0s autopkgtest [17:40:45]: starting date and time: 2025-03-15 17:40:45+0000 0s autopkgtest [17:40:45]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [17:40:45]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.z7jt0e9_/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:glibc --apt-upgrade skewer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- lxd -r lxd-armhf-10.145.243.188 lxd-armhf-10.145.243.188:autopkgtest/ubuntu/plucky/armhf 21s autopkgtest [17:41:06]: testbed dpkg architecture: armhf 23s autopkgtest [17:41:08]: testbed apt version: 2.9.33 26s autopkgtest [17:41:11]: @@@@@@@@@@@@@@@@@@@@ test bed setup 28s autopkgtest [17:41:13]: testbed release detected to be: None 36s autopkgtest [17:41:21]: updating testbed package index (apt update) 38s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 38s Get:2 http://ftpmaster.internal/ubuntu plucky InRelease [257 kB] 38s Get:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease [126 kB] 39s Get:4 http://ftpmaster.internal/ubuntu plucky-security InRelease [126 kB] 39s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [379 kB] 39s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 39s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [99.7 kB] 39s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [114 kB] 39s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf c-n-f Metadata [1832 B] 39s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted armhf c-n-f Metadata [116 B] 39s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [312 kB] 40s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf c-n-f Metadata [11.1 kB] 40s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [3472 B] 40s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf c-n-f Metadata [240 B] 40s Get:15 http://ftpmaster.internal/ubuntu plucky/universe Sources [21.0 MB] 53s Get:16 http://ftpmaster.internal/ubuntu plucky/main Sources [1394 kB] 54s Get:17 http://ftpmaster.internal/ubuntu plucky/multiverse Sources [299 kB] 55s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf Packages [1378 kB] 56s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf c-n-f Metadata [29.4 kB] 56s Get:20 http://ftpmaster.internal/ubuntu plucky/restricted armhf c-n-f Metadata [108 B] 56s Get:21 http://ftpmaster.internal/ubuntu plucky/universe armhf Packages [15.1 MB] 68s Get:22 http://ftpmaster.internal/ubuntu plucky/multiverse armhf Packages [172 kB] 69s Fetched 41.0 MB in 31s (1309 kB/s) 71s Reading package lists... 77s autopkgtest [17:42:02]: upgrading testbed (apt dist-upgrade and autopurge) 79s Reading package lists... 79s Building dependency tree... 79s Reading state information... 80s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 81s Starting 2 pkgProblemResolver with broken count: 0 81s Done 83s Entering ResolveByKeep 83s 84s Calculating upgrade... 85s The following packages will be upgraded: 85s libc-bin libc6 locales pinentry-curses python3-jinja2 sos strace 86s 7 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 86s Need to get 8683 kB of archives. 86s After this operation, 23.6 kB of additional disk space will be used. 86s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libc6 armhf 2.41-1ubuntu2 [2932 kB] 88s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libc-bin armhf 2.41-1ubuntu2 [545 kB] 89s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf locales all 2.41-1ubuntu2 [4246 kB] 91s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf strace armhf 6.13+ds-1ubuntu1 [445 kB] 92s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf pinentry-curses armhf 1.3.1-2ubuntu3 [40.6 kB] 92s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 92s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf sos all 4.9.0-5 [365 kB] 93s Preconfiguring packages ... 93s Fetched 8683 kB in 7s (1281 kB/s) 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 93s Preparing to unpack .../libc6_2.41-1ubuntu2_armhf.deb ... 93s Unpacking libc6:armhf (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 93s Setting up libc6:armhf (2.41-1ubuntu2) ... 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 93s Preparing to unpack .../libc-bin_2.41-1ubuntu2_armhf.deb ... 93s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 93s Setting up libc-bin (2.41-1ubuntu2) ... 94s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 94s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 94s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 94s Preparing to unpack .../strace_6.13+ds-1ubuntu1_armhf.deb ... 94s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 94s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_armhf.deb ... 94s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 94s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 94s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 94s Preparing to unpack .../archives/sos_4.9.0-5_all.deb ... 95s Unpacking sos (4.9.0-5) over (4.9.0-4) ... 95s Setting up sos (4.9.0-5) ... 95s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 95s Setting up locales (2.41-1ubuntu2) ... 96s Generating locales (this might take a while)... 99s en_US.UTF-8... done 99s Generation complete. 99s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 99s Setting up strace (6.13+ds-1ubuntu1) ... 99s Processing triggers for man-db (2.13.0-1) ... 100s Processing triggers for systemd (257.3-1ubuntu3) ... 106s Reading package lists... 106s Building dependency tree... 106s Reading state information... 