0s autopkgtest [23:43:06]: starting date and time: 2025-03-15 23:43:06+0000 0s autopkgtest [23:43:06]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [23:43:06]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.3jnwfogu/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:glibc --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- lxd -r lxd-armhf-10.145.243.85 lxd-armhf-10.145.243.85:autopkgtest/ubuntu/plucky/armhf 20s autopkgtest [23:43:26]: testbed dpkg architecture: armhf 21s autopkgtest [23:43:27]: testbed apt version: 2.9.33 25s autopkgtest [23:43:31]: @@@@@@@@@@@@@@@@@@@@ test bed setup 27s autopkgtest [23:43:33]: testbed release detected to be: None 34s autopkgtest [23:43:40]: updating testbed package index (apt update) 36s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 36s Get:2 http://ftpmaster.internal/ubuntu plucky InRelease [257 kB] 36s Get:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease [126 kB] 36s Get:4 http://ftpmaster.internal/ubuntu plucky-security InRelease [126 kB] 37s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [369 kB] 37s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [44.1 kB] 37s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [14.5 kB] 37s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [76.2 kB] 37s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf c-n-f Metadata [1796 B] 37s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted armhf c-n-f Metadata [116 B] 37s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [318 kB] 37s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf c-n-f Metadata [10.8 kB] 37s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [2732 B] 37s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf c-n-f Metadata [240 B] 37s Get:15 http://ftpmaster.internal/ubuntu plucky/main Sources [1389 kB] 37s Get:16 http://ftpmaster.internal/ubuntu plucky/multiverse Sources [299 kB] 37s Get:17 http://ftpmaster.internal/ubuntu plucky/universe Sources [21.0 MB] 39s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf Packages [1378 kB] 39s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf c-n-f Metadata [29.5 kB] 39s Get:20 http://ftpmaster.internal/ubuntu plucky/restricted armhf c-n-f Metadata [108 B] 39s Get:21 http://ftpmaster.internal/ubuntu plucky/universe armhf Packages [14.9 MB] 40s Get:22 http://ftpmaster.internal/ubuntu plucky/multiverse armhf Packages [172 kB] 43s Fetched 40.7 MB in 7s (5746 kB/s) 44s Reading package lists... 50s autopkgtest [23:43:56]: upgrading testbed (apt dist-upgrade and autopurge) 51s Reading package lists... 52s Building dependency tree... 52s Reading state information... 52s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 52s Starting 2 pkgProblemResolver with broken count: 0 52s Done 53s Entering ResolveByKeep 53s 54s Calculating upgrade... 54s The following packages will be upgraded: 54s libc-bin libc6 locales pinentry-curses python3-jinja2 sos strace 54s 7 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 54s Need to get 8683 kB of archives. 54s After this operation, 23.6 kB of additional disk space will be used. 54s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libc6 armhf 2.41-1ubuntu2 [2932 kB] 55s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libc-bin armhf 2.41-1ubuntu2 [545 kB] 55s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf locales all 2.41-1ubuntu2 [4246 kB] 55s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf strace armhf 6.13+ds-1ubuntu1 [445 kB] 55s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf pinentry-curses armhf 1.3.1-2ubuntu3 [40.6 kB] 55s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 55s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf sos all 4.9.0-5 [365 kB] 56s Preconfiguring packages ... 56s Fetched 8683 kB in 1s (7548 kB/s) 56s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 56s Preparing to unpack .../libc6_2.41-1ubuntu2_armhf.deb ... 56s Unpacking libc6:armhf (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 57s Setting up libc6:armhf (2.41-1ubuntu2) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 57s Preparing to unpack .../libc-bin_2.41-1ubuntu2_armhf.deb ... 57s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 57s Setting up libc-bin (2.41-1ubuntu2) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 57s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 57s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 58s Preparing to unpack .../strace_6.13+ds-1ubuntu1_armhf.deb ... 58s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 58s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_armhf.deb ... 58s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 58s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 58s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 58s Preparing to unpack .../archives/sos_4.9.0-5_all.deb ... 58s Unpacking sos (4.9.0-5) over (4.9.0-4) ... 58s Setting up sos (4.9.0-5) ... 59s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 59s Setting up locales (2.41-1ubuntu2) ... 60s Generating locales (this might take a while)... 62s en_US.UTF-8... done 62s Generation complete. 62s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 62s Setting up strace (6.13+ds-1ubuntu1) ... 62s Processing triggers for man-db (2.13.0-1) ... 63s Processing triggers for systemd (257.3-1ubuntu3) ... 65s Reading package lists... 66s Building dependency tree... 66s Reading state information... 66s Starting pkgProblemResolver with broken count: 0 66s Starting 2 pkgProblemResolver with broken count: 0 66s Done 67s Solving dependencies... 