0s autopkgtest [18:26:38]: starting date and time: 2024-11-13 18:26:38+0000 0s autopkgtest [18:26:38]: git checkout: 6f3be7a8 Fix armhf LXD image generation for plucky 0s autopkgtest [18:26:38]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.bencdj_m/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- lxd -r lxd-armhf-10.145.243.52 lxd-armhf-10.145.243.52:autopkgtest/ubuntu/plucky/armhf 53s autopkgtest [18:27:31]: testbed dpkg architecture: armhf 56s autopkgtest [18:27:34]: testbed apt version: 2.9.8 56s autopkgtest [18:27:34]: @@@@@@@@@@@@@@@@@@@@ test bed setup 64s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 64s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [971 kB] 64s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [104 kB] 64s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [17.2 kB] 64s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 64s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [106 kB] 64s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [647 kB] 64s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [17.2 kB] 65s Fetched 1943 kB in 1s (2026 kB/s) 65s Reading package lists... 83s tee: /proc/self/fd/2: Permission denied 104s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 105s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 105s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 105s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 106s Reading package lists... 106s Reading package lists... 106s Building dependency tree... 106s Reading state information... 107s Calculating upgrade... 107s The following packages were automatically installed and are no longer required: 107s libperl5.38t64 perl-modules-5.38 python3-netifaces 107s Use 'apt autoremove' to remove them. 107s The following NEW packages will be installed: 107s libperl5.40 perl-modules-5.40 python3.13-gdbm systemd-cryptsetup 107s The following packages will be upgraded: 107s apport apport-core-dump-handler base-files base-passwd bash-completion 107s dhcpcd-base distro-info-data dpkg dpkg-dev fwupd gcc-14-base info 107s install-info iproute2 libarchive13t64 libatomic1 libattr1 107s libblockdev-crypto3 libblockdev-fs3 libblockdev-loop3 libblockdev-mdraid3 107s libblockdev-nvme3 libblockdev-part3 libblockdev-swap3 libblockdev-utils3 107s libblockdev3 libbpf1 libbsd0 libbytesize-common libbytesize1 libdb5.3t64 107s libdpkg-perl libdrm-common libdrm2 libdw1t64 libedit2 libelf1t64 libevdev2 107s libfastjson4 libflashrom1 libftdi1-2 libfwupd2 libgcc-s1 libgnutls30t64 107s libgpgme11t64 libinih1 libjson-c5 libjson-glib-1.0-0 libjson-glib-1.0-common 107s libkeyutils1 libldap-common libldap2 liblocale-gettext-perl libmaxminddb0 107s libmnl0 libnetfilter-conntrack3 libnetplan1 libnghttp2-14 libnspr4 107s libnss-systemd libnvme1t64 libpam-systemd libpipeline1 libplymouth5 107s libpng16-16t64 libpopt0 libpython3-stdlib libpython3.12-minimal 107s libpython3.12-stdlib libsgutils2-1.46-2 libssh2-1t64 libstdc++6 107s libsystemd-shared libsystemd0 libtext-charwidth-perl libtext-iconv-perl 107s libtraceevent1 libtraceevent1-plugin libudev1 libudisks2-0 liburcu8t64 107s libutempter0 libuv1t64 libx11-6 libx11-data libxau6 libxmlb2 mawk 107s motd-news-config nano netplan-generator netplan.io openssh-client 107s openssh-server openssh-sftp-server pci.ids perl perl-base plymouth 107s plymouth-theme-ubuntu-text python3 python3-apport python3-certifi 107s python3-cffi-backend python3-configobj