0s autopkgtest [20:19:08]: starting date and time: 2024-11-29 20:19:08+0000 0s autopkgtest [20:19:08]: git checkout: be626eda Fix armhf LXD image generation for plucky 0s autopkgtest [20:19:08]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.k_zue5vi/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.4.0-1ubuntu1 -- lxd -r lxd-armhf-10.145.243.247 lxd-armhf-10.145.243.247:autopkgtest/ubuntu/plucky/armhf 55s autopkgtest [20:20:03]: testbed dpkg architecture: armhf 58s autopkgtest [20:20:06]: testbed apt version: 2.9.14ubuntu1 62s autopkgtest [20:20:10]: @@@@@@@@@@@@@@@@@@@@ test bed setup 65s autopkgtest [20:20:13]: testbed release detected to be: None 74s autopkgtest [20:20:22]: updating testbed package index (apt update) 77s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 77s Get:2 http://ftpmaster.internal/ubuntu plucky InRelease [213 kB] 77s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 77s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 77s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [14.4 kB] 77s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [837 kB] 77s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [9708 B] 77s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [62.8 kB] 77s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [85.5 kB] 77s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted armhf Packages [928 B] 77s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [635 kB] 77s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [6440 B] 77s Get:13 http://ftpmaster.internal/ubuntu plucky/multiverse Sources [298 kB] 77s Get:14 http://ftpmaster.internal/ubuntu plucky/universe Sources [20.7 MB] 78s Get:15 http://ftpmaster.internal/ubuntu plucky/main Sources [1377 kB] 78s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf Packages [1353 kB] 78s Get:17 http://ftpmaster.internal/ubuntu plucky/universe armhf Packages [14.6 MB] 78s Get:18 http://ftpmaster.internal/ubuntu plucky/multiverse armhf Packages [174 kB] 82s Fetched 40.5 MB in 5s (8043 kB/s) 83s Reading package lists... 91s autopkgtest [20:20:39]: upgrading testbed (apt dist-upgrade and autopurge) 94s Reading package lists... 94s Building dependency tree... 94s Reading state information... 95s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 95s Starting 2 pkgProblemResolver with broken count: 0 95s Done 95s Entering ResolveByKeep 96s 96s The following NEW packages will be installed: 96s openssl-provider-legacy 96s The following packages will be upgraded: 96s fwupd libfwupd3 libssl3t64 openssl python3-software-properties 96s software-properties-common 96s 6 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 96s Need to get 8135 kB of archives. 96s After this operation, 494 kB of additional disk space will be used. 96s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf openssl-provider-legacy armhf 3.4.0-1ubuntu1 [29.3 kB] 97s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libssl3t64 armhf 3.4.0-1ubuntu1 [1756 kB] 97s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf openssl armhf 3.4.0-1ubuntu1 [1159 kB] 97s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf fwupd armhf 2.0.2-2 [5020 kB] 97s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf libfwupd3 armhf 2.0.2-2 [124 kB] 97s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf software-properties-common all 0.107 [16.5 kB] 97s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf python3-software-properties all 0.107 [30.4 kB] 97s Fetched 8135 kB in 1s (9640 kB/s) 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59970 files and directories currently installed.) 98s Preparing to unpack .../libssl3t64_3.4.0-1ubuntu1_armhf.deb ... 98s Unpacking libssl3t64:armhf (3.4.0-1ubuntu1) over (3.3.1-2ubuntu2) ... 98s Selecting previously unselected package openssl-provider-legacy. 98s Preparing to unpack .../openssl-provider-legacy_3.4.0-1ubuntu1_armhf.deb ... 98s Unpacking openssl-provider-legacy (3.4.0-1ubuntu1) ... 98s Setting up libssl3t64:armhf (3.4.0-1ubuntu1) ... 98s Setting up openssl-provider-legacy (3.4.0-1ubuntu1) ... 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59973 files and directories currently installed.) 98s Preparing to unpack .../openssl_3.4.0-1ubuntu1_armhf.deb ... 98s Unpacking openssl (3.4.0-1ubuntu1) over (3.3.1-2ubuntu2) ... 98s Preparing to unpack .../fwupd_2.0.2-2_armhf.deb ... 98s Unpacking fwupd (2.0.2-2) over (2.0.2-1) ... 98s Preparing to unpack .../libfwupd3_2.0.2-2_armhf.deb ... 98s Unpacking libfwupd3:armhf (2.0.2-2) over (2.0.2-1) ... 98s Preparing to unpack .../software-properties-common_0.107_all.deb ... 98s Unpacking software-properties-common (0.107) over (0.105) ... 98s Preparing to unpack .../python3-software-properties_0.107_all.deb ... 98s Unpacking python3-software-properties (0.107) over (0.105) ... 98s Setting up libfwupd3:armhf (2.0.2-2) ... 98s Setting up python3-software-properties (0.107) ... 98s Setting up openssl (3.4.0-1ubuntu1) ... 98s Installing new version of config file /etc/ssl/openssl.cnf ... 98s Setting up fwupd (2.0.2-2) ... 99s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 99s fwupd.service is a disabled or a static unit not running, not starting it. 99s Setting up software-properties-common (0.107) ... 99s Processing triggers for libc-bin (2.40-1ubuntu3) ... 99s Processing triggers for man-db (2.13.0-1) ... 100s Processing triggers for dbus (1.14.10-4ubuntu5) ... 103s Reading package lists... 104s Building dependency tree... 104s Reading state information... 