0s autopkgtest [17:05:26]: starting date and time: 2024-11-13 17:05:26+0000
  0s autopkgtest [17:05:26]: git checkout: 6f3be7a8 Fix armhf LXD image generation for plucky
  0s autopkgtest [17:05:26]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.84z6rw2f/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- lxd -r lxd-armhf-10.145.243.52 lxd-armhf-10.145.243.52:autopkgtest/ubuntu/plucky/armhf
 53s autopkgtest [17:06:19]: testbed dpkg architecture: armhf
 55s autopkgtest [17:06:21]: testbed apt version: 2.9.8
 55s autopkgtest [17:06:21]: @@@@@@@@@@@@@@@@@@@@ test bed setup
 64s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB]
 64s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [971 kB]
 65s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [17.2 kB]
 65s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [104 kB]
 65s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B]
 65s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [106 kB]
 65s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [647 kB]
 65s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [17.2 kB]
 65s Fetched 1943 kB in 1s (1464 kB/s)
 65s Reading package lists...
 83s tee: /proc/self/fd/2: Permission denied
105s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease
105s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease
105s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease
105s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease
107s Reading package lists...
107s Reading package lists...
107s Building dependency tree...
107s Reading state information...
108s Calculating upgrade...
108s The following packages were automatically installed and are no longer required:
108s   libperl5.38t64 perl-modules-5.38 python3-netifaces
108s Use 'apt autoremove' to remove them.
108s The following NEW packages will be installed:
108s   libperl5.40 perl-modules-5.40 python3.13-gdbm systemd-cryptsetup
108s The following packages will be upgraded:
108s   apport apport-core-dump-handler base-files base-passwd bash-completion
108s   dhcpcd-base distro-info-data dpkg dpkg-dev fwupd gcc-14-base info
108s   install-info iproute2 libarchive13t64 libatomic1 libattr1
108s   libblockdev-crypto3 libblockdev-fs3 libblockdev-loop3 libblockdev-mdraid3
108s   libblockdev-nvme3 libblockdev-part3 libblockdev-swap3 libblockdev-utils3
108s   libblockdev3 libbpf1 libbsd0 libbytesize-common libbytesize1 libdb5.3t64
108s   libdpkg-perl libdrm-common libdrm2 libdw1t64 libedit2 libelf1t64 libevdev2
108s   libfastjson4 libflashrom1 libftdi1-2 libfwupd2 libgcc-s1 libgnutls30t64
108s   libgpgme11t64 libinih1 libjson-c5 libjson-glib-1.0-0 libjson-glib-1.0-common
108s   libkeyutils1 libldap-common libldap2 liblocale-gettext-perl libmaxminddb0
108s   libmnl0 libnetfilter-conntrack3 libnetplan1 libnghttp2-14 libnspr4
108s   libnss-systemd libnvme1t64 libpam-systemd libpipeline1 libplymouth5
108s   libpng16-16t64 libpopt0 libpython3-stdlib libpython3.12-minimal
108s   libpython3.12-stdlib libsgutils2-1.46-2 libssh2-1t64 libstdc++6
108s   libsystemd-shared libsystemd0 libtext-charwidth-perl libtext-iconv-perl
108s   libtraceevent1 libtraceevent1-plugin libudev1 libudisks2-0 liburcu8t64
108s   libutempter0 libuv1t64 libx11-6 libx11-data libxau6 libxmlb2 mawk
108s   motd-news-config nano netplan-generator netplan.io openssh-client
108s   openssh-server openssh-sftp-server pci.ids perl perl-base plymouth
108s   plymouth-theme-ubuntu-text python3 python3-apport python3-certifi
108s   python3-cffi-backend python3-configobj python3-gdbm python3-gi python3-idna
108s   python3-jaraco.functools python3-json-pointer python3-jsonpatch
108s   python3-lazr.restfulclient python3-lazr.uri python3-minimal
108s   python3-more-itertools python3-netplan python3-oauthlib
108s   python3-problem-report python3-typeguard python3-urllib3 python3-wadllib
108s   python3-zipp python3.12 python3.12-gdbm python3.12-minimal sg3-utils
108s   sg3-utils-udev ssh-import-id systemd systemd-resolved systemd-sysv
108s   systemd-timesyncd tzdata udev udisks2 ufw usbutils vim-common vim-tiny xxd
108s 140 upgraded, 4 newly installed, 0 to remove and 0 not upgraded.
108s Need to get 45.4 MB of archives.
108s After this operation, 43.1 MB of additional disk space will be used.
108s Get:1 http://ftpmaster.internal/ubuntu plucky/main armhf motd-news-config all 13.5ubuntu3 [5190 B]
108s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf base-files armhf 13.5ubuntu3 [75.1 kB]
109s Get:3 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg armhf 1.22.11ubuntu3 [1247 kB]
109s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf perl-modules-5.40 all 5.40.0-7 [3214 kB]
109s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf libperl5.40 armhf 5.40.0-7 [4139 kB]
109s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf perl armhf 5.40.0-7 [263 kB]
109s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf perl-base armhf 5.40.0-7 [1674 kB]
109s Get:8 http://ftpmaster.internal/ubuntu plucky/main armhf liblocale-gettext-perl armhf 1.07-7build1 [15.0 kB]
109s Get:9 http://ftpmaster.internal/ubuntu plucky/main armhf libtext-iconv-perl armhf 1.7-8build4 [12.8 kB]
109s Get:10 http://ftpmaster.internal/ubuntu plucky/main armhf libtext-charwidth-perl armhf 0.04-11build4 [9128 B]
109s Get:11 http://ftpmaster.internal/ubuntu plucky/main armhf libdb5.3t64 armhf 5.3.28+dfsg2-9 [655 kB]
109s Get:12 http://ftpmaster.internal/ubuntu plucky/main armhf base-passwd armhf 3.6.5 [53.2 kB]
109s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3-minimal armhf 3.12.7-1 [27.4 kB]
109s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3 armhf 3.12.7-1 [24.0 kB]
109s Get:15 http://ftpmaster.internal/ubuntu plucky/main armhf tzdata all 2024b-1ubuntu2 [274 kB]
109s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12 armhf 3.12.7-3 [661 kB]
109s Get:17 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-stdlib armhf 3.12.7-3 [1934 kB]
109s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-minimal armhf 3.12.7-3 [2012 kB]
110s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-minimal armhf 3.12.7-3 [822 kB]
110s Get:20 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libpython3-stdlib armhf 3.12.7-1 [10.0 kB]
110s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf libnss-systemd armhf 256.5-2ubuntu4 [155 kB]
110s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-timesyncd armhf 256.5-2ubuntu4 [40.7 kB]
110s Get:23 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-resolved armhf 256.5-2ubuntu4 [309 kB]
110s Get:24 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd-shared armhf 256.5-2ubuntu4 [2129 kB]
110s Get:25 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd0 armhf 256.5-2ubuntu4 [428 kB]
110s Get:26 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-sysv armhf 256.5-2ubuntu4 [11.9 kB]
110s Get:27 http://ftpmaster.internal/ubuntu plucky/main armhf libpam-systemd armhf 256.5-2ubuntu4 [226 kB]
110s Get:28 http://ftpmaster.internal/ubuntu plucky/main armhf systemd armhf 256.5-2ubuntu4 [3442 kB]
110s Get:29 http://ftpmaster.internal/ubuntu plucky/main armhf udev armhf 256.5-2ubuntu4 [1949 kB]
110s Get:30 http://ftpmaster.internal/ubuntu plucky/main armhf libudev1 armhf 256.5-2ubuntu4 [188 kB]
110s Get:31 http://ftpmaster.internal/ubuntu plucky/main armhf python3-problem-report all 2.30.0-0ubuntu5 [25.0 kB]
110s Get:32 http://ftpmaster.internal/ubuntu plucky/main armhf python3-apport all 2.30.0-0ubuntu5 [93.2 kB]
110s Get:33 http://ftpmaster.internal/ubuntu plucky/main armhf python3-gi armhf 3.50.0-3 [227 kB]
110s Get:34 http://ftpmaster.internal/ubuntu plucky/main armhf apport-core-dump-handler all 2.30.0-0ubuntu5 [17.9 kB]
110s Get:35 http://ftpmaster.internal/ubuntu plucky/main armhf apport all 2.30.0-0ubuntu5 [83.0 kB]
110s Get:36 http://ftpmaster.internal/ubuntu plucky/main armhf libbsd0 armhf 0.12.2-2 [36.8 kB]
110s Get:37 http://ftpmaster.internal/ubuntu plucky/main armhf libedit2 armhf 3.1-20240808-1 [79.0 kB]
110s Get:38 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-sftp-server armhf 1:9.7p1-7ubuntu5 [35.4 kB]
110s Get:39 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-server armhf 1:9.7p1-7ubuntu5 [505 kB]
110s Get:40 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-client armhf 1:9.7p1-7ubuntu5 [889 kB]
110s Get:41 http://ftpmaster.internal/ubuntu plucky/main armhf libatomic1 armhf 14.2.0-8ubuntu1 [7846 B]
110s Get:42 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-14-base armhf 14.2.0-8ubuntu1 [51.5 kB]
110s Get:43 http://ftpmaster.internal/ubuntu plucky/main armhf libstdc++6 armhf 14.2.0-8ubuntu1 [711 kB]
110s Get:44 http://ftpmaster.internal/ubuntu plucky/main armhf libgcc-s1 armhf 14.2.0-8ubuntu1 [40.8 kB]
110s Get:45 http://ftpmaster.internal/ubuntu plucky/main armhf libattr1 armhf 1:2.5.2-2 [10.5 kB]
110s Get:46 http://ftpmaster.internal/ubuntu plucky/main armhf libgnutls30t64 armhf 3.8.8-2ubuntu1 [955 kB]
110s Get:47 http://ftpmaster.internal/ubuntu plucky/main armhf install-info armhf 7.1.1-1 [61.4 kB]
110s Get:48 http://ftpmaster.internal/ubuntu plucky/main armhf mawk armhf 1.3.4.20240905-1 [116 kB]
110s Get:49 http://ftpmaster.internal/ubuntu plucky/main armhf dhcpcd-base armhf 1:10.1.0-2 [188 kB]
110s Get:50 http://ftpmaster.internal/ubuntu plucky/main armhf distro-info-data all 0.63 [6588 B]
110s Get:51 http://ftpmaster.internal/ubuntu plucky/main armhf libdw1t64 armhf 0.192-4 [243 kB]
110s Get:52 http://ftpmaster.internal/ubuntu plucky/main armhf libelf1t64 armhf 0.192-4 [50.2 kB]
110s Get:53 http://ftpmaster.internal/ubuntu plucky/main armhf libbpf1 armhf 1:1.5.0-1 [158 kB]
110s Get:54 http://ftpmaster.internal/ubuntu plucky/main armhf libmnl0 armhf 1.0.5-3 [10.7 kB]
110s Get:55 http://ftpmaster.internal/ubuntu plucky/main armhf iproute2 armhf 6.10.0-2ubuntu1 [1082 kB]
110s Get:56 http://ftpmaster.internal/ubuntu plucky/main armhf libfastjson4 armhf 1.2304.0-2 [20.2 kB]
110s Get:57 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-c5 armhf 0.18+ds-1 [33.2 kB]
110s Get:58 http://ftpmaster.internal/ubuntu plucky/main armhf libkeyutils1 armhf 1.6.3-4ubuntu2 [8712 B]
110s Get:59 http://ftpmaster.internal/ubuntu plucky/main armhf netplan-generator armhf 1.1.1-1 [60.4 kB]
110s Get:60 http://ftpmaster.internal/ubuntu plucky/main armhf python3-cffi-backend armhf 1.17.1-2 [68.7 kB]
110s Get:61 http://ftpmaster.internal/ubuntu plucky/main armhf python3-netplan armhf 1.1.1-1 [24.1 kB]
110s Get:62 http://ftpmaster.internal/ubuntu plucky/main armhf netplan.io armhf 1.1.1-1 [66.4 kB]
110s Get:63 http://ftpmaster.internal/ubuntu plucky/main armhf libnetplan1 armhf 1.1.1-1 [122 kB]
110s Get:64 http://ftpmaster.internal/ubuntu plucky/main armhf libpopt0 armhf 1.19+dfsg-2 [25.4 kB]
110s Get:65 http://ftpmaster.internal/ubuntu plucky/main armhf vim-tiny armhf 2:9.1.0777-1ubuntu1 [693 kB]
110s Get:66 http://ftpmaster.internal/ubuntu plucky/main armhf vim-common all 2:9.1.0777-1ubuntu1 [394 kB]
110s Get:67 http://ftpmaster.internal/ubuntu plucky/main armhf xxd armhf 2:9.1.0777-1ubuntu1 [66.8 kB]
110s Get:68 http://ftpmaster.internal/ubuntu plucky/main armhf bash-completion all 1:2.14.0-2 [210 kB]
110s Get:69 http://ftpmaster.internal/ubuntu plucky/main armhf info armhf 7.1.1-1 [126 kB]
110s Get:70 http://ftpmaster.internal/ubuntu plucky/main armhf libdrm-common all 2.4.123-1 [8436 B]
110s Get:71 http://ftpmaster.internal/ubuntu plucky/main armhf libdrm2 armhf 2.4.123-1 [36.5 kB]
110s Get:72 http://ftpmaster.internal/ubuntu plucky/main armhf libevdev2 armhf 1.13.3+dfsg-1 [29.7 kB]
110s Get:73 http://ftpmaster.internal/ubuntu plucky/main armhf libmaxminddb0 armhf 1.11.0-1 [16.8 kB]
110s Get:74 http://ftpmaster.internal/ubuntu plucky/main armhf libnetfilter-conntrack3 armhf 1.1.0-1 [38.4 kB]
110s Get:75 http://ftpmaster.internal/ubuntu plucky/main armhf libnghttp2-14 armhf 1.64.0-1 [68.9 kB]
110s Get:76 http://ftpmaster.internal/ubuntu plucky/main armhf libpipeline1 armhf 1.5.8-1 [26.9 kB]
110s Get:77 http://ftpmaster.internal/ubuntu plucky/main armhf libpng16-16t64 armhf 1.6.44-2 [168 kB]
110s Get:78 http://ftpmaster.internal/ubuntu plucky/main armhf libplymouth5 armhf 24.004.60-1ubuntu11 [140 kB]
110s Get:79 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1-plugin armhf 1:1.8.3-1ubuntu1 [18.1 kB]
111s Get:80 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1 armhf 1:1.8.3-1ubuntu1 [52.1 kB]
111s Get:81 http://ftpmaster.internal/ubuntu plucky/main armhf liburcu8t64 armhf 0.14.1-1 [56.6 kB]
111s Get:82 http://ftpmaster.internal/ubuntu plucky/main armhf libuv1t64 armhf 1.48.0-7 [83.3 kB]
111s Get:83 http://ftpmaster.internal/ubuntu plucky/main armhf libx11-data all 2:1.8.10-2 [116 kB]
111s Get:84 http://ftpmaster.internal/ubuntu plucky/main armhf libx11-6 armhf 2:1.8.10-2 [587 kB]
111s Get:85 http://ftpmaster.internal/ubuntu plucky/main armhf libxau6 armhf 1:1.0.11-1 [6558 B]
111s Get:86 http://ftpmaster.internal/ubuntu plucky/main armhf nano armhf 8.2-1 [276 kB]
111s Get:87 http://ftpmaster.internal/ubuntu plucky/main armhf pci.ids all 0.0~2024.10.24-1 [279 kB]
111s Get:88 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth-theme-ubuntu-text armhf 24.004.60-1ubuntu11 [9920 B]
111s Get:89 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth armhf 24.004.60-1ubuntu11 [142 kB]
111s Get:90 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-gdbm armhf 3.12.7-3 [28.7 kB]
111s Get:91 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13-gdbm armhf 3.13.0-2 [29.5 kB]
111s Get:92 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3-gdbm armhf 3.12.7-1 [8642 B]
111s Get:93 http://ftpmaster.internal/ubuntu plucky/main armhf ufw all 0.36.2-8 [170 kB]
111s Get:94 http://ftpmaster.internal/ubuntu plucky/main armhf usbutils armhf 1:018-1 [76.1 kB]
111s Get:95 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg-dev all 1.22.11ubuntu3 [1088 kB]
111s Get:96 http://ftpmaster.internal/ubuntu plucky/main armhf libdpkg-perl all 1.22.11ubuntu3 [279 kB]
111s Get:97 http://ftpmaster.internal/ubuntu plucky/main armhf libarchive13t64 armhf 3.7.4-1.1 [331 kB]
111s Get:98 http://ftpmaster.internal/ubuntu plucky/main armhf libftdi1-2 armhf 1.5-7 [25.7 kB]
111s Get:99 http://ftpmaster.internal/ubuntu plucky/main armhf libflashrom1 armhf 1.4.0-3ubuntu1 [141 kB]
111s Get:100 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-common all 1.10.0+ds-3 [5586 B]
111s Get:101 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-0 armhf 1.10.0+ds-3 [61.7 kB]
111s Get:102 http://ftpmaster.internal/ubuntu plucky/main armhf libfwupd2 armhf 1.9.26-2 [125 kB]
111s Get:103 http://ftpmaster.internal/ubuntu plucky/main armhf libxmlb2 armhf 0.3.21-1 [57.7 kB]
111s Get:104 http://ftpmaster.internal/ubuntu plucky/main armhf fwupd armhf 1.9.26-2 [4404 kB]
112s Get:105 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-utils3 armhf 3.2.1-1 [17.4 kB]
112s Get:106 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-crypto3 armhf 3.2.1-1 [22.4 kB]
112s Get:107 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-fs3 armhf 3.2.1-1 [34.3 kB]
112s Get:108 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-loop3 armhf 3.2.1-1 [6552 B]
112s Get:109 http://ftpmaster.internal/ubuntu plucky/main armhf libbytesize1 armhf 2.11-1ubuntu1 [12.0 kB]
112s Get:110 http://ftpmaster.internal/ubuntu plucky/main armhf libbytesize-common all 2.11-1ubuntu1 [3584 B]
112s Get:111 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-mdraid3 armhf 3.2.1-1 [13.4 kB]
112s Get:112 http://ftpmaster.internal/ubuntu plucky/main armhf libnvme1t64 armhf 1.11-1 [73.8 kB]
112s Get:113 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-nvme3 armhf 3.2.1-1 [17.6 kB]
112s Get:114 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-part3 armhf 3.2.1-1 [16.5 kB]
112s Get:115 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-swap3 armhf 3.2.1-1 [8952 B]
112s Get:116 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev3 armhf 3.2.1-1 [44.2 kB]
112s Get:117 http://ftpmaster.internal/ubuntu plucky/main armhf libgpgme11t64 armhf 1.23.2-5ubuntu4 [123 kB]
112s Get:118 http://ftpmaster.internal/ubuntu plucky/main armhf libinih1 armhf 58-1ubuntu1 [6750 B]
112s Get:119 http://ftpmaster.internal/ubuntu plucky/main armhf libldap-common all 2.6.8+dfsg-1~exp4ubuntu3 [32.3 kB]
112s Get:120 http://ftpmaster.internal/ubuntu plucky/main armhf libldap2 armhf 2.6.8+dfsg-1~exp4ubuntu3 [173 kB]
112s Get:121 http://ftpmaster.internal/ubuntu plucky/main armhf libnspr4 armhf 2:4.35-1.1ubuntu2 [94.1 kB]
112s Get:122 http://ftpmaster.internal/ubuntu plucky/main armhf libsgutils2-1.46-2 armhf 1.46-3ubuntu5 [82.5 kB]
112s Get:123 http://ftpmaster.internal/ubuntu plucky/main armhf libssh2-1t64 armhf 1.11.1-1 [116 kB]
112s Get:124 http://ftpmaster.internal/ubuntu plucky/main armhf udisks2 armhf 2.10.1-11ubuntu1 [278 kB]
112s Get:125 http://ftpmaster.internal/ubuntu plucky/main armhf libudisks2-0 armhf 2.10.1-11ubuntu1 [142 kB]
112s Get:126 http://ftpmaster.internal/ubuntu plucky/main armhf libutempter0 armhf 1.2.1-4 [9062 B]
112s Get:127 http://ftpmaster.internal/ubuntu plucky/main armhf python3-certifi all 2024.8.30+dfsg-1 [9742 B]
112s Get:128 http://ftpmaster.internal/ubuntu plucky/main armhf python3-configobj all 5.0.9-1 [33.9 kB]
112s Get:129 http://ftpmaster.internal/ubuntu plucky/main armhf python3-idna all 3.8-2 [47.0 kB]
112s Get:130 http://ftpmaster.internal/ubuntu plucky/main armhf python3-more-itertools all 10.5.0-1 [56.2 kB]
112s Get:131 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jaraco.functools all 4.1.0-1 [11.8 kB]
112s Get:132 http://ftpmaster.internal/ubuntu plucky/main armhf python3-json-pointer all 2.4-2 [8396 B]
112s Get:133 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jsonpatch all 1.32-4 [12.2 kB]
112s Get:134 http://ftpmaster.internal/ubuntu plucky/main armhf python3-lazr.uri all 1.0.6-4 [13.6 kB]
112s Get:135 http://ftpmaster.internal/ubuntu plucky/main armhf python3-wadllib all 2.0.0-1 [36.7 kB]
112s Get:136 http://ftpmaster.internal/ubuntu plucky/main armhf python3-oauthlib all 3.2.2-2 [89.8 kB]
112s Get:137 http://ftpmaster.internal/ubuntu plucky/main armhf python3-lazr.restfulclient all 0.14.6-2 [50.9 kB]
112s Get:138 http://ftpmaster.internal/ubuntu plucky/main armhf python3-typeguard all 4.4.1-1 [29.0 kB]
112s Get:139 http://ftpmaster.internal/ubuntu plucky/main armhf python3-urllib3 all 2.0.7-2ubuntu0.1 [93.1 kB]
112s Get:140 http://ftpmaster.internal/ubuntu plucky/main armhf python3-zipp all 3.21.0-1 [10.2 kB]
112s Get:141 http://ftpmaster.internal/ubuntu plucky/main armhf sg3-utils armhf 1.46-3ubuntu5 [816 kB]
112s Get:142 http://ftpmaster.internal/ubuntu plucky/main armhf sg3-utils-udev all 1.46-3ubuntu5 [5916 B]
112s Get:143 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-cryptsetup armhf 256.5-2ubuntu4 [122 kB]
112s Get:144 http://ftpmaster.internal/ubuntu plucky/main armhf ssh-import-id all 5.11-0ubuntu3 [10.1 kB]
113s Preconfiguring packages ...