python3-gdbm python3-gi python3-idna 107s python3-jaraco.functools python3-json-pointer python3-jsonpatch 107s python3-lazr.restfulclient python3-lazr.uri python3-minimal 107s python3-more-itertools python3-netplan python3-oauthlib 107s python3-problem-report python3-typeguard python3-urllib3 python3-wadllib 107s python3-zipp python3.12 python3.12-gdbm python3.12-minimal sg3-utils 107s sg3-utils-udev ssh-import-id systemd systemd-resolved systemd-sysv 107s systemd-timesyncd tzdata udev udisks2 ufw usbutils vim-common vim-tiny xxd 108s 140 upgraded, 4 newly installed, 0 to remove and 0 not upgraded. 108s Need to get 45.4 MB of archives. 108s After this operation, 43.1 MB of additional disk space will be used. 108s Get:1 http://ftpmaster.internal/ubuntu plucky/main armhf motd-news-config all 13.5ubuntu3 [5190 B] 108s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf base-files armhf 13.5ubuntu3 [75.1 kB] 108s Get:3 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg armhf 1.22.11ubuntu3 [1247 kB] 108s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf perl-modules-5.40 all 5.40.0-7 [3214 kB] 108s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf libperl5.40 armhf 5.40.0-7 [4139 kB] 108s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf perl armhf 5.40.0-7 [263 kB] 108s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf perl-base armhf 5.40.0-7 [1674 kB] 108s Get:8 http://ftpmaster.internal/ubuntu plucky/main armhf liblocale-gettext-perl armhf 1.07-7build1 [15.0 kB] 108s Get:9 http://ftpmaster.internal/ubuntu plucky/main armhf libtext-iconv-perl armhf 1.7-8build4 [12.8 kB] 108s Get:10 http://ftpmaster.internal/ubuntu plucky/main armhf libtext-charwidth-perl armhf 0.04-11build4 [9128 B] 108s Get:11 http://ftpmaster.internal/ubuntu plucky/main armhf libdb5.3t64 armhf 5.3.28+dfsg2-9 [655 kB] 108s Get:12 http://ftpmaster.internal/ubuntu plucky/main armhf base-passwd armhf 3.6.5 [53.2 kB] 108s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3-minimal armhf 3.12.7-1 [27.4 kB] 108s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3 armhf 3.12.7-1 [24.0 kB] 108s Get:15 http://ftpmaster.internal/ubuntu plucky/main armhf tzdata all 2024b-1ubuntu2 [274 kB] 108s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12 armhf 3.12.7-3 [661 kB] 108s Get:17 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-stdlib armhf 3.12.7-3 [1934 kB] 108s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-minimal armhf 3.12.7-3 [2012 kB] 109s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-minimal armhf 3.12.7-3 [822 kB] 109s Get:20 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libpython3-stdlib armhf 3.12.7-1 [10.0 kB] 109s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf libnss-systemd armhf 256.5-2ubuntu4 [155 kB] 109s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-timesyncd armhf 256.5-2ubuntu4 [40.7 kB] 109s Get:23 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-resolved armhf 256.5-2ubuntu4 [309 kB] 109s Get:24 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd-shared armhf 256.5-2ubuntu4 [2129 kB] 109s Get:25 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd0 armhf 256.5-2ubuntu4 [428 kB] 109s Get:26 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-sysv armhf 256.5-2ubuntu4 [11.9 kB] 109s Get:27 http://ftpmaster.internal/ubuntu plucky/main armhf libpam-systemd armhf 256.5-2ubuntu4 [226 kB] 109s Get:28 http://ftpmaster.internal/ubuntu plucky/main armhf