104s Starting pkgProblemResolver with broken count: 0 104s Starting 2 pkgProblemResolver with broken count: 0 104s Done 105s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 107s autopkgtest [20:20:55]: rebooting testbed after setup commands that affected boot 184s autopkgtest [20:22:12]: testbed running kernel: Linux 6.8.0-49-generic #49~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Nov 6 18:12:14 UTC 2 216s autopkgtest [20:22:44]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 233s Get:1 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (dsc) [3274 B] 233s Get:2 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (tar) [16.6 MB] 233s Get:3 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (diff) [10.8 MB] 233s gpgv: Signature made Sun Jun 30 04:14:25 2024 UTC 233s gpgv: using RSA key 4A5FD1CD115087CC03DC35C1D597897206C5F07F 233s gpgv: issuer "maytha8thedev@gmail.com" 233s gpgv: Can't check signature: No public key 233s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.8.2+ds-1.dsc: no acceptable signature found 235s autopkgtest [20:23:03]: testing package seqkit version 2.8.2+ds-1 239s autopkgtest [20:23:07]: build not needed 244s autopkgtest [20:23:12]: test run-unit-test: preparing testbed 246s Reading package lists... 247s Building dependency tree... 247s Reading state information... 247s Starting pkgProblemResolver with broken count: 0 247s Starting 2 pkgProblemResolver with broken count: 0 247s Done 248s The following NEW packages will be installed: 248s seqkit seqkit-examples ssshtest 248s 0 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. 248s Need to get 46.4 MB of archives. 248s After this operation, 56.6 MB of additional disk space will be used. 248s Get:1 http://ftpmaster.internal/ubuntu plucky/universe armhf seqkit armhf 2.8.2+ds-1 [6806 kB] 249s Get:2 http://ftpmaster.internal/ubuntu plucky/universe armhf seqkit-examples all 2.8.2+ds-1 [39.6 MB] 250s Get:3 http://ftpmaster.internal/ubuntu plucky/universe armhf ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 251s Fetched 46.4 MB in 2s (20.4 MB/s) 251s Selecting previously unselected package seqkit. 251s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 251s Preparing to unpack .../seqkit_2.8.2+ds-1_armhf.deb ... 251s Unpacking seqkit (2.8.2+ds-1) ... 251s Selecting previously unselected package seqkit-examples. 251s Preparing to unpack .../seqkit-examples_2.8.2+ds-1_all.deb ... 251s Unpacking seqkit-examples (2.8.2+ds-1) ... 251s Selecting previously unselected package ssshtest. 251s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 251s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 251s Setting up seqkit (2.8.2+ds-1) ... 251s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 251s Setting up seqkit-examples (2.8.2+ds-1) ... 251s Processing triggers for man-db (2.13.0-1) ... 265s autopkgtest [20:23:33]: test run-unit-test: [----------------------- 269s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 269s tput: No value for $TERM and no -T specified 270s 270s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 270s PASS "28645" == "28645" (LINE 28) 270s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 270s 270s seq_type ran in 0 sec with 2/92423 lines to STDERR/OUT 270s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 270s 270s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 270s PASS STDOUT CONTAINS "Protein" (LINE 42) 270s 270s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 270s PASS STDOUT CONTAINS "RNA" (LINE 48) 270s 270s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 270s PASS STDOUT CONTAINS "DNA" (LINE 54) 270s 270s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 270s PASS STDOUT CONTAINS "DNA" (LINE 60) 270s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 270s 270s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 270s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 270s 270s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 270s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 270s 270s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 271s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 271s 271s seq_revcom ran in 1 sec with 1/3 lines to STDERR/OUT 271s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 271s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 271s 271s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 271s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 271s 271s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 271s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 271s 271s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 271s PASS "a" == "a" (LINE 117) 271s 271s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 271s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 271s 271s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 271s PASS "gtn" == "gtn" (LINE 129) 271s 271s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 271s PASS "ACG" == "ACG" (LINE 135) 271s 271s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 271s PASS "N" == "N" (LINE 141) 271s 271s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 271s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 271s 271s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 271s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 271s 271s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 271s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 271s 271s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 271s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 271s 271s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 271s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 271s 271s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 271s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 272s 272s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 272s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 272s [ERRO] xopen: no content 272s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 272s 