113s Fetched 45.4 MB in 4s (11.2 MB/s)
113s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 59386 files and directories currently installed.)
113s Preparing to unpack .../motd-news-config_13.5ubuntu3_all.deb ...
113s Unpacking motd-news-config (13.5ubuntu3) over (13.3ubuntu6) ...
113s Preparing to unpack .../base-files_13.5ubuntu3_armhf.deb ...
113s Unpacking base-files (13.5ubuntu3) over (13.3ubuntu6) ...
113s Setting up base-files (13.5ubuntu3) ...
113s Installing new version of config file /etc/issue ...
113s Installing new version of config file /etc/issue.net ...
113s Installing new version of config file /etc/lsb-release ...
114s motd-news.service is a disabled or a static unit not running, not starting it.
114s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 59386 files and directories currently installed.)
114s Preparing to unpack .../dpkg_1.22.11ubuntu3_armhf.deb ...
114s Unpacking dpkg (1.22.11ubuntu3) over (1.22.11ubuntu1) ...
114s Setting up dpkg (1.22.11ubuntu3) ...
115s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 59386 files and directories currently installed.)
115s Preparing to unpack .../perl_5.40.0-7_armhf.deb ...
115s Unpacking perl (5.40.0-7) over (5.38.2-5) ...
115s Selecting previously unselected package perl-modules-5.40.
115s Preparing to unpack .../perl-modules-5.40_5.40.0-7_all.deb ...
115s Unpacking perl-modules-5.40 (5.40.0-7) ...
115s Selecting previously unselected package libperl5.40:armhf.
115s Preparing to unpack .../libperl5.40_5.40.0-7_armhf.deb ...
115s Unpacking libperl5.40:armhf (5.40.0-7) ...
115s Preparing to unpack .../perl-base_5.40.0-7_armhf.deb ...
115s Unpacking perl-base (5.40.0-7) over (5.38.2-5) ...
116s Setting up perl-base (5.40.0-7) ...
116s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61464 files and directories currently installed.)
116s Preparing to unpack .../liblocale-gettext-perl_1.07-7build1_armhf.deb ...
116s Unpacking liblocale-gettext-perl (1.07-7build1) over (1.07-7) ...
116s Preparing to unpack .../libtext-iconv-perl_1.7-8build4_armhf.deb ...
116s Unpacking libtext-iconv-perl:armhf (1.7-8build4) over (1.7-8build3) ...
116s Preparing to unpack .../libtext-charwidth-perl_0.04-11build4_armhf.deb ...
116s Unpacking libtext-charwidth-perl:armhf (0.04-11build4) over (0.04-11build3) ...
116s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-9_armhf.deb ...
116s Unpacking libdb5.3t64:armhf (5.3.28+dfsg2-9) over (5.3.28+dfsg2-7) ...
116s Setting up libdb5.3t64:armhf (5.3.28+dfsg2-9) ...
116s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61464 files and directories currently installed.)
116s Preparing to unpack .../base-passwd_3.6.5_armhf.deb ...
116s Unpacking base-passwd (3.6.5) over (3.6.4) ...
116s Setting up base-passwd (3.6.5) ...
116s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61465 files and directories currently installed.)
116s Preparing to unpack .../python3-minimal_3.12.7-1_armhf.deb ...
116s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ...
116s Setting up python3-minimal (3.12.7-1) ...
116s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61465 files and directories currently installed.)
116s Preparing to unpack .../00-python3_3.12.7-1_armhf.deb ...
116s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ...
116s Preparing to unpack .../01-tzdata_2024b-1ubuntu2_all.deb ...
116s Unpacking tzdata (2024b-1ubuntu2) over (2024a-4ubuntu1) ...
117s Preparing to unpack .../02-python3.12_3.12.7-3_armhf.deb ...
117s Unpacking python3.12 (3.12.7-3) over (3.12.7-1) ...
117s Preparing to unpack .../03-libpython3.12-stdlib_3.12.7-3_armhf.deb ...
117s Unpacking libpython3.12-stdlib:armhf (3.12.7-3) over (3.12.7-1) ...
117s Preparing to unpack .../04-python3.12-minimal_3.12.7-3_armhf.deb ...
117s Unpacking python3.12-minimal (3.12.7-3) over (3.12.7-1) ...
117s Preparing to unpack .../05-libpython3.12-minimal_3.12.7-3_armhf.deb ...
117s Unpacking libpython3.12-minimal:armhf (3.12.7-3) over (3.12.7-1) ...
117s Preparing to unpack .../06-libpython3-stdlib_3.12.7-1_armhf.deb ...
117s Unpacking libpython3-stdlib:armhf (3.12.7-1) over (3.12.6-0ubuntu1) ...
117s Preparing to unpack .../07-libnss-systemd_256.5-2ubuntu4_armhf.deb ...
117s Unpacking libnss-systemd:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../08-systemd-timesyncd_256.5-2ubuntu4_armhf.deb ...
117s Unpacking systemd-timesyncd (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../09-systemd-resolved_256.5-2ubuntu4_armhf.deb ...
117s Unpacking systemd-resolved (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../10-libsystemd-shared_256.5-2ubuntu4_armhf.deb ...
117s Unpacking libsystemd-shared:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../11-libsystemd0_256.5-2ubuntu4_armhf.deb ...
117s Unpacking libsystemd0:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Setting up libsystemd0:armhf (256.5-2ubuntu4) ...
117s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61464 files and directories currently installed.)
117s Preparing to unpack .../systemd-sysv_256.5-2ubuntu4_armhf.deb ...
117s Unpacking systemd-sysv (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../libpam-systemd_256.5-2ubuntu4_armhf.deb ...
117s Unpacking libpam-systemd:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
117s Preparing to unpack .../systemd_256.5-2ubuntu4_armhf.deb ...
118s Unpacking systemd (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
118s Preparing to unpack .../udev_256.5-2ubuntu4_armhf.deb ...
118s Unpacking udev (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
118s Preparing to unpack .../libudev1_256.5-2ubuntu4_armhf.deb ...
118s Unpacking libudev1:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ...
118s Setting up libudev1:armhf (256.5-2ubuntu4) ...
118s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61464 files and directories currently installed.)
118s Preparing to unpack .../0-python3-problem-report_2.30.0-0ubuntu5_all.deb ...
118s Unpacking python3-problem-report (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ...
118s Preparing to unpack .../1-python3-apport_2.30.0-0ubuntu5_all.deb ...
118s Unpacking python3-apport (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ...
118s Preparing to unpack .../2-python3-gi_3.50.0-3_armhf.deb ...
119s Unpacking python3-gi (3.50.0-3) over (3.48.2-1) ...
119s Preparing to unpack .../3-apport-core-dump-handler_2.30.0-0ubuntu5_all.deb ...
119s Unpacking apport-core-dump-handler (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ...
119s Preparing to unpack .../4-apport_2.30.0-0ubuntu5_all.deb ...
119s Unpacking apport (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ...
119s Preparing to unpack .../5-libbsd0_0.12.2-2_armhf.deb ...
119s Unpacking libbsd0:armhf (0.12.2-2) over (0.12.2-1) ...
119s Setting up libbsd0:armhf (0.12.2-2) ...
119s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
119s Preparing to unpack .../0-libedit2_3.1-20240808-1_armhf.deb ...
119s Unpacking libedit2:armhf (3.1-20240808-1) over (3.1-20240517-1) ...
119s Preparing to unpack .../1-openssh-sftp-server_1%3a9.7p1-7ubuntu5_armhf.deb ...
119s Unpacking openssh-sftp-server (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ...
119s Preparing to unpack .../2-openssh-server_1%3a9.7p1-7ubuntu5_armhf.deb ...
119s Unpacking openssh-server (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ...
119s Preparing to unpack .../3-openssh-client_1%3a9.7p1-7ubuntu5_armhf.deb ...
119s Unpacking openssh-client (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ...
119s Preparing to unpack .../4-libatomic1_14.2.0-8ubuntu1_armhf.deb ...
119s Unpacking libatomic1:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ...
119s Preparing to unpack .../5-gcc-14-base_14.2.0-8ubuntu1_armhf.deb ...
119s Unpacking gcc-14-base:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ...
119s Setting up gcc-14-base:armhf (14.2.0-8ubuntu1) ...
119s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
119s Preparing to unpack .../libstdc++6_14.2.0-8ubuntu1_armhf.deb ...
119s Unpacking libstdc++6:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ...
119s Setting up libstdc++6:armhf (14.2.0-8ubuntu1) ...
119s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
119s Preparing to unpack .../libgcc-s1_14.2.0-8ubuntu1_armhf.deb ...
119s Unpacking libgcc-s1:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ...
119s Setting up libgcc-s1:armhf (14.2.0-8ubuntu1) ...
119s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
119s Preparing to unpack .../libattr1_1%3a2.5.2-2_armhf.deb ...
119s Unpacking libattr1:armhf (1:2.5.2-2) over (1:2.5.2-1build2) ...
119s Setting up libattr1:armhf (1:2.5.2-2) ...
119s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
120s Preparing to unpack .../libgnutls30t64_3.8.8-2ubuntu1_armhf.deb ...
120s Unpacking libgnutls30t64:armhf (3.8.8-2ubuntu1) over (3.8.6-2ubuntu1) ...
120s Setting up libgnutls30t64:armhf (3.8.8-2ubuntu1) ...
120s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
120s Preparing to unpack .../install-info_7.1.1-1_armhf.deb ...
120s Unpacking install-info (7.1.1-1) over (7.1-3build2) ...
120s Setting up install-info (7.1.1-1) ...
120s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61456 files and directories currently installed.)
120s Preparing to unpack .../00-mawk_1.3.4.20240905-1_armhf.deb ...
120s Unpacking mawk (1.3.4.20240905-1) over (1.3.4.20240622-2) ...
120s Preparing to unpack .../01-dhcpcd-base_1%3a10.1.0-2_armhf.deb ...
120s Unpacking dhcpcd-base (1:10.1.0-2) over (1:10.0.8-3) ...
120s Preparing to unpack .../02-distro-info-data_0.63_all.deb ...
120s Unpacking distro-info-data (0.63) over (0.62) ...
120s Preparing to unpack .../03-libdw1t64_0.192-4_armhf.deb ...
120s Unpacking libdw1t64:armhf (0.192-4) over (0.191-2) ...
120s Preparing to unpack .../04-libelf1t64_0.192-4_armhf.deb ...
120s Unpacking libelf1t64:armhf (0.192-4) over (0.191-2) ...
120s Preparing to unpack .../05-libbpf1_1%3a1.5.0-1_armhf.deb ...
120s Unpacking libbpf1:armhf (1:1.5.0-1) over (1:1.4.5-1) ...
120s Preparing to unpack .../06-libmnl0_1.0.5-3_armhf.deb ...
120s Unpacking libmnl0:armhf (1.0.5-3) over (1.0.5-2build1) ...
120s Preparing to unpack .../07-iproute2_6.10.0-2ubuntu1_armhf.deb ...
120s Unpacking iproute2 (6.10.0-2ubuntu1) over (6.10.0-2) ...
120s Preparing to unpack .../08-libfastjson4_1.2304.0-2_armhf.deb ...
120s Unpacking libfastjson4:armhf (1.2304.0-2) over (1.2304.0-1build1) ...
120s Preparing to unpack .../09-libjson-c5_0.18+ds-1_armhf.deb ...
120s Unpacking libjson-c5:armhf (0.18+ds-1) over (0.17-1build1) ...
120s Preparing to unpack .../10-libkeyutils1_1.6.3-4ubuntu2_armhf.deb ...
120s Unpacking libkeyutils1:armhf (1.6.3-4ubuntu2) over (1.6.3-3build1) ...
120s Preparing to unpack .../11-netplan-generator_1.1.1-1_armhf.deb ...
120s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator'
120s Unpacking netplan-generator (1.1.1-1) over (1.1-1) ...
120s Preparing to unpack .../12-python3-cffi-backend_1.17.1-2_armhf.deb ...
120s Unpacking python3-cffi-backend:armhf (1.17.1-2) over (1.17.1-1) ...
120s Preparing to unpack .../13-python3-netplan_1.1.1-1_armhf.deb ...
120s Unpacking python3-netplan (1.1.1-1) over (1.1-1) ...
120s Preparing to unpack .../14-netplan.io_1.1.1-1_armhf.deb ...
120s Unpacking netplan.io (1.1.1-1) over (1.1-1) ...
121s Preparing to unpack .../15-libnetplan1_1.1.1-1_armhf.deb ...
121s Unpacking libnetplan1:armhf (1.1.1-1) over (1.1-1) ...
121s Preparing to unpack .../16-libpopt0_1.19+dfsg-2_armhf.deb ...
121s Unpacking libpopt0:armhf (1.19+dfsg-2) over (1.19+dfsg-1build1) ...
121s Preparing to unpack .../17-vim-tiny_2%3a9.1.0777-1ubuntu1_armhf.deb ...
121s Unpacking vim-tiny (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ...
121s Preparing to unpack .../18-vim-common_2%3a9.1.0777-1ubuntu1_all.deb ...
121s Unpacking vim-common (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ...
121s Preparing to unpack .../19-xxd_2%3a9.1.0777-1ubuntu1_armhf.deb ...
121s Unpacking xxd (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ...
121s Preparing to unpack .../20-bash-completion_1%3a2.14.0-2_all.deb ...
121s Unpacking bash-completion (1:2.14.0-2) over (1:2.14.0-1) ...
121s Preparing to unpack .../21-info_7.1.1-1_armhf.deb ...
121s Unpacking info (7.1.1-1) over (7.1-3build2) ...
121s Preparing to unpack .../22-libdrm-common_2.4.123-1_all.deb ...
121s Unpacking libdrm-common (2.4.123-1) over (2.4.122-1) ...
121s Preparing to unpack .../23-libdrm2_2.4.123-1_armhf.deb ...
121s Unpacking libdrm2:armhf (2.4.123-1) over (2.4.122-1) ...
121s Preparing to unpack .../24-libevdev2_1.13.3+dfsg-1_armhf.deb ...
121s Unpacking libevdev2:armhf (1.13.3+dfsg-1) over (1.13.2+dfsg-1) ...
121s Preparing to unpack .../25-libmaxminddb0_1.11.0-1_armhf.deb ...
121s Unpacking libmaxminddb0:armhf (1.11.0-1) over (1.10.0-1) ...
121s Preparing to unpack .../26-libnetfilter-conntrack3_1.1.0-1_armhf.deb ...
121s Unpacking libnetfilter-conntrack3:armhf (1.1.0-1) over (1.0.9-6build1) ...
121s Preparing to unpack .../27-libnghttp2-14_1.64.0-1_armhf.deb ...
121s Unpacking libnghttp2-14:armhf (1.64.0-1) over (1.62.1-2) ...
121s Preparing to unpack .../28-libpipeline1_1.5.8-1_armhf.deb ...
121s Unpacking libpipeline1:armhf (1.5.8-1) over (1.5.7-2) ...