systemd armhf 256.5-2ubuntu4 [3442 kB] 109s Get:29 http://ftpmaster.internal/ubuntu plucky/main armhf udev armhf 256.5-2ubuntu4 [1949 kB] 109s Get:30 http://ftpmaster.internal/ubuntu plucky/main armhf libudev1 armhf 256.5-2ubuntu4 [188 kB] 109s Get:31 http://ftpmaster.internal/ubuntu plucky/main armhf python3-problem-report all 2.30.0-0ubuntu5 [25.0 kB] 109s Get:32 http://ftpmaster.internal/ubuntu plucky/main armhf python3-apport all 2.30.0-0ubuntu5 [93.2 kB] 109s Get:33 http://ftpmaster.internal/ubuntu plucky/main armhf python3-gi armhf 3.50.0-3 [227 kB] 109s Get:34 http://ftpmaster.internal/ubuntu plucky/main armhf apport-core-dump-handler all 2.30.0-0ubuntu5 [17.9 kB] 109s Get:35 http://ftpmaster.internal/ubuntu plucky/main armhf apport all 2.30.0-0ubuntu5 [83.0 kB] 109s Get:36 http://ftpmaster.internal/ubuntu plucky/main armhf libbsd0 armhf 0.12.2-2 [36.8 kB] 109s Get:37 http://ftpmaster.internal/ubuntu plucky/main armhf libedit2 armhf 3.1-20240808-1 [79.0 kB] 109s Get:38 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-sftp-server armhf 1:9.7p1-7ubuntu5 [35.4 kB] 109s Get:39 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-server armhf 1:9.7p1-7ubuntu5 [505 kB] 109s Get:40 http://ftpmaster.internal/ubuntu plucky/main armhf openssh-client armhf 1:9.7p1-7ubuntu5 [889 kB] 109s Get:41 http://ftpmaster.internal/ubuntu plucky/main armhf libatomic1 armhf 14.2.0-8ubuntu1 [7846 B] 109s Get:42 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-14-base armhf 14.2.0-8ubuntu1 [51.5 kB] 109s Get:43 http://ftpmaster.internal/ubuntu plucky/main armhf libstdc++6 armhf 14.2.0-8ubuntu1 [711 kB] 109s Get:44 http://ftpmaster.internal/ubuntu plucky/main armhf libgcc-s1 armhf 14.2.0-8ubuntu1 [40.8 kB] 109s Get:45 http://ftpmaster.internal/ubuntu plucky/main armhf libattr1 armhf 1:2.5.2-2 [10.5 kB] 109s Get:46 http://ftpmaster.internal/ubuntu plucky/main armhf libgnutls30t64 armhf 3.8.8-2ubuntu1 [955 kB] 109s Get:47 http://ftpmaster.internal/ubuntu plucky/main armhf install-info armhf 7.1.1-1 [61.4 kB] 109s Get:48 http://ftpmaster.internal/ubuntu plucky/main armhf mawk armhf 1.3.4.20240905-1 [116 kB] 109s Get:49 http://ftpmaster.internal/ubuntu plucky/main armhf dhcpcd-base armhf 1:10.1.0-2 [188 kB] 109s Get:50 http://ftpmaster.internal/ubuntu plucky/main armhf distro-info-data all 0.63 [6588 B] 109s Get:51 http://ftpmaster.internal/ubuntu plucky/main armhf libdw1t64 armhf 0.192-4 [243 kB] 109s Get:52 http://ftpmaster.internal/ubuntu plucky/main armhf libelf1t64 armhf 0.192-4 [50.2 kB] 109s Get:53 http://ftpmaster.internal/ubuntu plucky/main armhf libbpf1 armhf 1:1.5.0-1 [158 kB] 109s Get:54 http://ftpmaster.internal/ubuntu plucky/main armhf libmnl0 armhf 1.0.5-3 [10.7 kB] 109s Get:55 http://ftpmaster.internal/ubuntu plucky/main armhf iproute2 armhf 6.10.0-2ubuntu1 [1082 kB] 109s Get:56 http://ftpmaster.internal/ubuntu plucky/main armhf libfastjson4 armhf 1.2304.0-2 [20.2 kB] 109s Get:57 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-c5 armhf 0.18+ds-1 [33.2 kB] 109s Get:58 http://ftpmaster.internal/ubuntu plucky/main armhf libkeyutils1 armhf 1.6.3-4ubuntu2 [8712 B] 109s Get:59 http://ftpmaster.internal/ubuntu plucky/main armhf netplan-generator armhf 1.1.1-1 [60.4 kB] 109s Get:60 http://ftpmaster.internal/ubuntu plucky/main armhf python3-cffi-backend armhf 1.17.1-2 [68.7 kB] 109s Get:61 http://ftpmaster.internal/ubuntu plucky/main armhf python3-netplan armhf 1.1.1-1 [24.1 kB] 109s Get:62 