107s Starting pkgProblemResolver with broken count: 0 107s Starting 2 pkgProblemResolver with broken count: 0 107s Done 107s Solving dependencies... 108s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 112s autopkgtest [17:42:37]: rebooting testbed after setup commands that affected boot 155s autopkgtest [17:43:20]: testbed running kernel: Linux 6.8.0-52-generic #53~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Jan 15 18:10:51 UTC 2 180s autopkgtest [17:43:45]: @@@@@@@@@@@@@@@@@@@@ apt-source skewer 190s Get:1 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (dsc) [1941 B] 190s Get:2 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (tar) [36.4 kB] 190s Get:3 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (diff) [21.8 kB] 191s gpgv: Signature made Sun Oct 31 14:43:32 2021 UTC 191s gpgv: using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1 191s gpgv: issuer "nilesh@debian.org" 191s gpgv: Can't check signature: No public key 191s dpkg-source: warning: cannot verify inline signature for ./skewer_0.2.2-6.dsc: no acceptable signature found 191s autopkgtest [17:43:56]: testing package skewer version 0.2.2-6 193s autopkgtest [17:43:58]: build not needed 195s autopkgtest [17:44:00]: test run-unit-test: preparing testbed 197s Reading package lists... 197s Building dependency tree... 197s Reading state information... 197s Starting pkgProblemResolver with broken count: 0 198s Starting 2 pkgProblemResolver with broken count: 0 198s Done 198s The following NEW packages will be installed: 198s skewer 199s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 199s Need to get 84.4 kB of archives. 199s After this operation, 150 kB of additional disk space will be used. 199s Get:1 http://ftpmaster.internal/ubuntu plucky/universe armhf skewer armhf 0.2.2-6 [84.4 kB] 199s Fetched 84.4 kB in 0s (246 kB/s) 199s Selecting previously unselected package skewer. 199s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 199s Preparing to unpack .../skewer_0.2.2-6_armhf.deb ... 199s Unpacking skewer (0.2.2-6) ... 199s Setting up skewer (0.2.2-6) ... 207s autopkgtest [17:44:12]: test run-unit-test: [----------------------- 209s |==> | (7.73%) |======> | (15.79%) |==========> | (23.94%) |==============> | (31.73%) |==================> | (39.85%) |======================> | (47.86%) |===========================> | (56.12%) |===============================> | (64.20%) |===================================> | (72.21%) |=======================================> | (80.23%).--. .-. 209s : .--': :.-. 209s `. `. : `'.' .--. .-..-..-. .--. .--. 209s _`, :: . `.' '_.': `; `; :' '_.': ..' 209s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 209s skewer v0.2.2 [April 4, 2016] 209s Parameters used: 209s -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGT 209s -- maximum error ratio allowed (-r): 0.100 209s -- maximum indel error ratio allowed (-d): 0.000 209s -- minimum read length allowed after trimming (-l): 16 209s -- maximum read length for output (-L): 30 209s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 209s -- minimum overlap length for adapter detection (-k): 3 209s Sat Mar 15 17:44:14 2025 >> started 209s 209s Sat Mar 15 17:44:14 2025 >> done (0.005s) 209s 24 reads processed; of these: 209s 0 ( 0.00%) short reads filtered out after trimming by size control 209s 0 ( 0.00%) empty reads filtered out after trimming by size control 209s 24 (100.00%) long reads filtered out after trimming by size control 209s 0 ( 0.00%) reads available. 209s log has been saved to "output-trimmed.log". 209s |===========================================> | (88.12%) |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 209s |================================================> | (99.99%) |======> | (15.79%) |==============> | (31.73%) |======================> | (47.86%) |===============================> | (64.20%) |=======================================> | (80.23%).--. .-. 209s : .--': :.-. 209s `. `. : `'.' .--. .-..-..-. .--. .--. 209s _`, :: . `.' '_.': `; `; :' '_.': ..' 209s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 209s skewer v0.2.2 [April 4, 2016] 209s Parameters used: 209s -- 3' end adapter sequences in file (-x): adapters.fa 209s A: ATGCGATCGACTCGACTAC 209s -- maximum error ratio allowed (-r): 0.100 209s -- maximum indel error ratio allowed (-d): 0.030 209s -- mean quality threshold (-Q): 9 209s -- minimum read length allowed after trimming (-l): 18 209s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 209s -- minimum overlap length for adapter detection (-k): 3 209s -- number of concurrent threads (-t): 2 209s Sat Mar 15 17:44:14 2025 >> started 209s 209s Sat Mar 15 17:44:14 2025 >> done (0.006s) 209s 24 reads processed; of these: 209s 0 ( 0.00%) short reads filtered out after trimming by size control 209s 0 ( 0.00%) empty reads filtered out after trimming by size control 209s 24 (100.00%) reads available; of these: 209s 24 (100.00%) untrimmed reads available after processing 209s log has been saved to "trimmed-trimmed.log". 210s output-trimmed.log 210s trimmed-trimmed.log 210s PASS 210s |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 210s |================================================> | (99.99%)autopkgtest [17:44:15]: test run-unit-test: -----------------------] 214s run-unit-test PASS 214s autopkgtest [17:44:19]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 217s autopkgtest [17:44:22]: @@@@@@@@@@@@@@@@@@@@ summary 217s run-unit-test PASS