121s Preparing to unpack .../29-libpng16-16t64_1.6.44-2_armhf.deb ...
121s Unpacking libpng16-16t64:armhf (1.6.44-2) over (1.6.44-1) ...
121s Preparing to unpack .../30-libplymouth5_24.004.60-1ubuntu11_armhf.deb ...
121s Unpacking libplymouth5:armhf (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ...
121s Preparing to unpack .../31-libtraceevent1-plugin_1%3a1.8.3-1ubuntu1_armhf.deb ...
121s Unpacking libtraceevent1-plugin:armhf (1:1.8.3-1ubuntu1) over (1:1.8.2-1ubuntu3) ...
121s Preparing to unpack .../32-libtraceevent1_1%3a1.8.3-1ubuntu1_armhf.deb ...
121s Unpacking libtraceevent1:armhf (1:1.8.3-1ubuntu1) over (1:1.8.2-1ubuntu3) ...
121s Preparing to unpack .../33-liburcu8t64_0.14.1-1_armhf.deb ...
121s Unpacking liburcu8t64:armhf (0.14.1-1) over (0.14.0-4) ...
121s Preparing to unpack .../34-libuv1t64_1.48.0-7_armhf.deb ...
121s Unpacking libuv1t64:armhf (1.48.0-7) over (1.48.0-5) ...
121s Preparing to unpack .../35-libx11-data_2%3a1.8.10-2_all.deb ...
121s Unpacking libx11-data (2:1.8.10-2) over (2:1.8.7-1build1) ...
122s Preparing to unpack .../36-libx11-6_2%3a1.8.10-2_armhf.deb ...
122s Unpacking libx11-6:armhf (2:1.8.10-2) over (2:1.8.7-1build1) ...
122s Preparing to unpack .../37-libxau6_1%3a1.0.11-1_armhf.deb ...
122s Unpacking libxau6:armhf (1:1.0.11-1) over (1:1.0.9-1build6) ...
122s Preparing to unpack .../38-nano_8.2-1_armhf.deb ...
122s Unpacking nano (8.2-1) over (8.1-1) ...
122s Preparing to unpack .../39-pci.ids_0.0~2024.10.24-1_all.deb ...
122s Unpacking pci.ids (0.0~2024.10.24-1) over (0.0~2024.09.12-1) ...
122s Preparing to unpack .../40-plymouth-theme-ubuntu-text_24.004.60-1ubuntu11_armhf.deb ...
122s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ...
122s Preparing to unpack .../41-plymouth_24.004.60-1ubuntu11_armhf.deb ...
122s Unpacking plymouth (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ...
122s Preparing to unpack .../42-python3.12-gdbm_3.12.7-3_armhf.deb ...
122s Unpacking python3.12-gdbm (3.12.7-3) over (3.12.7-1) ...
122s Selecting previously unselected package python3.13-gdbm.
122s Preparing to unpack .../43-python3.13-gdbm_3.13.0-2_armhf.deb ...
122s Unpacking python3.13-gdbm (3.13.0-2) ...
122s Preparing to unpack .../44-python3-gdbm_3.12.7-1_armhf.deb ...
122s Unpacking python3-gdbm:armhf (3.12.7-1) over (3.12.6-1ubuntu1) ...
122s Preparing to unpack .../45-ufw_0.36.2-8_all.deb ...
122s Unpacking ufw (0.36.2-8) over (0.36.2-6) ...
122s Preparing to unpack .../46-usbutils_1%3a018-1_armhf.deb ...
122s Unpacking usbutils (1:018-1) over (1:017-3build1) ...
122s Preparing to unpack .../47-dpkg-dev_1.22.11ubuntu3_all.deb ...
122s Unpacking dpkg-dev (1.22.11ubuntu3) over (1.22.11ubuntu1) ...
122s Preparing to unpack .../48-libdpkg-perl_1.22.11ubuntu3_all.deb ...
122s Unpacking libdpkg-perl (1.22.11ubuntu3) over (1.22.11ubuntu1) ...
122s Preparing to unpack .../49-libarchive13t64_3.7.4-1.1_armhf.deb ...
122s Unpacking libarchive13t64:armhf (3.7.4-1.1) over (3.7.4-1) ...
122s Preparing to unpack .../50-libftdi1-2_1.5-7_armhf.deb ...
122s Unpacking libftdi1-2:armhf (1.5-7) over (1.5-6build5) ...
122s Preparing to unpack .../51-libflashrom1_1.4.0-3ubuntu1_armhf.deb ...
122s Unpacking libflashrom1:armhf (1.4.0-3ubuntu1) over (1.3.0-2.1ubuntu2) ...
122s Preparing to unpack .../52-libjson-glib-1.0-common_1.10.0+ds-3_all.deb ...
122s Unpacking libjson-glib-1.0-common (1.10.0+ds-3) over (1.8.0-2build2) ...
123s Preparing to unpack .../53-libjson-glib-1.0-0_1.10.0+ds-3_armhf.deb ...
123s Unpacking libjson-glib-1.0-0:armhf (1.10.0+ds-3) over (1.8.0-2build2) ...
123s Preparing to unpack .../54-libfwupd2_1.9.26-2_armhf.deb ...
123s Unpacking libfwupd2:armhf (1.9.26-2) over (1.9.24-1) ...
123s Preparing to unpack .../55-libxmlb2_0.3.21-1_armhf.deb ...
123s Unpacking libxmlb2:armhf (0.3.21-1) over (0.3.19-1) ...
123s Preparing to unpack .../56-fwupd_1.9.26-2_armhf.deb ...
123s Unpacking fwupd (1.9.26-2) over (1.9.24-1) ...
123s Preparing to unpack .../57-libblockdev-utils3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-utils3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../58-libblockdev-crypto3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-crypto3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../59-libblockdev-fs3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-fs3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../60-libblockdev-loop3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-loop3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../61-libbytesize1_2.11-1ubuntu1_armhf.deb ...
123s Unpacking libbytesize1:armhf (2.11-1ubuntu1) over (2.10-1ubuntu2) ...
123s Preparing to unpack .../62-libbytesize-common_2.11-1ubuntu1_all.deb ...
123s Unpacking libbytesize-common (2.11-1ubuntu1) over (2.10-1ubuntu2) ...
123s Preparing to unpack .../63-libblockdev-mdraid3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-mdraid3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../64-libnvme1t64_1.11-1_armhf.deb ...
123s Unpacking libnvme1t64 (1.11-1) over (1.10-1) ...
123s Preparing to unpack .../65-libblockdev-nvme3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-nvme3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../66-libblockdev-part3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-part3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../67-libblockdev-swap3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev-swap3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../68-libblockdev3_3.2.1-1_armhf.deb ...
123s Unpacking libblockdev3:armhf (3.2.1-1) over (3.1.1-2) ...
123s Preparing to unpack .../69-libgpgme11t64_1.23.2-5ubuntu4_armhf.deb ...
123s Unpacking libgpgme11t64:armhf (1.23.2-5ubuntu4) over (1.18.0-4.1ubuntu4) ...
123s Preparing to unpack .../70-libinih1_58-1ubuntu1_armhf.deb ...
123s Unpacking libinih1:armhf (58-1ubuntu1) over (55-1ubuntu2) ...
123s Preparing to unpack .../71-libldap-common_2.6.8+dfsg-1~exp4ubuntu3_all.deb ...
123s Unpacking libldap-common (2.6.8+dfsg-1~exp4ubuntu3) over (2.6.8+dfsg-1~exp4ubuntu1) ...
123s Preparing to unpack .../72-libldap2_2.6.8+dfsg-1~exp4ubuntu3_armhf.deb ...
123s Unpacking libldap2:armhf (2.6.8+dfsg-1~exp4ubuntu3) over (2.6.8+dfsg-1~exp4ubuntu1) ...
123s Preparing to unpack .../73-libnspr4_2%3a4.35-1.1ubuntu2_armhf.deb ...
123s Unpacking libnspr4:armhf (2:4.35-1.1ubuntu2) over (2:4.35-1.1ubuntu1) ...
123s Preparing to unpack .../74-libsgutils2-1.46-2_1.46-3ubuntu5_armhf.deb ...
123s Unpacking libsgutils2-1.46-2:armhf (1.46-3ubuntu5) over (1.46-3ubuntu4) ...
123s Preparing to unpack .../75-libssh2-1t64_1.11.1-1_armhf.deb ...
123s Unpacking libssh2-1t64:armhf (1.11.1-1) over (1.11.0-7) ...
123s Preparing to unpack .../76-udisks2_2.10.1-11ubuntu1_armhf.deb ...
123s Unpacking udisks2 (2.10.1-11ubuntu1) over (2.10.1-9ubuntu2) ...
124s Preparing to unpack .../77-libudisks2-0_2.10.1-11ubuntu1_armhf.deb ...
124s Unpacking libudisks2-0:armhf (2.10.1-11ubuntu1) over (2.10.1-9ubuntu2) ...
124s Preparing to unpack .../78-libutempter0_1.2.1-4_armhf.deb ...
124s Unpacking libutempter0:armhf (1.2.1-4) over (1.2.1-3build1) ...
124s Preparing to unpack .../79-python3-certifi_2024.8.30+dfsg-1_all.deb ...
124s Unpacking python3-certifi (2024.8.30+dfsg-1) over (2024.6.2-1) ...
124s Preparing to unpack .../80-python3-configobj_5.0.9-1_all.deb ...
124s Unpacking python3-configobj (5.0.9-1) over (5.0.8-3) ...
124s Preparing to unpack .../81-python3-idna_3.8-2_all.deb ...
124s Unpacking python3-idna (3.8-2) over (3.6-2.1) ...
124s Preparing to unpack .../82-python3-more-itertools_10.5.0-1_all.deb ...
124s Unpacking python3-more-itertools (10.5.0-1) over (10.3.0-1) ...
124s Preparing to unpack .../83-python3-jaraco.functools_4.1.0-1_all.deb ...
124s Unpacking python3-jaraco.functools (4.1.0-1) over (4.0.2-1) ...
124s Preparing to unpack .../84-python3-json-pointer_2.4-2_all.deb ...
124s Unpacking python3-json-pointer (2.4-2) over (2.0-0ubuntu1) ...
124s Preparing to unpack .../85-python3-jsonpatch_1.32-4_all.deb ...
124s Unpacking python3-jsonpatch (1.32-4) over (1.32-3) ...
124s Preparing to unpack .../86-python3-lazr.uri_1.0.6-4_all.deb ...
124s Unpacking python3-lazr.uri (1.0.6-4) over (1.0.6-3) ...
124s Preparing to unpack .../87-python3-wadllib_2.0.0-1_all.deb ...
124s Unpacking python3-wadllib (2.0.0-1) over (1.3.6-5) ...
125s Preparing to unpack .../88-python3-oauthlib_3.2.2-2_all.deb ...
125s Unpacking python3-oauthlib (3.2.2-2) over (3.2.2-1) ...
125s Preparing to unpack .../89-python3-lazr.restfulclient_0.14.6-2_all.deb ...
125s Unpacking python3-lazr.restfulclient (0.14.6-2) over (0.14.6-1) ...
125s Preparing to unpack .../90-python3-typeguard_4.4.1-1_all.deb ...
125s Unpacking python3-typeguard (4.4.1-1) over (4.3.0-1) ...
125s Preparing to unpack .../91-python3-urllib3_2.0.7-2ubuntu0.1_all.deb ...
125s Unpacking python3-urllib3 (2.0.7-2ubuntu0.1) over (2.0.7-2) ...
125s Preparing to unpack .../92-python3-zipp_3.21.0-1_all.deb ...
125s Unpacking python3-zipp (3.21.0-1) over (3.20.0-1) ...
125s Preparing to unpack .../93-sg3-utils_1.46-3ubuntu5_armhf.deb ...
125s Unpacking sg3-utils (1.46-3ubuntu5) over (1.46-3ubuntu4) ...
125s Preparing to unpack .../94-sg3-utils-udev_1.46-3ubuntu5_all.deb ...
125s Unpacking sg3-utils-udev (1.46-3ubuntu5) over (1.46-3ubuntu4) ...
125s Selecting previously unselected package systemd-cryptsetup.
125s Preparing to unpack .../95-systemd-cryptsetup_256.5-2ubuntu4_armhf.deb ...
125s Unpacking systemd-cryptsetup (256.5-2ubuntu4) ...
125s Preparing to unpack .../96-ssh-import-id_5.11-0ubuntu3_all.deb ...
125s Unpacking ssh-import-id (5.11-0ubuntu3) over (5.11-0ubuntu2) ...
125s Setting up libpipeline1:armhf (1.5.8-1) ...
125s Setting up motd-news-config (13.5ubuntu3) ...
125s Setting up libtext-iconv-perl:armhf (1.7-8build4) ...
125s Setting up libtext-charwidth-perl:armhf (0.04-11build4) ...
125s Setting up liburcu8t64:armhf (0.14.1-1) ...
125s Setting up libxau6:armhf (1:1.0.11-1) ...
125s Setting up libkeyutils1:armhf (1.6.3-4ubuntu2) ...
125s Setting up pci.ids (0.0~2024.10.24-1) ...
125s Setting up distro-info-data (0.63) ...
125s Setting up libfastjson4:armhf (1.2304.0-2) ...
125s Setting up libinih1:armhf (58-1ubuntu1) ...
125s Setting up libmaxminddb0:armhf (1.11.0-1) ...
125s Setting up python3.12-gdbm (3.12.7-3) ...
125s Setting up libxmlb2:armhf (0.3.21-1) ...
125s Setting up libedit2:armhf (3.1-20240808-1) ...
125s Setting up libuv1t64:armhf (1.48.0-7) ...
125s Setting up libpython3.12-minimal:armhf (3.12.7-3) ...
125s Setting up libnghttp2-14:armhf (1.64.0-1) ...
125s Setting up libsgutils2-1.46-2:armhf (1.46-3ubuntu5) ...
125s Setting up libnetplan1:armhf (1.1.1-1) ...
125s Setting up libldap-common (2.6.8+dfsg-1~exp4ubuntu3) ...
125s Setting up usbutils (1:018-1) ...
125s Setting up xxd (2:9.1.0777-1ubuntu1) ...
125s Setting up libelf1t64:armhf (0.192-4) ...
125s Setting up libdw1t64:armhf (0.192-4) ...
125s Setting up tzdata (2024b-1ubuntu2) ...
125s 
125s Current default time zone: 'Etc/UTC'
125s Local time is now:      Wed Nov 13 17:07:31 UTC 2024.
125s Universal Time is now:  Wed Nov 13 17:07:31 UTC 2024.
125s Run 'dpkg-reconfigure tzdata' if you wish to change it.
125s 
125s Setting up libftdi1-2:armhf (1.5-7) ...
125s Setting up libflashrom1:armhf (1.4.0-3ubuntu1) ...
125s Setting up vim-common (2:9.1.0777-1ubuntu1) ...
125s Installing new version of config file /etc/vim/vimrc ...
125s Setting up libx11-data (2:1.8.10-2) ...
125s Setting up libnspr4:armhf (2:4.35-1.1ubuntu2) ...
125s Setting up bash-completion (1:2.14.0-2) ...
125s Setting up libbytesize-common (2.11-1ubuntu1) ...
125s Setting up libblockdev-utils3:armhf (3.2.1-1) ...
125s Setting up libpng16-16t64:armhf (1.6.44-2) ...
125s Setting up libmnl0:armhf (1.0.5-3) ...
125s Setting up libatomic1:armhf (14.2.0-8ubuntu1) ...
125s Setting up libsystemd-shared:armhf (256.5-2ubuntu4) ...
125s Setting up dhcpcd-base (1:10.1.0-2) ...
125s Setting up libutempter0:armhf (1.2.1-4) ...
125s Setting up nano (8.2-1) ...
125s Setting up libblockdev-fs3:armhf (3.2.1-1) ...
125s Setting up perl-modules-5.40 (5.40.0-7) ...
125s Setting up libnetfilter-conntrack3:armhf (1.1.0-1) ...
125s Setting up libtraceevent1:armhf (1:1.8.3-1ubuntu1) ...
125s Setting up libx11-6:armhf (2:1.8.10-2) ...
125s Setting up libjson-glib-1.0-common (1.10.0+ds-3) ...
125s Setting up mawk (1.3.4.20240905-1) ...
126s Setting up libbytesize1:armhf (2.11-1ubuntu1) ...
126s Setting up libgpgme11t64:armhf (1.23.2-5ubuntu4) ...
126s Setting up libssh2-1t64:armhf (1.11.1-1) ...
126s Setting up libdrm-common (2.4.123-1) ...
126s Setting up libarchive13t64:armhf (3.7.4-1.1) ...
126s Setting up libjson-c5:armhf (0.18+ds-1) ...
126s Setting up libevdev2:armhf (1.13.3+dfsg-1) ...
126s Setting up libldap2:armhf (2.6.8+dfsg-1~exp4ubuntu3) ...
126s Setting up info (7.1.1-1) ...
126s Setting up liblocale-gettext-perl (1.07-7build1) ...
126s Setting up libbpf1:armhf (1:1.5.0-1) ...
126s Setting up libudisks2-0:armhf (2.10.1-11ubuntu1) ...
126s Setting up python3.13-gdbm (3.13.0-2) ...
126s Setting up libpopt0:armhf (1.19+dfsg-2) ...
126s Setting up sg3-utils (1.46-3ubuntu5) ...
126s Setting up python3.12-minimal (3.12.7-3) ...
126s Setting up libpython3.12-stdlib:armhf (3.12.7-3) ...
126s Setting up libblockdev-mdraid3:armhf (3.2.1-1) ...
126s Setting up libblockdev-crypto3:armhf (3.2.1-1) ...
126s Setting up libblockdev-swap3:armhf (3.2.1-1) ...
126s Setting up iproute2 (6.10.0-2ubuntu1) ...
127s Setting up openssh-client (1:9.7p1-7ubuntu5) ...
127s Setting up python3.12 (3.12.7-3) ...
128s Setting up libblockdev-loop3:armhf (3.2.1-1) ...
128s Setting up systemd (256.5-2ubuntu4) ...
128s /usr/lib/tmpfiles.d/legacy.conf:13: Duplicate line for path "/run/lock", ignoring.
128s Created symlink '/run/systemd/system/tmp.mount' → '/dev/null'.
128s /usr/lib/tmpfiles.d/legacy.conf:13: Duplicate line for path "/run/lock", ignoring.
129s Setting up vim-tiny (2:9.1.0777-1ubuntu1) ...
129s Setting up libblockdev3:armhf (3.2.1-1) ...
129s Installing new version of config file /etc/libblockdev/3/conf.d/00-default.cfg ...
129s Setting up libjson-glib-1.0-0:armhf (1.10.0+ds-3) ...