272s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 272s Length correlation: 272s PASS "1" == "1" (LINE 220) 272s Length correlation: 272s PASS "1" == "1" (LINE 224) 272s Qual correlation: 272s PASS "1" == "1" (LINE 228) 272s 272s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 272s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 272s 272s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 272s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 272s 272s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT 272s PASS "100" == "100" (LINE 249) 272s 272s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 272s PASS "3074" == "3074" (LINE 254) 273s 273s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 273s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 273s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 273s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 273s 273s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 273s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 273s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 273s [INFO] 0 duplicated records removed 273s [INFO] sample by proportion 273s [INFO] 2814 sequences outputted 273s 273s common ran in 0 sec with 5/0 lines to STDERR/OUT 273s PASS "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" == "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" (LINE 299) 273s 273s split ran in 0 sec with 104/0 lines to STDERR/OUT 273s [INFO] 0 duplicated records removed 273s PASS "100" == "100" (LINE 316) 273s [INFO] 0 duplicated records removed 273s PASS "bb44753ad4db4d3ea8db3b1eb7fd9d20ee71a245000781a37bdf6a9951bc538d" == "bb44753ad4db4d3ea8db3b1eb7fd9d20ee71a245000781a37bdf6a9951bc538d" (LINE 317) 273s [INFO] sample by proportion 273s [INFO] 2814 sequences outputted 273s [INFO] sample by proportion 273s [INFO] 2814 sequences outputted 273s PASS "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" == "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" (LINE 324) 273s 273s head ran in 0 sec with 0/30 lines to STDERR/OUT 273s PASS "10" == "10" (LINE 332) 273s PASS "snq" == "snq" (LINE 341) 273s PASS "seq_2" == "seq_2" (LINE 350) 273s 273s restart ran in 0 sec with 0/2 lines to STDERR/OUT 273s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 273s 273s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 273s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 275s 275s shuffle ran in 2 sec with 20/0 lines to STDERR/OUT 275s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 389) 275s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 275s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 393) 275s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 394) 275s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 395) 275s 275s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 275s Correlation: 275s PASS "1" == "1" (LINE 422) 276s 276s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 432) 276s 276s bam_map_qual ran in 1 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 442) 276s 276s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 452) 276s 276s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 462) 276s 276s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 475) 276s 276s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 276s Correlation: 276s PASS "1" == "1" (LINE 488) 277s 277s bam_bundler ran in 0 sec with 13/9 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 498) 277s 277s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 277s PASS EXIT CODE (LINE 516) 277s 277s sana_fastq_sep_id ran in 0 sec with 9/0 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 529) 277s 277s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 539) 277s 277s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 550) 277s 277s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 558) 277s 277s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 277s PASS "0" == "0" (LINE 566) 281s 281s scat_fasta ran in 4 sec with 261/0 lines to STDERR/OUT 281s PASS "0" == "0" (LINE 615) 281s PASS "0" == "0" (LINE 617) 284s 284s scat_fastq ran in 3 sec with 531/0 lines to STDERR/OUT 284s PASS "0" == "0" (LINE 661) 284s PASS "0" == "0" (LINE 663) 284s [INFO] sample by number 284s [INFO] loading all sequences into memory... 285s [INFO] 9 sequences outputted 285s 285s faidx_id ran in 0 sec with 3/0 lines to STDERR/OUT 285s [INFO] 9 patterns loaded from file 285s [INFO] read sequences ... 285s [INFO] 9 sequences loaded 285s [INFO] sorting ... 285s [INFO] output ... 285s [INFO] read sequences ... 285s [INFO] 9 sequences loaded 285s [INFO] sorting ... 285s [INFO] output ... 285s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 679) 285s 285s faidx_full_head ran in 0 sec with 3/0 lines to STDERR/OUT 285s [INFO] read sequences ... 285s [INFO] 9 patterns loaded from file 285s [INFO] 9 sequences loaded 285s [INFO] sorting ... 285s [INFO] output ... 285s [INFO] read sequences ... 285s [INFO] 9 sequences loaded 285s [INFO] sorting ... 285s [INFO] output ... 285s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 686) 285s 285s faidx_region ran in 0 sec with 3/0 lines to STDERR/OUT 285s PASS "CAUGGGGUGUGAUUGCUUGGCUGGCCUGGCCUCCCUCUGUGGGGCGAUCGAUCGUGGAGCCCUCCCCCAUUGAUUGCCUUGCAGAGGGUGGCCUGAGUCUCUGUGGGGCAAUCGUAGGGUG" == "CAUGGGGUGUGAUUGCUUGGCUGGCCUGGCCUCCCUCUGUGGGGCGAUCGAUCGUGGAGCCCUCCCCCAUUGAUUGCCUUGCAGAGGGUGGCCUGAGUCUCUGUGGGGCAAUCGUAGGGUG" (LINE 695) 285s 285s sshtest v0.1.5 285s 285s 72 Tests 285s 0 Failures 285s 72 Successes 286s autopkgtest [20:23:54]: test run-unit-test: -----------------------] 291s autopkgtest [20:23:59]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 291s run-unit-test PASS 297s autopkgtest [20:24:05]: @@@@@@@@@@@@@@@@@@@@ summary 297s run-unit-test PASS