sequence file names [False] 173s each line is one sequence file containing a set of sequences 173s which will be aligned by abPOA to generate a consensus sequence 173s -i --incrmnt FILE incrementally align sequences to an existing graph/MSA [Null] 173s graph could be in GFA or MSA format generated by abPOA 173s -o --output FILE output to FILE [stdout] 173s -r --result INT output result mode [0] 173s - 0: consensus in FASTA format 173s - 1: MSA in PIR format 173s - 2: both 0 & 1 173s - 3: graph in GFA format 173s - 4: graph with consensus path in GFA format 173s - 5: consensus in FASTQ format 173s -a --cons-algrm INT consensus algorithm [0] 173s - 0: heaviest bundling path in partial order graph 173s - 1: most frequent bases at each position 173s -d --maxnum-cons INT max. number of consensus sequence to generate [1] 173s -q --min-freq FLOAT min. frequency of each consensus sequence (only effective when -d/--num-cons > 1) [0.25] 173s -g --out-pog FILE dump final alignment graph to FILE (.pdf/.png) [Null] 173s 173s -h --help print this help usage information 173s -v --version show version number 173s -V --verbose INT verbose level (0-2). 0: none, 1: information, 2: debug [0] 173s 173s + test 1 = 1 173s + abpoa ./test_data/seq.fa 173s [main] CMD: /usr/bin/abpoa.generic ./test_data/seq.fa 173s [abpoa_main] Real time: 0.000 sec; CPU: 0.005 sec; Peak RSS: 0.002 GB. 173s + diff - cons.fa 173s + abpoa ./test_data/heter.fa 173s [main] CMD: /usr/bin/abpoa.generic ./test_data/heter.fa 173s [abpoa_main] Real time: 0.009 sec; CPU: 0.013 sec; Peak RSS: 0.009 GB. 173s + abpoa -r1 ./test_data/seq.fa 173s [main] CMD: /usr/bin/abpoa.generic -r1 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.000 sec; CPU: 0.019 sec; Peak RSS: 0.002 GB. 173s + diff - out.msa 173s + abpoa -r2 ./test_data/seq.fa 173s [main] CMD: /usr/bin/abpoa.generic -r2 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.000 sec; CPU: 0.007 sec; Peak RSS: 0.002 GB. 173s + diff - out_cons.msa 173s + abpoa -r3 ./test_data/seq.fa 173s [main] CMD: /usr/bin/abpoa.generic -r3 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.000 sec; CPU: 0.008 sec; Peak RSS: 0.002 GB. 173s + diff - out.gfa 173s + abpoa -r4 ./test_data/seq.fa 173s [main] CMD: /usr/bin/abpoa.generic -r4 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.001 sec; CPU: 0.009 sec; Peak RSS: 0.002 GB. 173s + diff - out4.gfa 173s + cp out.gfa in.gfa 173s + cp out.msa in.msa 173s + abpoa -i in.gfa ./test_data/seq.fa -r3 173s [main] CMD: /usr/bin/abpoa.generic -i in.gfa -r3 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.001 sec; CPU: 0.012 sec; Peak RSS: 0.002 GB. 173s + diff - out.gfa 173s + abpoa -i in.msa ./test_data/seq.fa -r1 173s [main] CMD: /usr/bin/abpoa.generic -i in.msa -r1 ./test_data/seq.fa 173s [abpoa_main] Real time: 0.001 sec; CPU: 0.002 sec; Peak RSS: 0.002 GB. 173s + diff - out.msa 173s + abpoa ./test_data/seq.fa -g poa.png 173s [main] CMD: /usr/bin/abpoa.generic -g poa.png ./test_data/seq.fa 173s [abpoa_main] Real time: 0.557 sec; CPU: 0.005 sec; Peak RSS: 0.002 GB. 173s + diff - cons.fa 173s + abpoa ./test_data/heter.fa -d2 173s [main] CMD: /usr/bin/abpoa.generic -d2 ./test_data/heter.fa 173s [abpoa_main] Real time: 0.009 sec; CPU: 0.011 sec; Peak RSS: 0.009 GB. 173s >Consensus_sequence_1 0,2,3,4,10,13,14 173s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 173s >Consensus_sequence_2 1,5,6,7,8,9,11,12 173s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCATCCCCACCGCCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 174s autopkgtest [10:25:52]: test run-unit-test: -----------------------] 174s run-unit-test PASS 174s autopkgtest [10:25:52]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 175s autopkgtest [10:25:53]: test autodep8-python3: preparing testbed 309s autopkgtest [10:28:07]: testbed dpkg architecture: ppc64el 309s autopkgtest [10:28:07]: testbed apt version: 2.9.8 309s autopkgtest [10:28:07]: @@@@@@@@@@@@@@@@@@@@ test bed setup 310s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 310s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 311s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 311s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 311s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 311s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el Packages [86.2 kB] 311s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe ppc64el Packages [588 kB] 311s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse ppc64el Packages [19.6 kB] 311s Fetched 1715 kB in 1s (2052 kB/s) 311s Reading package lists... 