129s Setting up libblockdev-part3:armhf (3.2.1-1) ...
129s Setting up sg3-utils-udev (1.46-3ubuntu5) ...
129s update-initramfs: deferring update (trigger activated)
129s Setting up libperl5.40:armhf (5.40.0-7) ...
129s Setting up perl (5.40.0-7) ...
129s Setting up systemd-cryptsetup (256.5-2ubuntu4) ...
129s Setting up libnvme1t64 (1.11-1) ...
129s Setting up systemd-timesyncd (256.5-2ubuntu4) ...
129s systemd-time-wait-sync.service is a disabled or a static unit not running, not starting it.
129s Setting up udev (256.5-2ubuntu4) ...
130s Setting up libdpkg-perl (1.22.11ubuntu3) ...
130s Setting up libblockdev-nvme3:armhf (3.2.1-1) ...
130s Setting up libdrm2:armhf (2.4.123-1) ...
130s Setting up libtraceevent1-plugin:armhf (1:1.8.3-1ubuntu1) ...
130s Setting up libplymouth5:armhf (24.004.60-1ubuntu11) ...
130s Setting up netplan-generator (1.1.1-1) ...
130s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator'
130s Setting up libpython3-stdlib:armhf (3.12.7-1) ...
130s Setting up systemd-resolved (256.5-2ubuntu4) ...
131s Setting up openssh-sftp-server (1:9.7p1-7ubuntu5) ...
131s Setting up udisks2 (2.10.1-11ubuntu1) ...
131s vda: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/uevent': Permission denied
131s vda1: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda1/uevent': Permission denied
131s vda15: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda15/uevent': Permission denied
131s vda2: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda2/uevent': Permission denied
131s loop0: Failed to write 'change' to '/sys/devices/virtual/block/loop0/uevent': Permission denied
131s loop1: Failed to write 'change' to '/sys/devices/virtual/block/loop1/uevent': Permission denied
131s loop2: Failed to write 'change' to '/sys/devices/virtual/block/loop2/uevent': Permission denied
131s loop3: Failed to write 'change' to '/sys/devices/virtual/block/loop3/uevent': Permission denied
131s loop4: Failed to write 'change' to '/sys/devices/virtual/block/loop4/uevent': Permission denied
131s loop5: Failed to write 'change' to '/sys/devices/virtual/block/loop5/uevent': Permission denied
131s loop6: Failed to write 'change' to '/sys/devices/virtual/block/loop6/uevent': Permission denied
131s loop7: Failed to write 'change' to '/sys/devices/virtual/block/loop7/uevent': Permission denied
131s loop8: Failed to write 'change' to '/sys/devices/virtual/block/loop8/uevent': Permission denied
131s Setting up systemd-sysv (256.5-2ubuntu4) ...
131s Setting up openssh-server (1:9.7p1-7ubuntu5) ...
132s Setting up plymouth (24.004.60-1ubuntu11) ...
132s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
133s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
133s Setting up libfwupd2:armhf (1.9.26-2) ...
133s Setting up libnss-systemd:armhf (256.5-2ubuntu4) ...
133s Setting up python3 (3.12.7-1) ...
133s Setting up python3-zipp (3.21.0-1) ...
133s Setting up dpkg-dev (1.22.11ubuntu3) ...
133s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu11) ...
133s update-initramfs: deferring update (trigger activated)
133s Setting up python3-oauthlib (3.2.2-2) ...
133s Setting up python3-configobj (5.0.9-1) ...
134s Setting up python3-certifi (2024.8.30+dfsg-1) ...
134s Setting up python3-gi (3.50.0-3) ...
134s Setting up python3-idna (3.8-2) ...
134s Setting up python3-urllib3 (2.0.7-2ubuntu0.1) ...
134s Setting up python3-json-pointer (2.4-2) ...
134s Setting up libpam-systemd:armhf (256.5-2ubuntu4) ...
135s Setting up fwupd (1.9.26-2) ...
135s fwupd-offline-update.service is a disabled or a static unit not running, not starting it.
135s fwupd-refresh.service is a disabled or a static unit not running, not starting it.
135s fwupd.service is a disabled or a static unit not running, not starting it.
135s Setting up python3-cffi-backend:armhf (1.17.1-2) ...
135s Setting up python3-more-itertools (10.5.0-1) ...
135s Setting up python3-jaraco.functools (4.1.0-1) ...
135s Setting up python3-gdbm:armhf (3.12.7-1) ...
135s Setting up python3-problem-report (2.30.0-0ubuntu5) ...
136s Setting up ssh-import-id (5.11-0ubuntu3) ...
136s Setting up python3-jsonpatch (1.32-4) ...
136s Setting up python3-typeguard (4.4.1-1) ...
136s Setting up ufw (0.36.2-8) ...
137s Setting up python3-lazr.uri (1.0.6-4) ...
137s Setting up python3-apport (2.30.0-0ubuntu5) ...
137s Setting up python3-wadllib (2.0.0-1) ...
137s Setting up python3-netplan (1.1.1-1) ...
137s Setting up python3-lazr.restfulclient (0.14.6-2) ...
138s Setting up netplan.io (1.1.1-1) ...
138s Setting up apport-core-dump-handler (2.30.0-0ubuntu5) ...
138s Setting up apport (2.30.0-0ubuntu5) ...
138s Installing new version of config file /etc/apport/crashdb.conf ...
139s apport-autoreport.service is a disabled or a static unit not running, not starting it.
139s Processing triggers for dbus (1.14.10-4ubuntu5) ...
139s Processing triggers for shared-mime-info (2.4-5) ...
139s Processing triggers for install-info (7.1.1-1) ...
139s Processing triggers for initramfs-tools (0.142ubuntu34) ...
139s Processing triggers for libc-bin (2.40-1ubuntu3) ...
140s Processing triggers for rsyslog (8.2406.0-1ubuntu2) ...
140s Processing triggers for man-db (2.12.1-3) ...
141s Reading package lists...
142s Building dependency tree...
142s Reading state information...
142s The following packages will be REMOVED:
142s   libperl5.38t64* perl-modules-5.38* python3-netifaces*
143s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded.
143s After this operation, 41.7 MB disk space will be freed.
143s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 61506 files and directories currently installed.)
143s Removing libperl5.38t64:armhf (5.38.2-5) ...
143s Removing perl-modules-5.38 (5.38.2-5) ...
143s Removing python3-netifaces:armhf (0.11.0-2build3) ...
143s Processing triggers for man-db (2.12.1-3) ...
143s Processing triggers for libc-bin (2.40-1ubuntu3) ...
146s autopkgtest [17:07:52]: rebooting testbed after setup commands that affected boot
216s autopkgtest [17:09:02]: testbed running kernel: Linux 6.8.0-47-generic #47~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Oct  2 16:39:14 UTC 2
244s autopkgtest [17:09:30]: @@@@@@@@@@@@@@@@@@@@ apt-source presto
260s Get:1 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (dsc) [2233 B]
260s Get:2 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (tar) [362 kB]
260s Get:3 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (diff) [20.8 kB]
261s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC
261s gpgv:                using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7
261s gpgv: Can't check signature: No public key
261s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found
261s autopkgtest [17:09:47]: testing package presto version 0.7.2-1
263s autopkgtest [17:09:49]: build not needed
266s autopkgtest [17:09:52]: test pybuild-autopkgtest: preparing testbed
277s Reading package lists...
277s Building dependency tree...
277s Reading state information...
278s Starting pkgProblemResolver with broken count: 0
278s Starting 2 pkgProblemResolver with broken count: 0
278s Done
279s The following additional packages will be installed:
279s   autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-14
279s   cpp-14-arm-linux-gnueabihf cpp-arm-linux-gnueabihf debhelper debugedit
279s   dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config
279s   fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ g++-14
279s   g++-14-arm-linux-gnueabihf g++-arm-linux-gnueabihf gcc gcc-14
279s   gcc-14-arm-linux-gnueabihf gcc-arm-linux-gnueabihf gettext intltool-debian
279s   libarchive-zip-perl libasan8 libblas3 libc-dev-bin libc6-dev libcairo2
279s   libcc1-0 libcrypt-dev libdebhelper-perl libdeflate0
279s   libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 libfreetype6
279s   libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b
279s   libimagequant0 libisl23 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3
279s   liblbfgsb0 liblcms2-2 liblerc4 libmbedcrypto7t64 libmbedtls14t64
279s   libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal
279s   libpython3.13-stdlib libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool
279s   libubsan1 libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0
279s   libxrender1 linux-libc-dev m4 ncbi-blast+ ncbi-data po-debconf presto
279s   pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo
279s   python3-dateutil python3-decorator python3-freetype python3-numpy
279s   python3-packaging python3-pandas python3-pandas-lib python3-pil
279s   python3-presto python3-reportlab python3-rlpycairo python3-scipy python3-six
279s   python3-tz python3.13 python3.13-minimal rpcsvc-proto sgml-base w3c-sgml-lib
279s   x11-common xfonts-encodings xfonts-utils xml-core
279s Suggested packages:
279s   autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-14-locales
279s   cpp-14-doc dh-make flit python3-build python3-installer python3-wheel
279s   fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre gcc-14-doc
279s   gcc-multilib manpages-dev flex bison gdb gcc-doc gdb-arm-linux-gnueabihf
279s   gettext-doc libasprintf-dev libgettextpo-dev libc-devtools glibc-doc
279s   liblcms2-utils libstdc++-14-doc libtool-doc gfortran | fortran95-compiler
279s   gcj-jdk m4-doc libmail-box-perl python3-tk bwa clustalo clustalw dialign
279s   dssp emboss fasttree mafft muscle3 phylip phyml prank probcons
279s   python3-mysqldb python3-matplotlib python3-mmtf python3-rdflib
279s   python3-psycopg2 raxml samtools t-coffee wise gfortran python-numpy-doc
279s   python3-dev python3-pytest python-pandas-doc python3-statsmodels
279s   python-pil-doc pdf-viewer python3-egenix-mxtexttools python-reportlab-doc
279s   rl-accel rl-renderpm python-scipy-doc python3.13-venv python3.13-doc
279s   binfmt-support sgml-base-doc
279s Recommended packages:
279s   manpages manpages-dev libarchive-cpio-perl libltdl-dev libmail-sendmail-perl
279s   python-biopython-doc python3-matplotlib python3-bottleneck python3-numexpr
279s   python3-odf python3-openpyxl python3-bs4 python3-html5lib python3-lxml
279s   python3-tables python3-olefile fonts-dejavu-extra
279s The following NEW packages will be installed:
279s   autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential
279s   cd-hit cpp cpp-14 cpp-14-arm-linux-gnueabihf cpp-arm-linux-gnueabihf
279s   debhelper debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz
279s   fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++
279s   g++-14 g++-14-arm-linux-gnueabihf g++-arm-linux-gnueabihf gcc gcc-14
279s   gcc-14-arm-linux-gnueabihf gcc-arm-linux-gnueabihf gettext intltool-debian
279s   libarchive-zip-perl libasan8 libblas3 libc-dev-bin libc6-dev libcairo2
279s   libcc1-0 libcrypt-dev libdebhelper-perl libdeflate0
279s   libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 libfreetype6
279s   libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b
279s   libimagequant0 libisl23 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3
279s   liblbfgsb0 liblcms2-2 liblerc4 libmbedcrypto7t64 libmbedtls14t64
279s   libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal
279s   libpython3.13-stdlib libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool
279s   libubsan1 libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0
279s   libxrender1 linux-libc-dev m4 ncbi-blast+ ncbi-data po-debconf presto
279s   pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo
279s   python3-dateutil python3-decorator python3-freetype python3-numpy
279s   python3-packaging python3-pandas python3-pandas-lib python3-pil
279s   python3-presto python3-reportlab python3-rlpycairo python3-scipy python3-six
279s   python3-tz python3.13 python3.13-minimal rpcsvc-proto sgml-base w3c-sgml-lib
279s   x11-common xfonts-encodings xfonts-utils xml-core
279s 0 upgraded, 112 newly installed, 0 to remove and 0 not upgraded.
279s Need to get 130 MB/130 MB of archives.
279s After this operation, 417 MB of additional disk space will be used.
279s Get:1 /tmp/autopkgtest.XRQsI9/1-autopkgtest-satdep.deb autopkgtest-satdep armhf 0 [816 B]
279s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.13-minimal armhf 3.13.0-2 [866 kB]
280s Get:3 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13-minimal armhf 3.13.0-2 [1854 kB]
281s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf sgml-base all 1.31 [11.4 kB]
281s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf m4 armhf 1.4.19-4build1 [235 kB]
281s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf autoconf all 2.72-3 [382 kB]
281s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf autotools-dev all 20220109.1 [44.9 kB]
281s Get:8 http://ftpmaster.internal/ubuntu plucky/main armhf automake all 1:1.16.5-1.3ubuntu1 [558 kB]
281s Get:9 http://ftpmaster.internal/ubuntu plucky/main armhf autopoint all 0.22.5-2 [616 kB]
281s Get:10 http://ftpmaster.internal/ubuntu plucky/main armhf libc-dev-bin armhf 2.40-1ubuntu3 [19.2 kB]
281s Get:11 http://ftpmaster.internal/ubuntu plucky/main armhf linux-libc-dev armhf 6.11.0-8.8 [1628 kB]
282s Get:12 http://ftpmaster.internal/ubuntu plucky/main armhf libcrypt-dev armhf 1:4.4.36-4build1 [120 kB]
282s Get:13 http://ftpmaster.internal/ubuntu plucky/main armhf rpcsvc-proto armhf 1.4.2-0ubuntu7 [62.2 kB]
282s Get:14 http://ftpmaster.internal/ubuntu plucky/main armhf libc6-dev armhf 2.40-1ubuntu3 [1370 kB]
282s Get:15 http://ftpmaster.internal/ubuntu plucky/main armhf libisl23 armhf 0.27-1 [546 kB]
282s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf libmpc3 armhf 1.3.1-1build2 [47.1 kB]
282s Get:17 http://ftpmaster.internal/ubuntu plucky/main armhf cpp-14-arm-linux-gnueabihf armhf 14.2.0-8ubuntu1 [9219 kB]
283s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf cpp-14 armhf 14.2.0-8ubuntu1 [1032 B]
283s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf cpp-arm-linux-gnueabihf armhf 4:14.1.0-2ubuntu1 [5464 B]
283s Get:20 http://ftpmaster.internal/ubuntu plucky/main armhf cpp armhf 4:14.1.0-2ubuntu1 [22.4 kB]
283s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf libcc1-0 armhf 14.2.0-8ubuntu1 [43.3 kB]
283s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf libgomp1 armhf 14.2.0-8ubuntu1 [125 kB]
283s Get:23 http://ftpmaster.internal/ubuntu plucky/main armhf libasan8 armhf 14.2.0-8ubuntu1 [2901 kB]
283s Get:24 http://ftpmaster.internal/ubuntu plucky/main armhf libubsan1 armhf 14.2.0-8ubuntu1 [1150 kB]
283s Get:25 http://ftpmaster.internal/ubuntu plucky/main armhf libgcc-14-dev armhf 14.2.0-8ubuntu1 [897 kB]
283s Get:26 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-14-arm-linux-gnueabihf armhf 14.2.0-8ubuntu1 [18.0 MB]
284s Get:27 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-14 armhf 14.2.0-8ubuntu1 [498 kB]
284s Get:28 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-arm-linux-gnueabihf armhf 4:14.1.0-2ubuntu1 [1222 B]
284s Get:29 http://ftpmaster.internal/ubuntu plucky/main armhf gcc armhf 4:14.1.0-2ubuntu1 [5002 B]
284s Get:30 http://ftpmaster.internal/ubuntu plucky/main armhf libstdc++-14-dev armhf 14.2.0-8ubuntu1 [2569 kB]
284s Get:31 http://ftpmaster.internal/ubuntu plucky/main armhf g++-14-arm-linux-gnueabihf armhf 14.2.0-8ubuntu1 [10.5 MB]
284s Get:32 http://ftpmaster.internal/ubuntu plucky/main armhf g++-14 armhf 14.2.0-8ubuntu1 [19.9 kB]
284s Get:33 http://ftpmaster.internal/ubuntu plucky/main armhf g++-arm-linux-gnueabihf armhf 4:14.1.0-2ubuntu1 [968 B]
284s Get:34 http://ftpmaster.internal/ubuntu plucky/main armhf g++ armhf 4:14.1.0-2ubuntu1 [1084 B]
284s Get:35 http://ftpmaster.internal/ubuntu plucky/main armhf build-essential armhf 12.10ubuntu1 [4928 B]
284s Get:36 http://ftpmaster.internal/ubuntu plucky/universe armhf cd-hit armhf 4.8.1-4 [512 kB]
284s Get:37 http://ftpmaster.internal/ubuntu plucky/main armhf libdebhelper-perl all 13.20ubuntu1 [94.2 kB]
284s Get:38 http://ftpmaster.internal/ubuntu plucky/main armhf libtool all 2.4.7-7build1 [166 kB]
284s Get:39 http://ftpmaster.internal/ubuntu plucky/main armhf dh-autoreconf all 20 [16.1 kB]
284s Get:40 http://ftpmaster.internal/ubuntu plucky/main armhf libarchive-zip-perl all 1.68-1 [90.2 kB]
285s Get:41 http://ftpmaster.internal/ubuntu plucky/main armhf libfile-stripnondeterminism-perl all 1.14.0-1 [20.1 kB]
285s Get:42 http://ftpmaster.internal/ubuntu plucky/main armhf dh-strip-nondeterminism all 1.14.0-1 [5058 B]
285s Get:43 http://ftpmaster.internal/ubuntu plucky/main armhf debugedit armhf 1:5.1-1 [46.5 kB]
285s Get:44 http://ftpmaster.internal/ubuntu plucky/main armhf dwz armhf 0.15-1build6 [116 kB]
285s Get:45 http://ftpmaster.internal/ubuntu plucky/main armhf gettext armhf 0.22.5-2 [995 kB]