http://ftpmaster.internal/ubuntu plucky/main armhf netplan.io armhf 1.1.1-1 [66.4 kB] 109s Get:63 http://ftpmaster.internal/ubuntu plucky/main armhf libnetplan1 armhf 1.1.1-1 [122 kB] 109s Get:64 http://ftpmaster.internal/ubuntu plucky/main armhf libpopt0 armhf 1.19+dfsg-2 [25.4 kB] 109s Get:65 http://ftpmaster.internal/ubuntu plucky/main armhf vim-tiny armhf 2:9.1.0777-1ubuntu1 [693 kB] 109s Get:66 http://ftpmaster.internal/ubuntu plucky/main armhf vim-common all 2:9.1.0777-1ubuntu1 [394 kB] 109s Get:67 http://ftpmaster.internal/ubuntu plucky/main armhf xxd armhf 2:9.1.0777-1ubuntu1 [66.8 kB] 109s Get:68 http://ftpmaster.internal/ubuntu plucky/main armhf bash-completion all 1:2.14.0-2 [210 kB] 109s Get:69 http://ftpmaster.internal/ubuntu plucky/main armhf info armhf 7.1.1-1 [126 kB] 109s Get:70 http://ftpmaster.internal/ubuntu plucky/main armhf libdrm-common all 2.4.123-1 [8436 B] 109s Get:71 http://ftpmaster.internal/ubuntu plucky/main armhf libdrm2 armhf 2.4.123-1 [36.5 kB] 109s Get:72 http://ftpmaster.internal/ubuntu plucky/main armhf libevdev2 armhf 1.13.3+dfsg-1 [29.7 kB] 109s Get:73 http://ftpmaster.internal/ubuntu plucky/main armhf libmaxminddb0 armhf 1.11.0-1 [16.8 kB] 109s Get:74 http://ftpmaster.internal/ubuntu plucky/main armhf libnetfilter-conntrack3 armhf 1.1.0-1 [38.4 kB] 109s Get:75 http://ftpmaster.internal/ubuntu plucky/main armhf libnghttp2-14 armhf 1.64.0-1 [68.9 kB] 109s Get:76 http://ftpmaster.internal/ubuntu plucky/main armhf libpipeline1 armhf 1.5.8-1 [26.9 kB] 109s Get:77 http://ftpmaster.internal/ubuntu plucky/main armhf libpng16-16t64 armhf 1.6.44-2 [168 kB] 109s Get:78 http://ftpmaster.internal/ubuntu plucky/main armhf libplymouth5 armhf 24.004.60-1ubuntu11 [140 kB] 109s Get:79 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1-plugin armhf 1:1.8.3-1ubuntu1 [18.1 kB] 109s Get:80 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1 armhf 1:1.8.3-1ubuntu1 [52.1 kB] 109s Get:81 http://ftpmaster.internal/ubuntu plucky/main armhf liburcu8t64 armhf 0.14.1-1 [56.6 kB] 109s Get:82 http://ftpmaster.internal/ubuntu plucky/main armhf libuv1t64 armhf 1.48.0-7 [83.3 kB] 109s Get:83 http://ftpmaster.internal/ubuntu plucky/main armhf libx11-data all 2:1.8.10-2 [116 kB] 109s Get:84 http://ftpmaster.internal/ubuntu plucky/main armhf libx11-6 armhf 2:1.8.10-2 [587 kB] 109s Get:85 http://ftpmaster.internal/ubuntu plucky/main armhf libxau6 armhf 1:1.0.11-1 [6558 B] 109s Get:86 http://ftpmaster.internal/ubuntu plucky/main armhf nano armhf 8.2-1 [276 kB] 109s Get:87 http://ftpmaster.internal/ubuntu plucky/main armhf pci.ids all 0.0~2024.10.24-1 [279 kB] 110s Get:88 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth-theme-ubuntu-text armhf 24.004.60-1ubuntu11 [9920 B] 110s Get:89 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth armhf 24.004.60-1ubuntu11 [142 kB] 110s Get:90 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-gdbm armhf 3.12.7-3 [28.7 kB] 110s Get:91 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13-gdbm armhf 3.13.0-2 [29.5 kB] 110s Get:92 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf python3-gdbm armhf 3.12.7-1 [8642 B] 110s Get:93 http://ftpmaster.internal/ubuntu plucky/main armhf ufw all 0.36.2-8 [170 kB] 110s Get:94 http://ftpmaster.internal/ubuntu plucky/main armhf usbutils armhf 1:018-1 [76.1 kB] 110s Get:95 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg-dev all 1.22.11ubuntu3 [1088 kB] 110s Get:96 http://ftpmaster.internal/ubuntu plucky/main