67s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 69s autopkgtest [23:44:15]: rebooting testbed after setup commands that affected boot 107s autopkgtest [23:44:53]: testbed running kernel: Linux 6.8.0-52-generic #53~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Jan 15 18:10:51 UTC 2 131s autopkgtest [23:45:17]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 147s Get:1 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (dsc) [3288 B] 147s Get:2 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (tar) [16.6 MB] 147s Get:3 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (diff) [10.8 MB] 147s gpgv: Signature made Thu Jan 9 12:18:12 2025 UTC 147s gpgv: using RSA key 4A5FD1CD115087CC03DC35C1D597897206C5F07F 147s gpgv: issuer "maytha8thedev@gmail.com" 147s gpgv: Can't check signature: No public key 147s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.9.0+ds-1.dsc: no acceptable signature found 149s autopkgtest [23:45:35]: testing package seqkit version 2.9.0+ds-1 155s autopkgtest [23:45:41]: build not needed 159s autopkgtest [23:45:45]: test run-unit-test: preparing testbed 161s Reading package lists... 161s Building dependency tree... 161s Reading state information... 162s Starting pkgProblemResolver with broken count: 0 162s Starting 2 pkgProblemResolver with broken count: 0 162s Done 163s The following NEW packages will be installed: 163s seqkit seqkit-examples ssshtest 163s 0 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. 163s Need to get 46.6 MB of archives. 163s After this operation, 57.1 MB of additional disk space will be used. 163s Get:1 http://ftpmaster.internal/ubuntu plucky/universe armhf seqkit armhf 2.9.0+ds-1 [6983 kB] 164s Get:2 http://ftpmaster.internal/ubuntu plucky/universe armhf seqkit-examples all 2.9.0+ds-1 [39.6 MB] 169s Get:3 http://ftpmaster.internal/ubuntu plucky/universe armhf ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 169s Fetched 46.6 MB in 6s (7169 kB/s) 170s Selecting previously unselected package seqkit. 170s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 64655 files and directories currently installed.) 170s Preparing to unpack .../seqkit_2.9.0+ds-1_armhf.deb ... 170s Unpacking seqkit (2.9.0+ds-1) ... 170s Selecting previously unselected package seqkit-examples. 170s Preparing to unpack .../seqkit-examples_2.9.0+ds-1_all.deb ... 170s Unpacking seqkit-examples (2.9.0+ds-1) ... 170s Selecting previously unselected package ssshtest. 170s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 170s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 170s Setting up seqkit (2.9.0+ds-1) ... 170s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 170s Setting up seqkit-examples (2.9.0+ds-1) ... 170s Processing triggers for man-db (2.13.0-1) ... 179s autopkgtest [23:46:05]: test run-unit-test: [----------------------- 182s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 183s tput: No value for $TERM and no -T specified 183s 183s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 183s PASS "28645" == "28645" (LINE 28) 183s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 183s 183s seq_type ran in 0 sec with 2/92423 lines to STDERR/OUT 183s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 184s 184s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "Protein" (LINE 42) 184s 184s seq_type ran in 1 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "RNA" (LINE 48) 184s 184s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "DNA" (LINE 54) 184s 184s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "DNA" (LINE 60) 184s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 184s 184s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 184s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 184s 184s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 184s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 184s 184s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 184s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 184s 184s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 184s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 184s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 184s 184s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 184s 184s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 184s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 184s 184s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 184s PASS "a" == "a" (LINE 117) 184s 184s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 184s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 184s 184s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 184s PASS "gtn" == "gtn" (LINE 129) 185s 185s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 185s PASS "ACG" == "ACG" (LINE 135) 185s 185s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 185s PASS "N" == "N" (LINE 141) 185s 185s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 185s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 185s 185s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 185s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 185s 185s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 185s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 185s 185s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 185s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 185s 185s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 185s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 185s 185s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 185s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 185s 185s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 185s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 