285s Get:46 http://ftpmaster.internal/ubuntu plucky/main armhf intltool-debian all 0.35.0+20060710.6 [23.2 kB]
285s Get:47 http://ftpmaster.internal/ubuntu plucky/main armhf po-debconf all 1.0.21+nmu1 [233 kB]
285s Get:48 http://ftpmaster.internal/ubuntu plucky/main armhf debhelper all 13.20ubuntu1 [893 kB]
285s Get:49 http://ftpmaster.internal/ubuntu plucky/universe armhf dh-python all 6.20241024 [112 kB]
285s Get:50 http://ftpmaster.internal/ubuntu plucky/main armhf fonts-dejavu-mono all 2.37-8 [502 kB]
285s Get:51 http://ftpmaster.internal/ubuntu plucky/main armhf fonts-dejavu-core all 2.37-8 [835 kB]
285s Get:52 http://ftpmaster.internal/ubuntu plucky/main armhf libfontenc1 armhf 1:1.1.8-1build1 [11.5 kB]
285s Get:53 http://ftpmaster.internal/ubuntu plucky/main armhf libfreetype6 armhf 2.13.3+dfsg-1 [330 kB]
285s Get:54 http://ftpmaster.internal/ubuntu plucky/main armhf x11-common all 1:7.7+23ubuntu3 [21.7 kB]
285s Get:55 http://ftpmaster.internal/ubuntu plucky/main armhf xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB]
285s Get:56 http://ftpmaster.internal/ubuntu plucky/main armhf xfonts-utils armhf 1:7.7+7 [90.6 kB]
285s Get:57 http://ftpmaster.internal/ubuntu plucky/main armhf fonts-urw-base35 all 20200910-8 [11.0 MB]
285s Get:58 http://ftpmaster.internal/ubuntu plucky/main armhf fontconfig-config armhf 2.15.0-1.1ubuntu2 [37.4 kB]
285s Get:59 http://ftpmaster.internal/ubuntu plucky/main armhf libblas3 armhf 3.12.0-3build2 [126 kB]
285s Get:60 http://ftpmaster.internal/ubuntu plucky/main armhf libfontconfig1 armhf 2.15.0-1.1ubuntu2 [113 kB]
285s Get:61 http://ftpmaster.internal/ubuntu plucky/main armhf libpixman-1-0 armhf 0.44.0-3 [183 kB]
285s Get:62 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-render0 armhf 1.17.0-2 [15.3 kB]
285s Get:63 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-shm0 armhf 1.17.0-2 [5774 B]
285s Get:64 http://ftpmaster.internal/ubuntu plucky/main armhf libxrender1 armhf 1:0.9.10-1.1build1 [16.0 kB]
285s Get:65 http://ftpmaster.internal/ubuntu plucky/main armhf libcairo2 armhf 1.18.2-2 [484 kB]
285s Get:66 http://ftpmaster.internal/ubuntu plucky/main armhf libdeflate0 armhf 1.22-1 [38.9 kB]
285s Get:67 http://ftpmaster.internal/ubuntu plucky/main armhf libgfortran5 armhf 14.2.0-8ubuntu1 [311 kB]
285s Get:68 http://ftpmaster.internal/ubuntu plucky/main armhf libgraphite2-3 armhf 1.3.14-2ubuntu1 [64.8 kB]
285s Get:69 http://ftpmaster.internal/ubuntu plucky/main armhf libharfbuzz0b armhf 10.0.1-1 [463 kB]
285s Get:70 http://ftpmaster.internal/ubuntu plucky/main armhf libimagequant0 armhf 2.18.0-1build1 [31.1 kB]
285s Get:71 http://ftpmaster.internal/ubuntu plucky/main armhf libjpeg-turbo8 armhf 2.1.5-2ubuntu2 [125 kB]
285s Get:72 http://ftpmaster.internal/ubuntu plucky/main armhf libjpeg8 armhf 8c-2ubuntu11 [2148 B]
285s Get:73 http://ftpmaster.internal/ubuntu plucky/main armhf liblapack3 armhf 3.12.0-3build2 [2086 kB]
286s Get:74 http://ftpmaster.internal/ubuntu plucky/universe armhf liblbfgsb0 armhf 3.0+dfsg.4-1build1 [27.4 kB]
286s Get:75 http://ftpmaster.internal/ubuntu plucky/main armhf liblcms2-2 armhf 2.16-2 [137 kB]
286s Get:76 http://ftpmaster.internal/ubuntu plucky/main armhf liblerc4 armhf 4.0.0+ds-4ubuntu2 [151 kB]
286s Get:77 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedcrypto7t64 armhf 2.28.8-1 [182 kB]
286s Get:78 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedx509-1t64 armhf 2.28.8-1 [43.0 kB]
286s Get:79 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedtls14t64 armhf 2.28.8-1 [77.2 kB]
286s Get:80 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.13-stdlib armhf 3.13.0-2 [1972 kB]
286s Get:81 http://ftpmaster.internal/ubuntu plucky/main armhf libraqm0 armhf 0.10.1-1build1 [12.4 kB]
286s Get:82 http://ftpmaster.internal/ubuntu plucky/main armhf libsharpyuv0 armhf 1.4.0-0.1 [16.3 kB]
286s Get:83 http://ftpmaster.internal/ubuntu plucky/main armhf libjbig0 armhf 2.1-6.1ubuntu2 [24.9 kB]
286s Get:84 http://ftpmaster.internal/ubuntu plucky/main armhf libwebp7 armhf 1.4.0-0.1 [184 kB]
286s Get:85 http://ftpmaster.internal/ubuntu plucky/main armhf libtiff6 armhf 4.5.1+git230720-4ubuntu4 [179 kB]
286s Get:86 http://ftpmaster.internal/ubuntu plucky/main armhf libwebpdemux2 armhf 1.4.0-0.1 [11.8 kB]
286s Get:87 http://ftpmaster.internal/ubuntu plucky/main armhf libwebpmux3 armhf 1.4.0-0.1 [22.5 kB]
286s Get:88 http://ftpmaster.internal/ubuntu plucky/universe armhf ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB]
286s Get:89 http://ftpmaster.internal/ubuntu plucky/universe armhf ncbi-blast+ armhf 2.16.0+ds-6 [14.8 MB]
287s Get:90 http://ftpmaster.internal/ubuntu plucky/main armhf python3-numpy armhf 1:1.26.4+ds-11build1 [3570 kB]
287s Get:91 http://ftpmaster.internal/ubuntu plucky/main armhf libopenjp2-7 armhf 2.5.0-2ubuntu1 [170 kB]
287s Get:92 http://ftpmaster.internal/ubuntu plucky/main armhf python3-pil armhf 10.4.0-1ubuntu1 [428 kB]
287s Get:93 http://ftpmaster.internal/ubuntu plucky/main armhf python3-cairo armhf 1.26.1-2 [114 kB]
287s Get:94 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-freetype all 2.5.1-1 [92.3 kB]
287s Get:95 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-rlpycairo all 0.3.0-3 [9130 B]
287s Get:96 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-reportlab all 4.2.5-1 [1107 kB]
287s Get:97 http://ftpmaster.internal/ubuntu plucky/main armhf xml-core all 0.19 [20.3 kB]
287s Get:98 http://ftpmaster.internal/ubuntu plucky/universe armhf w3c-sgml-lib all 1.3-3 [280 kB]
287s Get:99 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-biopython armhf 1.84+dfsg-4 [1666 kB]
287s Get:100 http://ftpmaster.internal/ubuntu plucky/main armhf python3-six all 1.16.0-7 [13.1 kB]
287s Get:101 http://ftpmaster.internal/ubuntu plucky/main armhf python3-dateutil all 2.9.0-2 [80.3 kB]
287s Get:102 http://ftpmaster.internal/ubuntu plucky/main armhf python3-tz all 2024.1-2 [31.4 kB]
287s Get:103 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-pandas-lib armhf 2.2.3+dfsg-5 [4728 kB]
288s Get:104 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-pandas all 2.2.3+dfsg-5 [3112 kB]
288s Get:105 http://ftpmaster.internal/ubuntu plucky/main armhf python3-decorator all 5.1.1-5 [10.1 kB]
288s Get:106 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-scipy armhf 1.13.1-5 [16.4 MB]
288s Get:107 http://ftpmaster.internal/ubuntu plucky/main armhf python3-packaging all 24.1-1 [41.4 kB]
288s Get:108 http://ftpmaster.internal/ubuntu plucky/universe armhf python3-presto armhf 0.7.2-1 [80.7 kB]
288s Get:109 http://ftpmaster.internal/ubuntu plucky/universe armhf presto all 0.7.2-1 [240 kB]
288s Get:110 http://ftpmaster.internal/ubuntu plucky/universe armhf pybuild-plugin-autopkgtest all 6.20241024 [1746 B]
288s Get:111 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13 armhf 3.13.0-2 [719 kB]
288s Get:112 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3-all armhf 3.12.7-1 [890 B]
289s Fetched 130 MB in 9s (13.7 MB/s)
289s Selecting previously unselected package libpython3.13-minimal:armhf.
289s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 59566 files and directories currently installed.)
289s Preparing to unpack .../000-libpython3.13-minimal_3.13.0-2_armhf.deb ...
289s Unpacking libpython3.13-minimal:armhf (3.13.0-2) ...
289s Selecting previously unselected package python3.13-minimal.
289s Preparing to unpack .../001-python3.13-minimal_3.13.0-2_armhf.deb ...
289s Unpacking python3.13-minimal (3.13.0-2) ...
289s Selecting previously unselected package sgml-base.
289s Preparing to unpack .../002-sgml-base_1.31_all.deb ...
289s Unpacking sgml-base (1.31) ...
289s Selecting previously unselected package m4.
289s Preparing to unpack .../003-m4_1.4.19-4build1_armhf.deb ...
289s Unpacking m4 (1.4.19-4build1) ...
289s Selecting previously unselected package autoconf.
289s Preparing to unpack .../004-autoconf_2.72-3_all.deb ...
289s Unpacking autoconf (2.72-3) ...
289s Selecting previously unselected package autotools-dev.
289s Preparing to unpack .../005-autotools-dev_20220109.1_all.deb ...
289s Unpacking autotools-dev (20220109.1) ...
289s Selecting previously unselected package automake.
289s Preparing to unpack .../006-automake_1%3a1.16.5-1.3ubuntu1_all.deb ...
289s Unpacking automake (1:1.16.5-1.3ubuntu1) ...
289s Selecting previously unselected package autopoint.
289s Preparing to unpack .../007-autopoint_0.22.5-2_all.deb ...
289s Unpacking autopoint (0.22.5-2) ...
289s Selecting previously unselected package libc-dev-bin.
289s Preparing to unpack .../008-libc-dev-bin_2.40-1ubuntu3_armhf.deb ...
289s Unpacking libc-dev-bin (2.40-1ubuntu3) ...
289s Selecting previously unselected package linux-libc-dev:armhf.
289s Preparing to unpack .../009-linux-libc-dev_6.11.0-8.8_armhf.deb ...
289s Unpacking linux-libc-dev:armhf (6.11.0-8.8) ...
289s Selecting previously unselected package libcrypt-dev:armhf.
289s Preparing to unpack .../010-libcrypt-dev_1%3a4.4.36-4build1_armhf.deb ...
289s Unpacking libcrypt-dev:armhf (1:4.4.36-4build1) ...
289s Selecting previously unselected package rpcsvc-proto.
289s Preparing to unpack .../011-rpcsvc-proto_1.4.2-0ubuntu7_armhf.deb ...
289s Unpacking rpcsvc-proto (1.4.2-0ubuntu7) ...
290s Selecting previously unselected package libc6-dev:armhf.
290s Preparing to unpack .../012-libc6-dev_2.40-1ubuntu3_armhf.deb ...
290s Unpacking libc6-dev:armhf (2.40-1ubuntu3) ...
290s Selecting previously unselected package libisl23:armhf.
290s Preparing to unpack .../013-libisl23_0.27-1_armhf.deb ...
290s Unpacking libisl23:armhf (0.27-1) ...
290s Selecting previously unselected package libmpc3:armhf.
290s Preparing to unpack .../014-libmpc3_1.3.1-1build2_armhf.deb ...
290s Unpacking libmpc3:armhf (1.3.1-1build2) ...
290s Selecting previously unselected package cpp-14-arm-linux-gnueabihf.
290s Preparing to unpack .../015-cpp-14-arm-linux-gnueabihf_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking cpp-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package cpp-14.
290s Preparing to unpack .../016-cpp-14_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking cpp-14 (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package cpp-arm-linux-gnueabihf.
290s Preparing to unpack .../017-cpp-arm-linux-gnueabihf_4%3a14.1.0-2ubuntu1_armhf.deb ...
290s Unpacking cpp-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
290s Selecting previously unselected package cpp.
290s Preparing to unpack .../018-cpp_4%3a14.1.0-2ubuntu1_armhf.deb ...
290s Unpacking cpp (4:14.1.0-2ubuntu1) ...
290s Selecting previously unselected package libcc1-0:armhf.
290s Preparing to unpack .../019-libcc1-0_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking libcc1-0:armhf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package libgomp1:armhf.
290s Preparing to unpack .../020-libgomp1_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking libgomp1:armhf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package libasan8:armhf.
290s Preparing to unpack .../021-libasan8_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking libasan8:armhf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package libubsan1:armhf.
290s Preparing to unpack .../022-libubsan1_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking libubsan1:armhf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package libgcc-14-dev:armhf.
290s Preparing to unpack .../023-libgcc-14-dev_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking libgcc-14-dev:armhf (14.2.0-8ubuntu1) ...
290s Selecting previously unselected package gcc-14-arm-linux-gnueabihf.
290s Preparing to unpack .../024-gcc-14-arm-linux-gnueabihf_14.2.0-8ubuntu1_armhf.deb ...
290s Unpacking gcc-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
291s Selecting previously unselected package gcc-14.
291s Preparing to unpack .../025-gcc-14_14.2.0-8ubuntu1_armhf.deb ...
291s Unpacking gcc-14 (14.2.0-8ubuntu1) ...
291s Selecting previously unselected package gcc-arm-linux-gnueabihf.
291s Preparing to unpack .../026-gcc-arm-linux-gnueabihf_4%3a14.1.0-2ubuntu1_armhf.deb ...
291s Unpacking gcc-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
291s Selecting previously unselected package gcc.
291s Preparing to unpack .../027-gcc_4%3a14.1.0-2ubuntu1_armhf.deb ...
291s Unpacking gcc (4:14.1.0-2ubuntu1) ...
291s Selecting previously unselected package libstdc++-14-dev:armhf.
291s Preparing to unpack .../028-libstdc++-14-dev_14.2.0-8ubuntu1_armhf.deb ...
291s Unpacking libstdc++-14-dev:armhf (14.2.0-8ubuntu1) ...
291s Selecting previously unselected package g++-14-arm-linux-gnueabihf.
291s Preparing to unpack .../029-g++-14-arm-linux-gnueabihf_14.2.0-8ubuntu1_armhf.deb ...
291s Unpacking g++-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
291s Selecting previously unselected package g++-14.
291s Preparing to unpack .../030-g++-14_14.2.0-8ubuntu1_armhf.deb ...
291s Unpacking g++-14 (14.2.0-8ubuntu1) ...
291s Selecting previously unselected package g++-arm-linux-gnueabihf.
291s Preparing to unpack .../031-g++-arm-linux-gnueabihf_4%3a14.1.0-2ubuntu1_armhf.deb ...
291s Unpacking g++-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
291s Selecting previously unselected package g++.
291s Preparing to unpack .../032-g++_4%3a14.1.0-2ubuntu1_armhf.deb ...
291s Unpacking g++ (4:14.1.0-2ubuntu1) ...
291s Selecting previously unselected package build-essential.
291s Preparing to unpack .../033-build-essential_12.10ubuntu1_armhf.deb ...
291s Unpacking build-essential (12.10ubuntu1) ...
291s Selecting previously unselected package cd-hit.
291s Preparing to unpack .../034-cd-hit_4.8.1-4_armhf.deb ...
291s Unpacking cd-hit (4.8.1-4) ...
291s Selecting previously unselected package libdebhelper-perl.
291s Preparing to unpack .../035-libdebhelper-perl_13.20ubuntu1_all.deb ...
291s Unpacking libdebhelper-perl (13.20ubuntu1) ...
291s Selecting previously unselected package libtool.
292s Preparing to unpack .../036-libtool_2.4.7-7build1_all.deb ...
292s Unpacking libtool (2.4.7-7build1) ...
292s Selecting previously unselected package dh-autoreconf.
292s Preparing to unpack .../037-dh-autoreconf_20_all.deb ...
292s Unpacking dh-autoreconf (20) ...
292s Selecting previously unselected package libarchive-zip-perl.
292s Preparing to unpack .../038-libarchive-zip-perl_1.68-1_all.deb ...
292s Unpacking libarchive-zip-perl (1.68-1) ...
292s Selecting previously unselected package libfile-stripnondeterminism-perl.
292s Preparing to unpack .../039-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ...
292s Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ...
292s Selecting previously unselected package dh-strip-nondeterminism.
292s Preparing to unpack .../040-dh-strip-nondeterminism_1.14.0-1_all.deb ...
292s Unpacking dh-strip-nondeterminism (1.14.0-1) ...
292s Selecting previously unselected package debugedit.
292s Preparing to unpack .../041-debugedit_1%3a5.1-1_armhf.deb ...
292s Unpacking debugedit (1:5.1-1) ...
292s Selecting previously unselected package dwz.
292s Preparing to unpack .../042-dwz_0.15-1build6_armhf.deb ...
292s Unpacking dwz (0.15-1build6) ...
292s Selecting previously unselected package gettext.
292s Preparing to unpack .../043-gettext_0.22.5-2_armhf.deb ...
292s Unpacking gettext (0.22.5-2) ...
292s Selecting previously unselected package intltool-debian.
292s Preparing to unpack .../044-intltool-debian_0.35.0+20060710.6_all.deb ...
292s Unpacking intltool-debian (0.35.0+20060710.6) ...
292s Selecting previously unselected package po-debconf.
292s Preparing to unpack .../045-po-debconf_1.0.21+nmu1_all.deb ...
292s Unpacking po-debconf (1.0.21+nmu1) ...
292s Selecting previously unselected package debhelper.
292s Preparing to unpack .../046-debhelper_13.20ubuntu1_all.deb ...
292s Unpacking debhelper (13.20ubuntu1) ...
292s Selecting previously unselected package dh-python.
292s Preparing to unpack .../047-dh-python_6.20241024_all.deb ...
292s Unpacking dh-python (6.20241024) ...
292s Selecting previously unselected package fonts-dejavu-mono.
292s Preparing to unpack .../048-fonts-dejavu-mono_2.37-8_all.deb ...
292s Unpacking fonts-dejavu-mono (2.37-8) ...
292s Selecting previously unselected package fonts-dejavu-core.
292s Preparing to unpack .../049-fonts-dejavu-core_2.37-8_all.deb ...
292s Unpacking fonts-dejavu-core (2.37-8) ...
292s Selecting previously unselected package libfontenc1:armhf.
292s Preparing to unpack .../050-libfontenc1_1%3a1.1.8-1build1_armhf.deb ...
292s Unpacking libfontenc1:armhf (1:1.1.8-1build1) ...
292s Selecting previously unselected package libfreetype6:armhf.
292s Preparing to unpack .../051-libfreetype6_2.13.3+dfsg-1_armhf.deb ...
292s Unpacking libfreetype6:armhf (2.13.3+dfsg-1) ...