armhf libdpkg-perl all 1.22.11ubuntu3 [279 kB] 110s Get:97 http://ftpmaster.internal/ubuntu plucky/main armhf libarchive13t64 armhf 3.7.4-1.1 [331 kB] 110s Get:98 http://ftpmaster.internal/ubuntu plucky/main armhf libftdi1-2 armhf 1.5-7 [25.7 kB] 110s Get:99 http://ftpmaster.internal/ubuntu plucky/main armhf libflashrom1 armhf 1.4.0-3ubuntu1 [141 kB] 110s Get:100 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-common all 1.10.0+ds-3 [5586 B] 110s Get:101 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-0 armhf 1.10.0+ds-3 [61.7 kB] 110s Get:102 http://ftpmaster.internal/ubuntu plucky/main armhf libfwupd2 armhf 1.9.26-2 [125 kB] 110s Get:103 http://ftpmaster.internal/ubuntu plucky/main armhf libxmlb2 armhf 0.3.21-1 [57.7 kB] 110s Get:104 http://ftpmaster.internal/ubuntu plucky/main armhf fwupd armhf 1.9.26-2 [4404 kB] 110s Get:105 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-utils3 armhf 3.2.1-1 [17.4 kB] 110s Get:106 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-crypto3 armhf 3.2.1-1 [22.4 kB] 110s Get:107 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-fs3 armhf 3.2.1-1 [34.3 kB] 110s Get:108 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-loop3 armhf 3.2.1-1 [6552 B] 110s Get:109 http://ftpmaster.internal/ubuntu plucky/main armhf libbytesize1 armhf 2.11-1ubuntu1 [12.0 kB] 110s Get:110 http://ftpmaster.internal/ubuntu plucky/main armhf libbytesize-common all 2.11-1ubuntu1 [3584 B] 110s Get:111 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-mdraid3 armhf 3.2.1-1 [13.4 kB] 110s Get:112 http://ftpmaster.internal/ubuntu plucky/main armhf libnvme1t64 armhf 1.11-1 [73.8 kB] 110s Get:113 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-nvme3 armhf 3.2.1-1 [17.6 kB] 111s Get:114 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-part3 armhf 3.2.1-1 [16.5 kB] 111s Get:115 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-swap3 armhf 3.2.1-1 [8952 B] 111s Get:116 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev3 armhf 3.2.1-1 [44.2 kB] 111s Get:117 http://ftpmaster.internal/ubuntu plucky/main armhf libgpgme11t64 armhf 1.23.2-5ubuntu4 [123 kB] 111s Get:118 http://ftpmaster.internal/ubuntu plucky/main armhf libinih1 armhf 58-1ubuntu1 [6750 B] 111s Get:119 http://ftpmaster.internal/ubuntu plucky/main armhf libldap-common all 2.6.8+dfsg-1~exp4ubuntu3 [32.3 kB] 111s Get:120 http://ftpmaster.internal/ubuntu plucky/main armhf libldap2 armhf 2.6.8+dfsg-1~exp4ubuntu3 [173 kB] 111s Get:121 http://ftpmaster.internal/ubuntu plucky/main armhf libnspr4 armhf 2:4.35-1.1ubuntu2 [94.1 kB] 111s Get:122 http://ftpmaster.internal/ubuntu plucky/main armhf libsgutils2-1.46-2 armhf 1.46-3ubuntu5 [82.5 kB] 111s Get:123 http://ftpmaster.internal/ubuntu plucky/main armhf libssh2-1t64 armhf 1.11.1-1 [116 kB] 111s Get:124 http://ftpmaster.internal/ubuntu plucky/main armhf udisks2 armhf 2.10.1-11ubuntu1 [278 kB] 111s Get:125 http://ftpmaster.internal/ubuntu plucky/main armhf libudisks2-0 armhf 2.10.1-11ubuntu1 [142 kB] 111s Get:126 http://ftpmaster.internal/ubuntu plucky/main armhf libutempter0 armhf 1.2.1-4 [9062 B] 111s Get:127 http://ftpmaster.internal/ubuntu plucky/main armhf python3-certifi all 2024.8.30+dfsg-1 [9742 B] 111s Get:128 http://ftpmaster.internal/ubuntu plucky/main armhf python3-configobj all 5.0.9-1 [33.9 kB] 111s Get:129 http://ftpmaster.internal/ubuntu plucky/main armhf python3-idna all 3.8-2 [47.0 kB] 111s Get:130 http://ftpmaster.internal/ubuntu