314s Reading package lists... 314s Building dependency tree... 314s Reading state information... 314s Calculating upgrade... 314s The following NEW packages will be installed: 314s python3.13-gdbm 314s The following packages will be upgraded: 314s libpython3-stdlib python3 python3-gdbm python3-minimal 314s 4 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 314s Need to get 102 kB of archives. 314s After this operation, 141 kB of additional disk space will be used. 314s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-minimal ppc64el 3.12.7-1 [27.4 kB] 315s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3 ppc64el 3.12.7-1 [24.0 kB] 315s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el libpython3-stdlib ppc64el 3.12.7-1 [10.0 kB] 315s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-gdbm ppc64el 3.13.0-2 [31.5 kB] 315s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-gdbm ppc64el 3.12.7-1 [8640 B] 315s Fetched 102 kB in 0s (275 kB/s) 315s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 315s Preparing to unpack .../python3-minimal_3.12.7-1_ppc64el.deb ... 315s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 315s Setting up python3-minimal (3.12.7-1) ... 315s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73767 files and directories currently installed.) 315s Preparing to unpack .../python3_3.12.7-1_ppc64el.deb ... 316s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 316s Preparing to unpack .../libpython3-stdlib_3.12.7-1_ppc64el.deb ... 316s Unpacking libpython3-stdlib:ppc64el (3.12.7-1) over (3.12.6-0ubuntu1) ... 316s Selecting previously unselected package python3.13-gdbm. 316s Preparing to unpack .../python3.13-gdbm_3.13.0-2_ppc64el.deb ... 316s Unpacking python3.13-gdbm (3.13.0-2) ... 316s Preparing to unpack .../python3-gdbm_3.12.7-1_ppc64el.deb ... 316s Unpacking python3-gdbm:ppc64el (3.12.7-1) over (3.12.6-1ubuntu1) ... 316s Setting up python3.13-gdbm (3.13.0-2) ... 316s Setting up libpython3-stdlib:ppc64el (3.12.7-1) ... 316s Setting up python3 (3.12.7-1) ... 316s Setting up python3-gdbm:ppc64el (3.12.7-1) ... 316s Processing triggers for man-db (2.12.1-3) ... 317s Reading package lists... 317s Building dependency tree... 317s Reading state information... 317s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 318s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 318s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 318s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 318s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 319s Reading package lists... 319s Reading package lists... 319s Building dependency tree... 319s Reading state information... 319s Calculating upgrade... 319s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 320s Reading package lists... 320s Building dependency tree... 320s Reading state information... 320s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 327s Reading package lists... 327s Building dependency tree... 327s Reading state information... 327s Starting pkgProblemResolver with broken count: 0 327s Starting 2 pkgProblemResolver with broken count: 0 327s Done 328s The following additional packages will be installed: 328s libpython3.13-minimal libpython3.13-stdlib python3-all python3-pyabpoa 328s python3.13 python3.13-minimal 328s Suggested packages: 328s python3.13-venv python3.13-doc binfmt-support 328s The following NEW packages will be installed: 328s autopkgtest-satdep libpython3.13-minimal libpython3.13-stdlib python3-all 328s python3-pyabpoa python3.13 python3.13-minimal 328s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 328s Need to get 6247 kB/6247 kB of archives. 