292s Selecting previously unselected package x11-common.
292s Preparing to unpack .../052-x11-common_1%3a7.7+23ubuntu3_all.deb ...
292s Unpacking x11-common (1:7.7+23ubuntu3) ...
292s Selecting previously unselected package xfonts-encodings.
292s Preparing to unpack .../053-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ...
292s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ...
292s Selecting previously unselected package xfonts-utils.
292s Preparing to unpack .../054-xfonts-utils_1%3a7.7+7_armhf.deb ...
292s Unpacking xfonts-utils (1:7.7+7) ...
292s Selecting previously unselected package fonts-urw-base35.
292s Preparing to unpack .../055-fonts-urw-base35_20200910-8_all.deb ...
292s Unpacking fonts-urw-base35 (20200910-8) ...
292s Selecting previously unselected package fontconfig-config.
292s Preparing to unpack .../056-fontconfig-config_2.15.0-1.1ubuntu2_armhf.deb ...
293s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ...
293s Selecting previously unselected package libblas3:armhf.
293s Preparing to unpack .../057-libblas3_3.12.0-3build2_armhf.deb ...
293s Unpacking libblas3:armhf (3.12.0-3build2) ...
293s Selecting previously unselected package libfontconfig1:armhf.
293s Preparing to unpack .../058-libfontconfig1_2.15.0-1.1ubuntu2_armhf.deb ...
293s Unpacking libfontconfig1:armhf (2.15.0-1.1ubuntu2) ...
293s Selecting previously unselected package libpixman-1-0:armhf.
293s Preparing to unpack .../059-libpixman-1-0_0.44.0-3_armhf.deb ...
293s Unpacking libpixman-1-0:armhf (0.44.0-3) ...
293s Selecting previously unselected package libxcb-render0:armhf.
293s Preparing to unpack .../060-libxcb-render0_1.17.0-2_armhf.deb ...
293s Unpacking libxcb-render0:armhf (1.17.0-2) ...
293s Selecting previously unselected package libxcb-shm0:armhf.
293s Preparing to unpack .../061-libxcb-shm0_1.17.0-2_armhf.deb ...
293s Unpacking libxcb-shm0:armhf (1.17.0-2) ...
293s Selecting previously unselected package libxrender1:armhf.
293s Preparing to unpack .../062-libxrender1_1%3a0.9.10-1.1build1_armhf.deb ...
293s Unpacking libxrender1:armhf (1:0.9.10-1.1build1) ...
293s Selecting previously unselected package libcairo2:armhf.
293s Preparing to unpack .../063-libcairo2_1.18.2-2_armhf.deb ...
293s Unpacking libcairo2:armhf (1.18.2-2) ...
293s Selecting previously unselected package libdeflate0:armhf.
293s Preparing to unpack .../064-libdeflate0_1.22-1_armhf.deb ...
293s Unpacking libdeflate0:armhf (1.22-1) ...
293s Selecting previously unselected package libgfortran5:armhf.
293s Preparing to unpack .../065-libgfortran5_14.2.0-8ubuntu1_armhf.deb ...
293s Unpacking libgfortran5:armhf (14.2.0-8ubuntu1) ...
293s Selecting previously unselected package libgraphite2-3:armhf.
293s Preparing to unpack .../066-libgraphite2-3_1.3.14-2ubuntu1_armhf.deb ...
293s Unpacking libgraphite2-3:armhf (1.3.14-2ubuntu1) ...
293s Selecting previously unselected package libharfbuzz0b:armhf.
293s Preparing to unpack .../067-libharfbuzz0b_10.0.1-1_armhf.deb ...
293s Unpacking libharfbuzz0b:armhf (10.0.1-1) ...
293s Selecting previously unselected package libimagequant0:armhf.
293s Preparing to unpack .../068-libimagequant0_2.18.0-1build1_armhf.deb ...
293s Unpacking libimagequant0:armhf (2.18.0-1build1) ...
293s Selecting previously unselected package libjpeg-turbo8:armhf.
293s Preparing to unpack .../069-libjpeg-turbo8_2.1.5-2ubuntu2_armhf.deb ...
293s Unpacking libjpeg-turbo8:armhf (2.1.5-2ubuntu2) ...
293s Selecting previously unselected package libjpeg8:armhf.
293s Preparing to unpack .../070-libjpeg8_8c-2ubuntu11_armhf.deb ...
293s Unpacking libjpeg8:armhf (8c-2ubuntu11) ...
293s Selecting previously unselected package liblapack3:armhf.
293s Preparing to unpack .../071-liblapack3_3.12.0-3build2_armhf.deb ...
293s Unpacking liblapack3:armhf (3.12.0-3build2) ...
293s Selecting previously unselected package liblbfgsb0:armhf.
293s Preparing to unpack .../072-liblbfgsb0_3.0+dfsg.4-1build1_armhf.deb ...
293s Unpacking liblbfgsb0:armhf (3.0+dfsg.4-1build1) ...
293s Selecting previously unselected package liblcms2-2:armhf.
293s Preparing to unpack .../073-liblcms2-2_2.16-2_armhf.deb ...
293s Unpacking liblcms2-2:armhf (2.16-2) ...
293s Selecting previously unselected package liblerc4:armhf.
293s Preparing to unpack .../074-liblerc4_4.0.0+ds-4ubuntu2_armhf.deb ...
293s Unpacking liblerc4:armhf (4.0.0+ds-4ubuntu2) ...
293s Selecting previously unselected package libmbedcrypto7t64:armhf.
293s Preparing to unpack .../075-libmbedcrypto7t64_2.28.8-1_armhf.deb ...
293s Unpacking libmbedcrypto7t64:armhf (2.28.8-1) ...
293s Selecting previously unselected package libmbedx509-1t64:armhf.
293s Preparing to unpack .../076-libmbedx509-1t64_2.28.8-1_armhf.deb ...
293s Unpacking libmbedx509-1t64:armhf (2.28.8-1) ...
293s Selecting previously unselected package libmbedtls14t64:armhf.
293s Preparing to unpack .../077-libmbedtls14t64_2.28.8-1_armhf.deb ...
293s Unpacking libmbedtls14t64:armhf (2.28.8-1) ...
293s Selecting previously unselected package libpython3.13-stdlib:armhf.
293s Preparing to unpack .../078-libpython3.13-stdlib_3.13.0-2_armhf.deb ...
293s Unpacking libpython3.13-stdlib:armhf (3.13.0-2) ...
294s Selecting previously unselected package libraqm0:armhf.
294s Preparing to unpack .../079-libraqm0_0.10.1-1build1_armhf.deb ...
294s Unpacking libraqm0:armhf (0.10.1-1build1) ...
294s Selecting previously unselected package libsharpyuv0:armhf.
294s Preparing to unpack .../080-libsharpyuv0_1.4.0-0.1_armhf.deb ...
294s Unpacking libsharpyuv0:armhf (1.4.0-0.1) ...
294s Selecting previously unselected package libjbig0:armhf.
294s Preparing to unpack .../081-libjbig0_2.1-6.1ubuntu2_armhf.deb ...
294s Unpacking libjbig0:armhf (2.1-6.1ubuntu2) ...
294s Selecting previously unselected package libwebp7:armhf.
294s Preparing to unpack .../082-libwebp7_1.4.0-0.1_armhf.deb ...
294s Unpacking libwebp7:armhf (1.4.0-0.1) ...
294s Selecting previously unselected package libtiff6:armhf.
294s Preparing to unpack .../083-libtiff6_4.5.1+git230720-4ubuntu4_armhf.deb ...
294s Unpacking libtiff6:armhf (4.5.1+git230720-4ubuntu4) ...
294s Selecting previously unselected package libwebpdemux2:armhf.
294s Preparing to unpack .../084-libwebpdemux2_1.4.0-0.1_armhf.deb ...
294s Unpacking libwebpdemux2:armhf (1.4.0-0.1) ...
294s Selecting previously unselected package libwebpmux3:armhf.
294s Preparing to unpack .../085-libwebpmux3_1.4.0-0.1_armhf.deb ...
294s Unpacking libwebpmux3:armhf (1.4.0-0.1) ...
294s Selecting previously unselected package ncbi-data.
294s Preparing to unpack .../086-ncbi-data_6.1.20170106+dfsg2-5_all.deb ...
294s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ...
294s Selecting previously unselected package ncbi-blast+.
294s Preparing to unpack .../087-ncbi-blast+_2.16.0+ds-6_armhf.deb ...
294s Unpacking ncbi-blast+ (2.16.0+ds-6) ...
294s Selecting previously unselected package python3-numpy.
294s Preparing to unpack .../088-python3-numpy_1%3a1.26.4+ds-11build1_armhf.deb ...
294s Unpacking python3-numpy (1:1.26.4+ds-11build1) ...
295s Selecting previously unselected package libopenjp2-7:armhf.
295s Preparing to unpack .../089-libopenjp2-7_2.5.0-2ubuntu1_armhf.deb ...
295s Unpacking libopenjp2-7:armhf (2.5.0-2ubuntu1) ...
295s Selecting previously unselected package python3-pil:armhf.
295s Preparing to unpack .../090-python3-pil_10.4.0-1ubuntu1_armhf.deb ...
295s Unpacking python3-pil:armhf (10.4.0-1ubuntu1) ...
295s Selecting previously unselected package python3-cairo.
295s Preparing to unpack .../091-python3-cairo_1.26.1-2_armhf.deb ...
295s Unpacking python3-cairo (1.26.1-2) ...
295s Selecting previously unselected package python3-freetype.
295s Preparing to unpack .../092-python3-freetype_2.5.1-1_all.deb ...
295s Unpacking python3-freetype (2.5.1-1) ...
295s Selecting previously unselected package python3-rlpycairo.
295s Preparing to unpack .../093-python3-rlpycairo_0.3.0-3_all.deb ...
295s Unpacking python3-rlpycairo (0.3.0-3) ...
295s Selecting previously unselected package python3-reportlab.
295s Preparing to unpack .../094-python3-reportlab_4.2.5-1_all.deb ...
295s Unpacking python3-reportlab (4.2.5-1) ...
295s Selecting previously unselected package xml-core.
295s Preparing to unpack .../095-xml-core_0.19_all.deb ...
295s Unpacking xml-core (0.19) ...
295s Selecting previously unselected package w3c-sgml-lib.
295s Preparing to unpack .../096-w3c-sgml-lib_1.3-3_all.deb ...
295s Unpacking w3c-sgml-lib (1.3-3) ...
295s Selecting previously unselected package python3-biopython.
295s Preparing to unpack .../097-python3-biopython_1.84+dfsg-4_armhf.deb ...
295s Unpacking python3-biopython (1.84+dfsg-4) ...
295s Selecting previously unselected package python3-six.
295s Preparing to unpack .../098-python3-six_1.16.0-7_all.deb ...
295s Unpacking python3-six (1.16.0-7) ...
295s Selecting previously unselected package python3-dateutil.
295s Preparing to unpack .../099-python3-dateutil_2.9.0-2_all.deb ...
295s Unpacking python3-dateutil (2.9.0-2) ...
295s Selecting previously unselected package python3-tz.
295s Preparing to unpack .../100-python3-tz_2024.1-2_all.deb ...
295s Unpacking python3-tz (2024.1-2) ...
295s Selecting previously unselected package python3-pandas-lib:armhf.
295s Preparing to unpack .../101-python3-pandas-lib_2.2.3+dfsg-5_armhf.deb ...
295s Unpacking python3-pandas-lib:armhf (2.2.3+dfsg-5) ...
296s Selecting previously unselected package python3-pandas.
296s Preparing to unpack .../102-python3-pandas_2.2.3+dfsg-5_all.deb ...
296s Unpacking python3-pandas (2.2.3+dfsg-5) ...
296s Selecting previously unselected package python3-decorator.
296s Preparing to unpack .../103-python3-decorator_5.1.1-5_all.deb ...
296s Unpacking python3-decorator (5.1.1-5) ...
296s Selecting previously unselected package python3-scipy.
296s Preparing to unpack .../104-python3-scipy_1.13.1-5_armhf.deb ...
296s Unpacking python3-scipy (1.13.1-5) ...
296s Selecting previously unselected package python3-packaging.
296s Preparing to unpack .../105-python3-packaging_24.1-1_all.deb ...
296s Unpacking python3-packaging (24.1-1) ...
296s Selecting previously unselected package python3-presto.
296s Preparing to unpack .../106-python3-presto_0.7.2-1_armhf.deb ...
296s Unpacking python3-presto (0.7.2-1) ...
296s Selecting previously unselected package presto.
296s Preparing to unpack .../107-presto_0.7.2-1_all.deb ...
296s Unpacking presto (0.7.2-1) ...
296s Selecting previously unselected package pybuild-plugin-autopkgtest.
297s Preparing to unpack .../108-pybuild-plugin-autopkgtest_6.20241024_all.deb ...
297s Unpacking pybuild-plugin-autopkgtest (6.20241024) ...
297s Selecting previously unselected package python3.13.
297s Preparing to unpack .../109-python3.13_3.13.0-2_armhf.deb ...
297s Unpacking python3.13 (3.13.0-2) ...
297s Selecting previously unselected package python3-all.
297s Preparing to unpack .../110-python3-all_3.12.7-1_armhf.deb ...
297s Unpacking python3-all (3.12.7-1) ...
297s Selecting previously unselected package autopkgtest-satdep.
297s Preparing to unpack .../111-1-autopkgtest-satdep.deb ...
297s Unpacking autopkgtest-satdep (0) ...
297s Setting up dh-python (6.20241024) ...
297s Setting up libgraphite2-3:armhf (1.3.14-2ubuntu1) ...
297s Setting up liblcms2-2:armhf (2.16-2) ...
297s Setting up ncbi-data (6.1.20170106+dfsg2-5) ...
297s Setting up libpixman-1-0:armhf (0.44.0-3) ...
297s Setting up libsharpyuv0:armhf (1.4.0-0.1) ...
297s Setting up liblerc4:armhf (4.0.0+ds-4ubuntu2) ...
297s Setting up libmbedcrypto7t64:armhf (2.28.8-1) ...
297s Setting up libxrender1:armhf (1:0.9.10-1.1build1) ...
297s Setting up libxcb-render0:armhf (1.17.0-2) ...
297s Setting up libarchive-zip-perl (1.68-1) ...
297s Setting up libdebhelper-perl (13.20ubuntu1) ...
297s Setting up x11-common (1:7.7+23ubuntu3) ...
297s Setting up libdeflate0:armhf (1.22-1) ...
297s Setting up linux-libc-dev:armhf (6.11.0-8.8) ...
297s Setting up m4 (1.4.19-4build1) ...
297s Setting up libxcb-shm0:armhf (1.17.0-2) ...
297s Setting up libgomp1:armhf (14.2.0-8ubuntu1) ...
297s Setting up libjbig0:armhf (2.1-6.1ubuntu2) ...
297s Setting up python3-tz (2024.1-2) ...
297s Setting up python3-six (1.16.0-7) ...
298s Setting up libpython3.13-minimal:armhf (3.13.0-2) ...
298s Setting up python3-decorator (5.1.1-5) ...
298s Setting up libfontenc1:armhf (1:1.1.8-1build1) ...
298s Setting up autotools-dev (20220109.1) ...
298s Setting up libblas3:armhf (3.12.0-3build2) ...
298s update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode
298s Setting up python3-packaging (24.1-1) ...
298s Setting up rpcsvc-proto (1.4.2-0ubuntu7) ...
298s Setting up libfreetype6:armhf (2.13.3+dfsg-1) ...
298s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ...
298s Setting up libimagequant0:armhf (2.18.0-1build1) ...
298s Setting up fonts-dejavu-mono (2.37-8) ...
298s Setting up libmpc3:armhf (1.3.1-1build2) ...
298s Setting up autopoint (0.22.5-2) ...
298s Setting up fonts-dejavu-core (2.37-8) ...
298s Setting up libjpeg-turbo8:armhf (2.1.5-2ubuntu2) ...
298s Setting up libgfortran5:armhf (14.2.0-8ubuntu1) ...
298s Setting up autoconf (2.72-3) ...
298s Setting up libwebp7:armhf (1.4.0-0.1) ...
298s Setting up libubsan1:armhf (14.2.0-8ubuntu1) ...
298s Setting up dwz (0.15-1build6) ...
298s Setting up libcrypt-dev:armhf (1:4.4.36-4build1) ...
298s Setting up libasan8:armhf (14.2.0-8ubuntu1) ...
298s Setting up debugedit (1:5.1-1) ...
298s Setting up libopenjp2-7:armhf (2.5.0-2ubuntu1) ...
298s Setting up python3.13-minimal (3.13.0-2) ...
299s Setting up libharfbuzz0b:armhf (10.0.1-1) ...
299s Setting up python3-dateutil (2.9.0-2) ...
299s Setting up sgml-base (1.31) ...
299s Setting up libgcc-14-dev:armhf (14.2.0-8ubuntu1) ...
299s Setting up libisl23:armhf (0.27-1) ...
299s Setting up libc-dev-bin (2.40-1ubuntu3) ...
299s Setting up libwebpmux3:armhf (1.4.0-0.1) ...
299s Setting up libpython3.13-stdlib:armhf (3.13.0-2) ...
299s Setting up libcc1-0:armhf (14.2.0-8ubuntu1) ...
299s Setting up cpp-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
299s Setting up cd-hit (4.8.1-4) ...
299s Setting up libjpeg8:armhf (8c-2ubuntu11) ...
299s Setting up automake (1:1.16.5-1.3ubuntu1) ...
299s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
299s Setting up libfile-stripnondeterminism-perl (1.14.0-1) ...
299s Setting up liblapack3:armhf (3.12.0-3build2) ...
299s update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode
299s Setting up gettext (0.22.5-2) ...
299s Setting up libmbedx509-1t64:armhf (2.28.8-1) ...
299s Setting up python3.13 (3.13.0-2) ...
300s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ...
301s Setting up libwebpdemux2:armhf (1.4.0-0.1) ...
301s Setting up gcc-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
301s Setting up python3-all (3.12.7-1) ...
301s Setting up python3-freetype (2.5.1-1) ...
301s Setting up xfonts-utils (1:7.7+7) ...
301s Setting up intltool-debian (0.35.0+20060710.6) ...
301s Setting up libraqm0:armhf (0.10.1-1build1) ...
301s Setting up python3-numpy (1:1.26.4+ds-11build1) ...
305s Setting up cpp-14 (14.2.0-8ubuntu1) ...
305s Setting up dh-strip-nondeterminism (1.14.0-1) ...
305s Setting up libmbedtls14t64:armhf (2.28.8-1) ...
305s Setting up libtiff6:armhf (4.5.1+git230720-4ubuntu4) ...
305s Setting up xml-core (0.19) ...
305s Setting up libc6-dev:armhf (2.40-1ubuntu3) ...