plucky/main armhf python3-more-itertools all 10.5.0-1 [56.2 kB] 111s Get:131 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jaraco.functools all 4.1.0-1 [11.8 kB] 111s Get:132 http://ftpmaster.internal/ubuntu plucky/main armhf python3-json-pointer all 2.4-2 [8396 B] 111s Get:133 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jsonpatch all 1.32-4 [12.2 kB] 111s Get:134 http://ftpmaster.internal/ubuntu plucky/main armhf python3-lazr.uri all 1.0.6-4 [13.6 kB] 111s Get:135 http://ftpmaster.internal/ubuntu plucky/main armhf python3-wadllib all 2.0.0-1 [36.7 kB] 111s Get:136 http://ftpmaster.internal/ubuntu plucky/main armhf python3-oauthlib all 3.2.2-2 [89.8 kB] 111s Get:137 http://ftpmaster.internal/ubuntu plucky/main armhf python3-lazr.restfulclient all 0.14.6-2 [50.9 kB] 111s Get:138 http://ftpmaster.internal/ubuntu plucky/main armhf python3-typeguard all 4.4.1-1 [29.0 kB] 111s Get:139 http://ftpmaster.internal/ubuntu plucky/main armhf python3-urllib3 all 2.0.7-2ubuntu0.1 [93.1 kB] 111s Get:140 http://ftpmaster.internal/ubuntu plucky/main armhf python3-zipp all 3.21.0-1 [10.2 kB] 111s Get:141 http://ftpmaster.internal/ubuntu plucky/main armhf sg3-utils armhf 1.46-3ubuntu5 [816 kB] 111s Get:142 http://ftpmaster.internal/ubuntu plucky/main armhf sg3-utils-udev all 1.46-3ubuntu5 [5916 B] 111s Get:143 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-cryptsetup armhf 256.5-2ubuntu4 [122 kB] 111s Get:144 http://ftpmaster.internal/ubuntu plucky/main armhf ssh-import-id all 5.11-0ubuntu3 [10.1 kB] 112s Preconfiguring packages ... 112s Fetched 45.4 MB in 4s (12.7 MB/s) 112s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59386 files and directories currently installed.) 112s Preparing to unpack .../motd-news-config_13.5ubuntu3_all.deb ... 112s Unpacking motd-news-config (13.5ubuntu3) over (13.3ubuntu6) ... 112s Preparing to unpack .../base-files_13.5ubuntu3_armhf.deb ... 112s Unpacking base-files (13.5ubuntu3) over (13.3ubuntu6) ... 112s Setting up base-files (13.5ubuntu3) ... 112s Installing new version of config file /etc/issue ... 112s Installing new version of config file /etc/issue.net ... 112s Installing new version of config file /etc/lsb-release ... 113s motd-news.service is a disabled or a static unit not running, not starting it. 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59386 files and directories currently installed.) 113s Preparing to unpack .../dpkg_1.22.11ubuntu3_armhf.deb ... 113s Unpacking dpkg (1.22.11ubuntu3) over (1.22.11ubuntu1) ... 113s Setting up dpkg (1.22.11ubuntu3) ... 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59386 files and directories currently installed.) 113s Preparing to unpack .../perl_5.40.0-7_armhf.deb ... 113s Unpacking perl (5.40.0-7) over (5.38.2-5) ... 113s Selecting previously unselected package perl-modules-5.40. 113s Preparing to unpack .../perl-modules-5.40_5.40.0-7_all.deb ... 113s Unpacking perl-modules-5.40 (5.40.0-7) ... 114s Selecting previously unselected package libperl5.40:armhf. 114s Preparing to unpack .../libperl5.40_5.40.0-7_armhf.deb ... 114s Unpacking libperl5.40:armhf (5.40.0-7) ... 114s Preparing to unpack .../perl-base_5.40.0-7_armhf.deb ... 114s Unpacking perl-base (5.40.0-7) over (5.38.2-5) ... 114s Setting up perl-base (5.40.0-7) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61464 files and directories currently installed.) 114s Preparing to unpack .../liblocale-gettext-perl_1.07-7build1_armhf.deb ... 