328s After this operation, 26.2 MB of additional disk space will be used. 328s Get:1 /tmp/autopkgtest.RAs1Wp/2-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [716 B] 328s Get:2 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpython3.13-minimal ppc64el 3.13.0-2 [881 kB] 328s Get:3 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13-minimal ppc64el 3.13.0-2 [2302 kB] 328s Get:4 http://ftpmaster.internal/ubuntu plucky/main ppc64el libpython3.13-stdlib ppc64el 3.13.0-2 [2148 kB] 328s Get:5 http://ftpmaster.internal/ubuntu plucky/main ppc64el python3.13 ppc64el 3.13.0-2 [719 kB] 328s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main ppc64el python3-all ppc64el 3.12.7-1 [888 B] 328s Get:7 http://ftpmaster.internal/ubuntu plucky/universe ppc64el python3-pyabpoa ppc64el 1.5.3-1 [196 kB] 329s Fetched 6247 kB in 1s (7710 kB/s) 329s Selecting previously unselected package libpython3.13-minimal:ppc64el. 329s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73774 files and directories currently installed.) 329s Preparing to unpack .../0-libpython3.13-minimal_3.13.0-2_ppc64el.deb ... 329s Unpacking libpython3.13-minimal:ppc64el (3.13.0-2) ... 329s Selecting previously unselected package python3.13-minimal. 329s Preparing to unpack .../1-python3.13-minimal_3.13.0-2_ppc64el.deb ... 329s Unpacking python3.13-minimal (3.13.0-2) ... 329s Selecting previously unselected package libpython3.13-stdlib:ppc64el. 329s Preparing to unpack .../2-libpython3.13-stdlib_3.13.0-2_ppc64el.deb ... 329s Unpacking libpython3.13-stdlib:ppc64el (3.13.0-2) ... 329s Selecting previously unselected package python3.13. 329s Preparing to unpack .../3-python3.13_3.13.0-2_ppc64el.deb ... 329s Unpacking python3.13 (3.13.0-2) ... 329s Selecting previously unselected package python3-all. 329s Preparing to unpack .../4-python3-all_3.12.7-1_ppc64el.deb ... 329s Unpacking python3-all (3.12.7-1) ... 329s Selecting previously unselected package python3-pyabpoa. 329s Preparing to unpack .../5-python3-pyabpoa_1.5.3-1_ppc64el.deb ... 329s Unpacking python3-pyabpoa (1.5.3-1) ... 329s Selecting previously unselected package autopkgtest-satdep. 329s Preparing to unpack .../6-2-autopkgtest-satdep.deb ... 329s Unpacking autopkgtest-satdep (0) ... 329s Setting up python3-pyabpoa (1.5.3-1) ... 329s Setting up libpython3.13-minimal:ppc64el (3.13.0-2) ... 329s Setting up python3.13-minimal (3.13.0-2) ... 330s Setting up libpython3.13-stdlib:ppc64el (3.13.0-2) ... 330s Setting up python3.13 (3.13.0-2) ... 331s Setting up python3-all (3.12.7-1) ... 331s Setting up autopkgtest-satdep (0) ... 331s Processing triggers for man-db (2.12.1-3) ... 332s Processing triggers for systemd (256.5-2ubuntu4) ... 334s (Reading database ... 74517 files and directories currently installed.) 334s Removing autopkgtest-satdep (0) ... 336s autopkgtest [10:28:34]: test autodep8-python3: set -e ; for py in $(py3versions -r 2>/dev/null) ; do cd "$AUTOPKGTEST_TMP" ; echo "Testing with $py:" ; $py -c "import pyabpoa; print(pyabpoa)" ; done 336s autopkgtest [10:28:34]: test autodep8-python3: [----------------------- 337s Testing with python3.13: 337s Traceback (most recent call last): 337s File "", line 1, in 337s import pyabpoa; print(pyabpoa) 337s ^^^^^^^^^^^^^^ 337s ModuleNotFoundError: No module named 'pyabpoa' 337s autopkgtest [10:28:35]: test autodep8-python3: -----------------------] 338s autopkgtest [10:28:36]: test autodep8-python3: - - - - - - - - - - results - - - - - - - - - - 338s autodep8-python3 FAIL non-zero exit status 1 338s autopkgtest [10:28:36]: @@@@@@@@@@@@@@@@@@@@ summary 338s run-unit-test PASS 338s autodep8-python3 FAIL non-zero exit status 1 355s virt: nova [W] Using flock in prodstack6-ppc64el 355s virt: flock: timeout while waiting to get lock 355s virt: Creating nova instance adt-plucky-ppc64el-abpoa-20241113-100519-juju-7f2275-prod-proposed-migration-environment-2-6dec0d3f-95f1-47e9-b3f1-e0fc68b9df1b from image adt/ubuntu-plucky-ppc64el-server-20241113.img (UUID 0c5715b6-5cca-4485-b8bf-b85dfd917a5f)... 355s virt: nova [W] Using flock in prodstack6-ppc64el 355s virt: Creating nova instance adt-plucky-ppc64el-abpoa-20241113-100519-juju-7f2275-prod-proposed-migration-environment-2-6dec0d3f-95f1-47e9-b3f1-e0fc68b9df1b from image adt/ubuntu-plucky-ppc64el-server-20241113.img (UUID 0c5715b6-5cca-4485-b8bf-b85dfd917a5f)...