305s Setting up libfontconfig1:armhf (2.15.0-1.1ubuntu2) ...
305s Setting up libstdc++-14-dev:armhf (14.2.0-8ubuntu1) ...
305s Setting up cpp-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
305s Setting up liblbfgsb0:armhf (3.0+dfsg.4-1build1) ...
305s Setting up gcc-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
305s Setting up g++-14-arm-linux-gnueabihf (14.2.0-8ubuntu1) ...
305s Setting up python3-scipy (1.13.1-5) ...
313s Setting up po-debconf (1.0.21+nmu1) ...
313s Setting up python3-pandas-lib:armhf (2.2.3+dfsg-5) ...
313s Setting up fonts-urw-base35 (20200910-8) ...
313s Setting up libcairo2:armhf (1.18.2-2) ...
313s Setting up gcc-14 (14.2.0-8ubuntu1) ...
313s Setting up ncbi-blast+ (2.16.0+ds-6) ...
313s Setting up python3-pil:armhf (10.4.0-1ubuntu1) ...
313s Setting up python3-pandas (2.2.3+dfsg-5) ...
326s Setting up cpp (4:14.1.0-2ubuntu1) ...
326s Setting up g++-14 (14.2.0-8ubuntu1) ...
326s Setting up g++-arm-linux-gnueabihf (4:14.1.0-2ubuntu1) ...
326s Setting up python3-cairo (1.26.1-2) ...
326s Setting up libtool (2.4.7-7build1) ...
326s Setting up gcc (4:14.1.0-2ubuntu1) ...
326s Setting up dh-autoreconf (20) ...
326s Setting up python3-rlpycairo (0.3.0-3) ...
326s Setting up python3-reportlab (4.2.5-1) ...
328s Setting up g++ (4:14.1.0-2ubuntu1) ...
328s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode
328s Setting up build-essential (12.10ubuntu1) ...
328s Setting up debhelper (13.20ubuntu1) ...
328s Setting up pybuild-plugin-autopkgtest (6.20241024) ...
328s Processing triggers for libc-bin (2.40-1ubuntu3) ...
328s Processing triggers for systemd (256.5-2ubuntu4) ...
328s Processing triggers for man-db (2.12.1-3) ...
329s Processing triggers for install-info (7.1.1-1) ...
329s Processing triggers for sgml-base (1.31) ...
329s Setting up w3c-sgml-lib (1.3-3) ...
357s Setting up python3-biopython (1.84+dfsg-4) ...
360s Setting up python3-presto (0.7.2-1) ...
360s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s'
360s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter))
360s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s'
360s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:]))
360s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s'
360s   header['SPECIES'] = re.sub('\s', '_', fields[2])
360s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\('
360s   header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3])
360s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s'
360s   header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE'
360s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.'
360s   version = re.sub('\.linux.*$','',version)
360s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>'
360s   id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)')
360s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s'
360s   if replace_special:  parse_id = lambda x: re.sub('[\s,=|]+', '_', x)
360s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s'
360s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter))
360s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s'
360s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:]))
360s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s'
360s   header['SPECIES'] = re.sub('\s', '_', fields[2])
360s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\('
360s   header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3])
360s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s'
360s   header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE'
360s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.'
360s   version = re.sub('\.linux.*$','',version)
360s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>'
360s   id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)')
360s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s'
360s   if replace_special:  parse_id = lambda x: re.sub('[\s,=|]+', '_', x)
360s Setting up presto (0.7.2-1) ...
360s Setting up autopkgtest-satdep (0) ...
382s (Reading database ... 71112 files and directories currently installed.)
382s Removing autopkgtest-satdep (0) ...
389s autopkgtest [17:11:55]: test pybuild-autopkgtest: pybuild-autopkgtest
389s autopkgtest [17:11:55]: test pybuild-autopkgtest: [-----------------------
391s pybuild-autopkgtest
392s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.XRQsI9/build.t5x/src/bin /tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build; rm /tmp/autopkgtest.XRQsI9/build.t5x/src/tests/test_ClusterSets.py || echo "Test file already removed or moved";
392s I: pybuild base:311: cd /tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build; python3.13 -m unittest discover -v 
392s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok
392s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok
392s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok
392s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok
392s tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) ... ERROR
392s tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) ... ERROR
392s tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) ... ERROR
392s tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) ... ERROR
392s tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) ... ERROR
392s tests.test_IO (unittest.loader._FailedTest.tests.test_IO) ... ERROR
392s tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) ... ERROR
392s tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) ... ERROR
392s tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) ... ERROR
392s 
392s ======================================================================
392s ERROR: tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs)
392s -> test_collapseAnnotation()
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']})
392s <- test_collapseAnnotation() 0.000
392s -> test_getCoordKey()
392s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066']
392s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6']
392s ['000034_0199_0169', 'GXGJ56Z01AE06X']
392s <- test_getCoordKey() 0.000
392s -> test_mergeAnnotation()
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']})
392s <- test_mergeAnnotation() 0.000
392s -> test_renameAnnotation()
392s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']})
392s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'})
392s <- test_renameAnnotation() 0.000
392s Test file already removed or moved
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_AssemblePairs
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_AssemblePairs.py", line 12, in <module>
392s     import pandas as pd
392s   File "/usr/lib/python3/dist-packages/pandas/__init__.py", line 19, in <module>
392s     raise ImportError(
392s         "Unable to import required dependencies:\n" + "\n".join(_missing_dependencies)
392s     )
392s ImportError: Unable to import required dependencies:
392s numpy: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_BuildConsensus
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in <module>
392s     from . import multiarray
392s   File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in <module>
392s     from . import overrides
392s   File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in <module>
392s     from numpy.core._multiarray_umath import (
392s         add_docstring,  _get_implementing_args, _ArrayFunctionDispatcher)
392s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath'
392s 
392s During handling of the above exception, another exception occurred:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in <module>
392s     from numpy.__config__ import show as show_config
392s   File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in <module>
392s     from numpy.core._multiarray_umath import (
392s     ...<3 lines>...
392s     )
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in <module>
392s     raise ImportError(msg)
392s ImportError: 
392s 
392s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE!
392s 
392s Importing the numpy C-extensions failed. This error can happen for
392s many reasons, often due to issues with your setup or how NumPy was
392s installed.
392s 
392s We have compiled some common reasons and troubleshooting tips at:
392s 
392s     https://numpy.org/devdocs/user/troubleshooting-importerror.html
392s 
392s Please note and check the following:
392s 
392s   * The Python version is: Python3.13 from "/usr/bin/python3.13"
392s   * The NumPy version is: "1.26.4"
392s 
392s and make sure that they are the versions you expect.
392s Please carefully study the documentation linked above for further help.
392s 
392s Original error was: No module named 'numpy.core._multiarray_umath'
392s 
392s 
392s The above exception was the direct cause of the following exception:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_BuildConsensus.py", line 16, in <module>
392s     from presto.Sequence import calculateSetError, deleteSeqPositions, findGapPositions, \
392s                                 frequencyConsensus, qualityConsensus
392s   File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in <module>
392s     import numpy as np
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in <module>
392s     raise ImportError(msg) from e
392s ImportError: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_CollapseSeq
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in <module>
392s     from . import multiarray
392s   File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in <module>
392s     from . import overrides
392s   File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in <module>
392s     from numpy.core._multiarray_umath import (
392s         add_docstring,  _get_implementing_args, _ArrayFunctionDispatcher)
392s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath'
392s 
392s During handling of the above exception, another exception occurred:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in <module>
392s     from numpy.__config__ import show as show_config
392s   File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in <module>
392s     from numpy.core._multiarray_umath import (
392s     ...<3 lines>...
392s     )
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in <module>
392s     raise ImportError(msg)
392s ImportError: 
392s 
392s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE!
392s 
392s Importing the numpy C-extensions failed. This error can happen for
392s many reasons, often due to issues with your setup or how NumPy was
392s installed.
392s 
392s We have compiled some common reasons and troubleshooting tips at:
392s 
392s     https://numpy.org/devdocs/user/troubleshooting-importerror.html
392s 
392s Please note and check the following:
392s 
392s   * The Python version is: Python3.13 from "/usr/bin/python3.13"
392s   * The NumPy version is: "1.26.4"
392s 
392s and make sure that they are the versions you expect.
392s Please carefully study the documentation linked above for further help.
392s 
392s Original error was: No module named 'numpy.core._multiarray_umath'
392s 
392s 
392s The above exception was the direct cause of the following exception:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_CollapseSeq.py", line 17, in <module>
392s     from presto.Sequence import checkSeqEqual
392s   File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in <module>
392s     import numpy as np
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in <module>
392s     raise ImportError(msg) from e
392s ImportError: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_ConvertHeaders
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_ConvertHeaders.py", line 18, in <module>
392s     import ConvertHeaders
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/../bin/ConvertHeaders.py", line 15, in <module>
392s     from Bio import SeqIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in <module>
392s     from Bio.SeqIO import TwoBitIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in <module>
392s     raise MissingPythonDependencyError(
392s     ...<2 lines>...
392s     ) from None
392s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_EstimateError
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in <module>
392s     from . import multiarray
392s   File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in <module>
392s     from . import overrides
392s   File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in <module>
392s     from numpy.core._multiarray_umath import (
392s         add_docstring,  _get_implementing_args, _ArrayFunctionDispatcher)
392s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath'
392s 
392s During handling of the above exception, another exception occurred:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in <module>
392s     from numpy.__config__ import show as show_config
392s   File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in <module>
392s     from numpy.core._multiarray_umath import (
392s     ...<3 lines>...
392s     )
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in <module>
392s     raise ImportError(msg)
392s ImportError: 
392s 
392s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE!
392s 
392s Importing the numpy C-extensions failed. This error can happen for
392s many reasons, often due to issues with your setup or how NumPy was
392s installed.
392s 
392s We have compiled some common reasons and troubleshooting tips at:
392s 
392s     https://numpy.org/devdocs/user/troubleshooting-importerror.html
392s 
392s Please note and check the following:
392s 
392s   * The Python version is: Python3.13 from "/usr/bin/python3.13"
392s   * The NumPy version is: "1.26.4"
392s 
392s and make sure that they are the versions you expect.
392s Please carefully study the documentation linked above for further help.
392s 
392s Original error was: No module named 'numpy.core._multiarray_umath'
392s 
392s 
392s The above exception was the direct cause of the following exception:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_EstimateError.py", line 11, in <module>
392s     import numpy as np
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in <module>
392s     raise ImportError(msg) from e
392s ImportError: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_IO (unittest.loader._FailedTest.tests.test_IO)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_IO
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_IO.py", line 15, in <module>
392s     from presto.IO import getFileType, readSeqFile
392s   File "/usr/lib/python3/dist-packages/presto/IO.py", line 15, in <module>
392s     from Bio import SeqIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in <module>
392s     from Bio.SeqIO import TwoBitIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in <module>
392s     raise MissingPythonDependencyError(
392s     ...<2 lines>...
392s     ) from None
392s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_MaskPrimers
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in <module>
392s     from . import multiarray
392s   File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in <module>
392s     from . import overrides
392s   File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in <module>
392s     from numpy.core._multiarray_umath import (
392s         add_docstring,  _get_implementing_args, _ArrayFunctionDispatcher)
392s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath'
392s 
392s During handling of the above exception, another exception occurred:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in <module>
392s     from numpy.__config__ import show as show_config
392s   File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in <module>
392s     from numpy.core._multiarray_umath import (
392s     ...<3 lines>...
392s     )
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in <module>
392s     raise ImportError(msg)
392s ImportError: 
392s 
392s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE!
392s 
392s Importing the numpy C-extensions failed. This error can happen for
392s many reasons, often due to issues with your setup or how NumPy was
392s installed.
392s 
392s We have compiled some common reasons and troubleshooting tips at:
392s 
392s     https://numpy.org/devdocs/user/troubleshooting-importerror.html
392s 
392s Please note and check the following:
392s 
392s   * The Python version is: Python3.13 from "/usr/bin/python3.13"
392s   * The NumPy version is: "1.26.4"
392s 
392s and make sure that they are the versions you expect.
392s Please carefully study the documentation linked above for further help.
392s 
392s Original error was: No module named 'numpy.core._multiarray_umath'
392s 
392s 
392s The above exception was the direct cause of the following exception:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_MaskPrimers.py", line 17, in <module>
392s     from presto.Sequence import getDNAScoreDict, localAlignment, scoreAlignment, extractAlignment, \
392s                                 maskSeq, PrimerAlignment
392s   File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in <module>
392s     import numpy as np
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in <module>
392s     raise ImportError(msg) from e
392s ImportError: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_Sequence
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in <module>
392s     from . import multiarray
392s   File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in <module>
392s     from . import overrides
392s   File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in <module>
392s     from numpy.core._multiarray_umath import (
392s         add_docstring,  _get_implementing_args, _ArrayFunctionDispatcher)
392s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath'
392s 
392s During handling of the above exception, another exception occurred:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in <module>
392s     from numpy.__config__ import show as show_config
392s   File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in <module>
392s     from numpy.core._multiarray_umath import (
392s     ...<3 lines>...
392s     )
392s   File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in <module>
392s     raise ImportError(msg)
392s ImportError: 
392s 
392s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE!
392s 
392s Importing the numpy C-extensions failed. This error can happen for
392s many reasons, often due to issues with your setup or how NumPy was
392s installed.
392s 
392s We have compiled some common reasons and troubleshooting tips at:
392s 
392s     https://numpy.org/devdocs/user/troubleshooting-importerror.html
392s 
392s Please note and check the following:
392s 
392s   * The Python version is: Python3.13 from "/usr/bin/python3.13"
392s   * The NumPy version is: "1.26.4"
392s 
392s and make sure that they are the versions you expect.
392s Please carefully study the documentation linked above for further help.
392s 
392s Original error was: No module named 'numpy.core._multiarray_umath'
392s 
392s 
392s The above exception was the direct cause of the following exception:
392s 
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_Sequence.py", line 18, in <module>
392s     from presto.Sequence import getDNAScoreDict, scoreDNA, scoreSeqPair, weightSeq, \
392s                                 calculateSetError, meanQuality, filterQuality
392s   File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in <module>
392s     import numpy as np
392s   File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in <module>
392s     raise ImportError(msg) from e
392s ImportError: Error importing numpy: you should not try to import numpy from
392s         its source directory; please exit the numpy source tree, and relaunch
392s         your python interpreter from there.
392s 
392s 
392s ======================================================================
392s ERROR: tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders)
392s ----------------------------------------------------------------------
392s ImportError: Failed to import test module: tests.test_UnifyHeaders
392s Traceback (most recent call last):
392s   File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path
392s     module = self._get_module_from_name(name)
392s   File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name
392s     __import__(name)
392s     ~~~~~~~~~~^^^^^^
392s   File "/tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build/tests/test_UnifyHeaders.py", line 16, in <module>
392s     from presto.Multiprocessing import SeqData
392s   File "/usr/lib/python3/dist-packages/presto/Multiprocessing.py", line 16, in <module>
392s     from Bio import SeqIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in <module>
392s     from Bio.SeqIO import TwoBitIO
392s   File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in <module>
392s     raise MissingPythonDependencyError(
392s     ...<2 lines>...