185s [ERRO] xopen: no content 185s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 185s 185s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 185s Length correlation: 185s PASS "1" == "1" (LINE 220) 185s Length correlation: 185s PASS "1" == "1" (LINE 224) 185s Qual correlation: 185s PASS "1" == "1" (LINE 228) 186s 186s grep_by_regexp ran in 1 sec with 0/5540 lines to STDERR/OUT 186s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 186s 186s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 186s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 186s 186s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT 186s PASS "100" == "100" (LINE 249) 186s 186s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 186s PASS "3074" == "3074" (LINE 254) 186s 186s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 186s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 186s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 186s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 186s 186s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 186s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 186s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 187s [INFO] 0 duplicated records removed 187s [INFO] sample by proportion 187s [INFO] 2814 sequences outputted 187s 187s common ran in 0 sec with 5/0 lines to STDERR/OUT 187s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 299) 187s 187s split ran in 0 sec with 104/0 lines to STDERR/OUT 187s [INFO] 0 duplicated records removed 187s PASS "100" == "100" (LINE 316) 187s [INFO] 0 duplicated records removed 187s PASS "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" == "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" (LINE 317) 187s [INFO] sample by proportion 187s [INFO] 2814 sequences outputted 187s [INFO] sample by proportion 187s [INFO] 2814 sequences outputted 187s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 324) 187s 187s head ran in 0 sec with 0/30 lines to STDERR/OUT 187s PASS "10" == "10" (LINE 332) 187s PASS "snq" == "snq" (LINE 341) 187s PASS "seq_2" == "seq_2" (LINE 350) 187s 187s restart ran in 0 sec with 0/2 lines to STDERR/OUT 187s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 187s 187s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 187s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 189s 189s shuffle ran in 2 sec with 20/0 lines to STDERR/OUT 189s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 389) 189s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 189s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 393) 189s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 394) 189s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 395) 190s 190s bam_acc ran in 1 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 422) 190s 190s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 432) 190s 190s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 442) 190s 190s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 452) 190s 190s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 462) 190s 190s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 475) 190s 190s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 190s Correlation: 190s PASS "1" == "1" (LINE 488) 191s 191s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 498) 191s 191s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 191s PASS EXIT CODE (LINE 516) 191s 191s sana_fastq_sep_id ran in 0 sec with 9/0 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 529) 191s 191s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 539) 191s 191s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 550) 191s 191s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 558) 191s 191s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 191s PASS "0" == "0" (LINE 566) 195s 195s scat_fasta ran in 4 sec with 261/0 lines to STDERR/OUT 195s PASS "0" == "0" (LINE 615) 195s PASS "0" == "0" (LINE 617) 197s 197s scat_fastq ran in 2 sec with 531/0 lines to STDERR/OUT 197s PASS "0" == "0" (LINE 661) 197s PASS "0" == "0" (LINE 663) 197s [INFO] sample by number 197s [INFO] loading all sequences into memory... 197s [INFO] 9 sequences outputted 197s 197s faidx_id ran in 0 sec with 3/0 lines to STDERR/OUT 197s [INFO] read sequences ... 197s [INFO] 9 patterns loaded from file 197s [INFO] 9 sequences loaded 197s [INFO] sorting ... 197s [INFO] output ... 197s [INFO] read sequences ... 197s [INFO] 9 sequences loaded 197s [INFO] sorting ... 197s [INFO] output ... 197s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 679) 197s 197s faidx_full_head ran in 0 sec with 3/0 lines to STDERR/OUT 197s [INFO] read sequences ... 197s [INFO] 9 patterns loaded from file 197s [INFO] 9 sequences loaded 197s [INFO] sorting ... 197s [INFO] output ... 198s [INFO] read sequences ... 198s [INFO] 9 sequences loaded 198s [INFO] sorting ... 198s [INFO] output ... 198s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 686) 198s 198s faidx_region ran in 1 sec with 3/0 lines to STDERR/OUT 198s PASS "GCAGCUGCAGCAUUAUCAAGAUUCACAUAGAAAUCAUGUGGGGCAGAAAACAUAGGUUCUAAAAAUCUAACCCCAAGUUCUUUGAACAUGAGAAUCUUGAUGAUGCUGCAUCAGCA" == "GCAGCUGCAGCAUUAUCAAGAUUCACAUAGAAAUCAUGUGGGGCAGAAAACAUAGGUUCUAAAAAUCUAACCCCAAGUUCUUUGAACAUGAGAAUCUUGAUGAUGCUGCAUCAGCA" (LINE 695) 198s 198s sshtest v0.1.5 198s 198s 72 Tests 198s 0 Failures 198s 72 Successes 198s autopkgtest [23:46:24]: test run-unit-test: -----------------------] 202s autopkgtest [23:46:28]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 202s run-unit-test PASS 206s autopkgtest [23:46:32]: @@@@@@@@@@@@@@@@@@@@ summary 206s run-unit-test PASS