392s     ) from None
392s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/
392s 
392s 
392s ----------------------------------------------------------------------
392s Ran 13 tests in 0.002s
392s 
392s FAILED (errors=9)
392s E: pybuild pybuild:389: test: plugin distutils failed with: exit code=1: cd /tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build; python3.13 -m unittest discover -v 
392s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.XRQsI9/build.t5x/src/bin /tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build; rm /tmp/autopkgtest.XRQsI9/build.t5x/src/tests/test_ClusterSets.py || echo "Test file already removed or moved";
392s rm: cannot remove '/tmp/autopkgtest.XRQsI9/build.t5x/src/tests/test_ClusterSets.py': No such file or directory
392s I: pybuild base:311: cd /tmp/autopkgtest.XRQsI9/autopkgtest_tmp/build; python3.12 -m unittest discover -v 
393s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok
393s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok
393s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok
393s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok
393s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n'
393s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n'
393s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n'
393s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n'
393s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n'
393s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n'
393s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok
393s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok
393s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... -> test_collapseAnnotation()
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']})
393s <- test_collapseAnnotation() 0.000
393s -> test_getCoordKey()
393s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066']
393s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6']
393s ['000034_0199_0169', 'GXGJ56Z01AE06X']
393s <- test_getCoordKey() 0.000
393s -> test_mergeAnnotation()
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']})
393s <- test_mergeAnnotation() 0.000
393s -> test_renameAnnotation()
393s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']})
393s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'})
393s <- test_renameAnnotation() 0.000
393s -> test_calculateSetError()
393s Frequency consensus error>
393s   REF> CGGCGTAA
393s  SEQ1> CGGCGTAA
393s  SEQ2> CCNNGTAA
393s  SEQ3> CGGC--TA
393s  SEQ4> CGNN--TA
393s  SEQ5> CGGC--AA
393s ERROR> 0.250000
393s Quality consensus error>
393s   REF> CGGCNNAA
393s  SEQ1> CGGCGTAA
393s  SEQ2> CCNNGTAA
393s  SEQ3> CGGC--TA
393s  SEQ4> CGNN--TA
393s  SEQ5> CGGC--AA
393s ERROR> 0.233333
393s <- test_calculateSetError() 0.000
393s -> test_deleteSeqPositions()
393s MAX_GAP=0.4> CGGCAA
393s MAX_GAP=0.8> CGGCGTAA
393s <- test_deleteSeqPositions() 0.000
393s -> test_findGapPositions()
393s MAX_GAP=0.4> [4, 5]
393s MAX_GAP=0.8> []
393s <- test_findGapPositions() 0.000
393s -> test_frequencyConsensus()
393s MIN_FREQ=0.2> CGGCGTAA
393s MIN_FREQ=0.8> CGGCGTNA
393s <- test_frequencyConsensus() 0.000
393s -> test_qualityConsensus()
393s   MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90]
393s  MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90]
393s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90]
393s <- test_qualityConsensus() 0.000
393s -> test_checkSeqEqual()
393s DNA Equality>
393s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
393s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
393s          EQUAL> True
393s 
393s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
393s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
393s          EQUAL> False
393s 
393s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
393s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
393s          EQUAL> True
393s 
393s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
393s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
393s          EQUAL> False
393s 
393s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
393s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
393s          EQUAL> True
393s 
393s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
393s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
393s          EQUAL> True
393s 
393s <- test_checkSeqEqual() 0.000
393s -> test_convert454Header()
393s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'})
393s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'})
393s <- test_convert454Header() 0.000
393s -> test_convertGenbankHeader()
393s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
393s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'})
393s <- test_convertGenbankHeader() 0.000
393s -> test_convertGenericHeader()
393s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
393s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
393s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'})
393s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"})
393s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'})
393s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'})
393s <- test_convertGenericHeader() 0.000
393s -> test_convertIMGTHeader()
393s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'})
393s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'})
393s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'})
393s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'})
393s OrderedDict({'ID': 'IGHV1-18*01'})
393s OrderedDict({'ID': 'IGHV1-69*07'})
393s OrderedDict({'ID': 'IGHV(III)-22-2*01'})
393s OrderedDict({'ID': 'TRAV11*01'})
393s <- test_convertIMGTHeader() 0.000
393s -> test_convertIlluminaHeader()
393s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'})
393s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'})
393s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'})
393s <- test_convertIlluminaHeader() 0.000
393s -> test_convertSRAHeader()
393s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'})
393s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'})
393s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'})
393s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'})
393s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'})
393s <- test_convertSRAHeader() 0.000
393s -> test_calculateDistances()
393s <- test_calculateDistances() 0.001
393s -> test_countMismatches()
393s <- test_countMismatches() 0.001
393s -> test_initializeMismatchDictionary()
393s <- test_initializeMismatchDictionary() 0.000
393s -> test_getFileType()
393s <- test_getFileType() 0.000
393s -> test_extractAlignment()
393s   SEQ1>
393s       SEQ> CCACGTTTTAGTAATTAATA
393s   ALN-SEQ> CCACGTTTTAGT
393s    ALN-PR> ----GTTTTAGT
393s    PRIMER> GTTTTAGT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ2>
393s       SEQ> CCNCGTTTTAGTAATTAATA
393s   ALN-SEQ> CCNCGTTTTAGT
393s    ALN-PR> ----GTTTTAGT
393s    PRIMER> GTTTTAGT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ3>
393s       SEQ> GGGCGTTTTAGTAATTAATA
393s   ALN-SEQ> GGGCGTTTTAGT
393s    ALN-PR> ----GTTTTAGT
393s    PRIMER> GTTTTAGT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ4>
393s       SEQ> GGNNGTTTTACTAATTAATA
393s   ALN-SEQ> GGNNGTTTTACT
393s    ALN-PR> ----GTTTTACT
393s    PRIMER> GTTTTACT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ5>
393s       SEQ> NNGCNNNNNACTAATTAATA
393s   ALN-SEQ> NNGCNNNNNACT
393s    ALN-PR> ----NNNNNACT
393s    PRIMER> NNNNNACT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ6>
393s       SEQ> GGGATANNNACTAATTAATA
393s   ALN-SEQ> GGGATANNNACT
393s    ALN-PR> ----TANNNACT
393s    PRIMER> TANNNACT
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ7>
393s       SEQ> NNNNNNNNNNNNNNNNNNNN
393s   ALN-SEQ> NNNNNNNNNNNN
393s    ALN-PR> ----NNNNNNNN
393s    PRIMER> NNNNNNNN
393s     START> 4
393s       END> 12
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s <- test_extractAlignment() 0.000
393s -> test_localAlignment()
393s TEST Ns>
393s   SEQ1>
393s       SEQ> CCACGTTTTAGTAATTAATA
393s   ALN-SEQ> CCACGTTTTAGTAATTAATA
393s    ALN-PR> -CACGTTTT-----------
393s    PRIMER> PR1
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ2>
393s       SEQ> CCNCGTTTTAGTAATTAATA
393s   ALN-SEQ> CCNCGTTTTAGTAATTAATA
393s    ALN-PR> -CACGTTTT-----------
393s    PRIMER> PR1
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.125000
393s 
393s   SEQ3>
393s       SEQ> GGGCGTTTTAGTAATTAATA
393s   ALN-SEQ> GGGCGTTTTAGTAATTAATA
393s    ALN-PR> -GGCGTTTT-----------
393s    PRIMER> PR2
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ4>
393s       SEQ> GGNNGTTTTACTAATTAATA
393s   ALN-SEQ> GGNNGTTTTACTAATTAATA
393s    ALN-PR> GGC-GTTTT-----------
393s    PRIMER> PR2
393s     START> 0
393s       END> 9
393s      GAPS> 1
393s     ERROR> 0.250000
393s ok
393s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok
393s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok
393s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok
393s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok
393s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok
393s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok
393s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok
393s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok
393s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok
393s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object.
393s   warnings.warn(
393s ok
393s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok
393s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok
393s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok
393s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok
393s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok
393s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok
393s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok
393s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok
393s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok
393s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok
393s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok
393s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok
393s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok
393s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok
393s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok
393s 
393s ----------------------------------------------------------------------
393s Ran 38 tests in 0.055s
393s 
393s OK (skipped=6)
393s 
393s   SEQ5>
393s       SEQ> NNGCNNNNNACTAATTAATA
393s   ALN-SEQ> NNGCNNNNNACTAATTAATA
393s    ALN-PR> ------------ANATAA--
393s    PRIMER> PR3
393s     START> 12
393s       END> 18
393s      GAPS> 0
393s     ERROR> 0.375000
393s 
393s   SEQ6>
393s       SEQ> GGGATANNNACTAATTAATA
393s   ALN-SEQ> GGGATANNNACTAATTAATA
393s    ALN-PR> -GGANA--------------
393s    PRIMER> PR3
393s     START> 1
393s       END> 6
393s      GAPS> 0
393s     ERROR> 0.375000
393s 
393s   SEQ7>
393s       SEQ> NNNNNNNNNNNNNNNNNNNN
393s   ALN-SEQ> None
393s    ALN-PR> None
393s    PRIMER> None
393s     START> None
393s       END> None
393s      GAPS> 0
393s     ERROR> 1.000000
393s 
393s TEST INDELS>
393s   SEQ1>
393s       SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG
393s   ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG
393s    ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------
393s    PRIMER> PR1
393s     START> 15
393s       END> 38
393s      GAPS> 0
393s     ERROR> 0.083333
393s 
393s   SEQ2>
393s       SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG
393s   ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG
393s    ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------
393s    PRIMER> PR1
393s     START> 14
393s       END> 38
393s      GAPS> 2
393s     ERROR> 0.208333
393s 
393s   SEQ3>
393s       SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG
393s   ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG
393s    ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------
393s    PRIMER> PR1
393s     START> 15
393s       END> 38
393s      GAPS> 1
393s     ERROR> 0.125000
393s 
393s   SEQ4>
393s       SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT
393s   ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT
393s    ALN-PR> ------CATCT-TCCTCTA-------------------------------------------
393s    PRIMER> PR2
393s     START> 6
393s       END> 19
393s      GAPS> 1
393s     ERROR> 0.250000
393s 
393s   SEQ5>
393s       SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG
393s   ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG
393s    ALN-PR> ------CATCTTCCTCTA--------------------------------------------
393s    PRIMER> PR2
393s     START> 6
393s       END> 18
393s      GAPS> 0
393s     ERROR> 0.166667
393s 
393s   SEQ6>
393s       SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA
393s   ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA
393s    ALN-PR> TCT-TCCTCTA---------------------------------------------------
393s    PRIMER> PR2
393s     START> 0
393s       END> 11
393s      GAPS> 1
393s     ERROR> 0.250000
393s 
393s   SEQ7>
393s       SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s   ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s    ALN-PR> --GTGAAGA-GCCTG-----------------------------------------------
393s    PRIMER> PR3
393s     START> 2
393s       END> 15
393s      GAPS> 1
393s     ERROR> 0.083333
393s 
393s   SEQ8>
393s       SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s   ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s    ALN-PR> ---TGAAGA-GCCTG-----------------------------------------------
393s    PRIMER> PR3
393s     START> 3
393s       END> 15
393s      GAPS> 1
393s     ERROR> 0.166667
393s 
393s   SEQ9>
393s       SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s   ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
393s    ALN-PR> ---TGAAGA-GCCTG-----------------------------------------------
393s    PRIMER> PR3
393s     START> 3
393s       END> 15
393s      GAPS> 1
393s     ERROR> 0.333333
393s 
393s   SEQ10>
393s       SEQ> --------------------------------------------------------------
393s   ALN-SEQ> None
393s    ALN-PR> None
393s    PRIMER> None
393s     START> None
393s       END> None
393s      GAPS> 0
393s     ERROR> 1.000000
393s 
393s <- test_localAlignment() 0.027
393s -> test_maskSeq()
393s TEST CUT>
393s  ID> SEQ|PRIMER=A|BARCODE=CCA
393s SEQ> AGTAATTAATA
393s 
393s TEST MASK>
393s  ID> SEQ|PRIMER=A|BARCODE=CCA
393s SEQ> NNNNNNAGTAATTAATA
393s 
393s TEST TRIM>
393s  ID> SEQ|PRIMER=A|BARCODE=CCA
393s SEQ> CGTTTTAGTAATTAATA
393s 
393s TEST TAG>
393s  ID> SEQ|PRIMER=A|BARCODE=CCA
393s SEQ> CCACGTTTTAGTAATTAATA
393s 
393s <- test_maskSeq() 0.001
393s -> test_scoreAlignment()
393s   SEQ1>
393s       SEQ> CCACGTTTTAGTAATTAATA
393s   ALN-SEQ> CCACGTTTT
393s    ALN-PR> -CACGTTTT
393s    PRIMER> PR1
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ2>
393s       SEQ> CCNCGTTTTAGTAATTAATA
393s   ALN-SEQ> CCNCGTTTT
393s    ALN-PR> -CACGTTTT
393s    PRIMER> PR1
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.125000
393s 
393s   SEQ3>
393s       SEQ> GGGCGTTTTAGTAATTAATA
393s   ALN-SEQ> GGGCGTTTT
393s    ALN-PR> -GGCGTTTT
393s    PRIMER> PR2
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.000000
393s 
393s   SEQ4>
393s       SEQ> GGNNGTTTTACTAATTAATA
393s   ALN-SEQ> GGNNGTTTT
393s    ALN-PR> -GGCGTTTT
393s    PRIMER> PR2
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.250000
393s 
393s   SEQ5>
393s       SEQ> NNGCNNNNNACTAATTAATA
393s   ALN-SEQ> NNGCNNNNN
393s    ALN-PR> -GGCGTTTT
393s    PRIMER> PR2
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.750000
393s 
393s   SEQ6>
393s       SEQ> GGGATANNNACTAATTAATA
393s   ALN-SEQ> GGGATANNN
393s    ALN-PR> -GGANATAA
393s    PRIMER> PR3
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 0.375000
393s 
393s   SEQ7>
393s       SEQ> NNNNNNNNNNNNNNNNNNNN
393s   ALN-SEQ> NNNNNNNNN
393s    ALN-PR> -CACGTTTT
393s    PRIMER> None
393s     START> 1
393s       END> 9
393s      GAPS> 0
393s     ERROR> 1.000000
393s 
393s <- test_scoreAlignment() 0.009
393s -> test_calculateSetError()
393s REF> CGGCGTAA 0.4347826086956522
393s REF> NNNNNNNN 1.0
393s <- test_calculateSetError() 0.000
393s -> test_filterQuality()
393s RESULT> True 25
393s RESULT> False 5
393s RESULT> False 0
393s <- test_filterQuality() 0.000
393s -> test_meanQuality()
393s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40]
393s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20]
393s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0]
393s <- test_meanQuality() 0.000
393s -> test_scoreDNA()
393s Default DNA Scores>
393s   A==A> 1
393s   A==T> 0
393s   A==R> 1
393s   U==T> 1
393s   A==N> 1
393s   N==A> 1
393s   A==-> 0
393s   -==A> 0
393s Symmetric DNA Scores>
393s   A==A> 1
393s   A==T> 0
393s   A==R> 1
393s   U==T> 1
393s   A==N> 1
393s   N==A> 1
393s   A==-> 1
393s   -==A> 1
393s Asymmetric DNA Scores>
393s   A==A> 1
393s   A==T> 0
393s   A==R> 1
393s   U==T> 1
393s   A==N> 1
393s   N==A> 0
393s   A==-> 1
393s   -==A> 0
393s <- test_scoreDNA() 0.000
393s -> test_scoreSeqPair()
393s Default DNA Scores>
393s     SEQ1> CGGCGTAA
393s     SEQ2> CGNNGTAG
393s    SCORE> 7
393s   WEIGHT> 8
393s    ERROR> 0.125000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ3> CGGC--AA
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ4> CGNN--AG
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ5> NNNNNNNN
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ6> NNNNNNAA
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ3> CGGC--AA
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ4> CGNN--AG
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ5> NNNNNNNN
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ6> NNNNNNAA
393s    SCORE> 7
393s   WEIGHT> 8
393s    ERROR> 0.125000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ4> CGNN--AG
393s    SCORE> 7
393s   WEIGHT> 8
393s    ERROR> 0.125000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ5> NNNNNNNN
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ6> NNNNNNAA
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ7> --------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ8> CG------
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ5> NNNNNNNN
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ6> NNNNNNAA
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ7> --------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ8> CG------
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ6> NNNNNNAA
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ7> --------
393s     SEQ8> CG------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s Asymmetric DNA Scores>
393s     SEQ1> CGGCGTAA
393s     SEQ2> CGNNGTAG
393s    SCORE> 7
393s   WEIGHT> 8
393s    ERROR> 0.125000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ3> CGGC--AA
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ4> CGNN--AG
393s    SCORE> 7
393s   WEIGHT> 8
393s    ERROR> 0.125000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ5> NNNNNNNN
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ6> NNNNNNAA
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ7> --------
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ8> CG------
393s    SCORE> 8
393s   WEIGHT> 8
393s    ERROR> 0.000000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ3> CGGC--AA
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ4> CGNN--AG
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ5> NNNNNNNN
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ6> NNNNNNAA
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ7> --------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ8> CG------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ4> CGNN--AG
393s    SCORE> 5
393s   WEIGHT> 8
393s    ERROR> 0.375000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ5> NNNNNNNN
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ6> NNNNNNAA
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ7> --------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ8> CG------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ5> NNNNNNNN
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ6> NNNNNNAA
393s    SCORE> 3
393s   WEIGHT> 8
393s    ERROR> 0.625000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ7> --------
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ8> CG------
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ6> NNNNNNAA
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ8> CG------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ7> --------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ7> --------
393s     SEQ8> CG------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s Masked DNA Scores>
393s     SEQ1> CGGCGTAA
393s     SEQ2> CGNNGTAG
393s    SCORE> 5
393s   WEIGHT> 6
393s    ERROR> 0.166667
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ3> CGGC--AA
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ4> CGNN--AG
393s    SCORE> 3
393s   WEIGHT> 6
393s    ERROR> 0.500000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ5> NNNNNNNN
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ6> NNNNNNAA
393s    SCORE> 2
393s   WEIGHT> 2
393s    ERROR> 0.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 8
393s    ERROR> 1.000000
393s 
393s     SEQ1> CGGCGTAA
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ3> CGGC--AA
393s    SCORE> 3
393s   WEIGHT> 6
393s    ERROR> 0.500000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ4> CGNN--AG
393s    SCORE> 4
393s   WEIGHT> 6
393s    ERROR> 0.333333
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ5> NNNNNNNN
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ6> NNNNNNAA
393s    SCORE> 1
393s   WEIGHT> 2
393s    ERROR> 0.500000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 6
393s    ERROR> 1.000000
393s 
393s     SEQ2> CGNNGTAG
393s     SEQ8> CG------
393s    SCORE> 2
393s   WEIGHT> 6
393s    ERROR> 0.666667
393s 
393s     SEQ3> CGGC--AA
393s     SEQ4> CGNN--AG
393s    SCORE> 5
393s   WEIGHT> 6
393s    ERROR> 0.166667
393s 
393s     SEQ3> CGGC--AA
393s     SEQ5> NNNNNNNN
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ6> NNNNNNAA
393s    SCORE> 2
393s   WEIGHT> 2
393s    ERROR> 0.000000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ7> --------
393s    SCORE> 2
393s   WEIGHT> 8
393s    ERROR> 0.750000
393s 
393s     SEQ3> CGGC--AA
393s     SEQ8> CG------
393s    SCORE> 4
393s   WEIGHT> 8
393s    ERROR> 0.500000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ5> NNNNNNNN
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ6> NNNNNNAA
393s    SCORE> 1
393s   WEIGHT> 2
393s    ERROR> 0.500000
393s 
393s     SEQ4> CGNN--AG
393s     SEQ7> --------
393s    SCORE> 2
393s   WEIGHT> 6
393s    ERROR> 0.666667
393s 
393s     SEQ4> CGNN--AG
393s     SEQ8> CG------
393s    SCORE> 4
393s   WEIGHT> 6
393s    ERROR> 0.333333
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ6> NNNNNNAA
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ5> NNNNNNNN
393s     SEQ8> CG------
393s    SCORE> 0
393s   WEIGHT> 0
393s    ERROR> 1.000000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ7> --------
393s    SCORE> 0
393s   WEIGHT> 2
393s    ERROR> 1.000000
393s 
393s     SEQ6> NNNNNNAA
393s     SEQ8> CG------
393s    SCORE> 0
393s   WEIGHT> 2
393s    ERROR> 1.000000
393s 
393s     SEQ7> --------
393s     SEQ8> CG------
393s    SCORE> 6
393s   WEIGHT> 8
393s    ERROR> 0.250000
393s 
393s <- test_scoreSeqPair() 0.007
393s -> test_weightDNA()
393s DNA Weight>
393s   SEQ1> 8
393s   SEQ2> 6
393s   SEQ3> 8
393s   SEQ4> 6
393s   SEQ5> 0
393s   SEQ6> 2
393s   SEQ7> 8
393s   SEQ8> 8
393s AA Weight>
393s   SEQ1> 8
393s   SEQ2> 6
393s   SEQ3> 8
393s   SEQ4> 6
393s <- test_weightDNA() 0.000
393s -> test_consensusUnify()
393s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1
393s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1
393s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1
393s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1
393s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1
393s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1
393s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2
393s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2
393s <- test_consensusUnify() 0.000
393s -> test_deletionUnify()
393s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False
393s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False
393s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False
393s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False
393s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False
393s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False
393s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True
393s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True
393s <- test_deletionUnify() 0.000
393s pybuild-autopkgtest: error: pybuild --autopkgtest -i python{version} -p "3.13 3.12" returned exit code 13
393s make: *** [/tmp/0KPaavpmJj/run:4: pybuild-autopkgtest] Error 25
393s pybuild-autopkgtest: error: /tmp/0KPaavpmJj/run pybuild-autopkgtest returned exit code 2
394s autopkgtest [17:12:00]: test pybuild-autopkgtest: -----------------------]
399s autopkgtest [17:12:05]: test pybuild-autopkgtest:  - - - - - - - - - - results - - - - - - - - - -
399s pybuild-autopkgtest  FAIL non-zero exit status 25
403s autopkgtest [17:12:09]: @@@@@@@@@@@@@@@@@@@@ summary
403s pybuild-autopkgtest  FAIL non-zero exit status 25