114s Unpacking liblocale-gettext-perl (1.07-7build1) over (1.07-7) ... 114s Preparing to unpack .../libtext-iconv-perl_1.7-8build4_armhf.deb ... 114s Unpacking libtext-iconv-perl:armhf (1.7-8build4) over (1.7-8build3) ... 114s Preparing to unpack .../libtext-charwidth-perl_0.04-11build4_armhf.deb ... 114s Unpacking libtext-charwidth-perl:armhf (0.04-11build4) over (0.04-11build3) ... 114s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-9_armhf.deb ... 114s Unpacking libdb5.3t64:armhf (5.3.28+dfsg2-9) over (5.3.28+dfsg2-7) ... 114s Setting up libdb5.3t64:armhf (5.3.28+dfsg2-9) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61464 files and directories currently installed.) 114s Preparing to unpack .../base-passwd_3.6.5_armhf.deb ... 114s Unpacking base-passwd (3.6.5) over (3.6.4) ... 114s Setting up base-passwd (3.6.5) ... 115s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61465 files and directories currently installed.) 115s Preparing to unpack .../python3-minimal_3.12.7-1_armhf.deb ... 115s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 115s Setting up python3-minimal (3.12.7-1) ... 115s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61465 files and directories currently installed.) 115s Preparing to unpack .../00-python3_3.12.7-1_armhf.deb ... 115s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 115s Preparing to unpack .../01-tzdata_2024b-1ubuntu2_all.deb ... 115s Unpacking tzdata (2024b-1ubuntu2) over (2024a-4ubuntu1) ... 115s Preparing to unpack .../02-python3.12_3.12.7-3_armhf.deb ... 115s Unpacking python3.12 (3.12.7-3) over (3.12.7-1) ... 115s Preparing to unpack .../03-libpython3.12-stdlib_3.12.7-3_armhf.deb ... 115s Unpacking libpython3.12-stdlib:armhf (3.12.7-3) over (3.12.7-1) ... 115s Preparing to unpack .../04-python3.12-minimal_3.12.7-3_armhf.deb ... 115s Unpacking python3.12-minimal (3.12.7-3) over (3.12.7-1) ... 115s Preparing to unpack .../05-libpython3.12-minimal_3.12.7-3_armhf.deb ... 115s Unpacking libpython3.12-minimal:armhf (3.12.7-3) over (3.12.7-1) ... 116s Preparing to unpack .../06-libpython3-stdlib_3.12.7-1_armhf.deb ... 116s Unpacking libpython3-stdlib:armhf (3.12.7-1) over (3.12.6-0ubuntu1) ... 116s Preparing to unpack .../07-libnss-systemd_256.5-2ubuntu4_armhf.deb ... 116s Unpacking libnss-systemd:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../08-systemd-timesyncd_256.5-2ubuntu4_armhf.deb ... 116s Unpacking systemd-timesyncd (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../09-systemd-resolved_256.5-2ubuntu4_armhf.deb ... 116s Unpacking systemd-resolved (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../10-libsystemd-shared_256.5-2ubuntu4_armhf.deb ... 116s Unpacking libsystemd-shared:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../11-libsystemd0_256.5-2ubuntu4_armhf.deb ... 116s Unpacking libsystemd0:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Setting up libsystemd0:armhf (256.5-2ubuntu4) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61464 files and directories currently installed.) 116s Preparing to unpack .../systemd-sysv_256.5-2ubuntu4_armhf.deb ... 116s Unpacking systemd-sysv (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../libpam-systemd_256.5-2ubuntu4_armhf.deb ... 116s Unpacking libpam-systemd:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../systemd_256.5-2ubuntu4_armhf.deb ... 116s Unpacking systemd (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../udev_256.5-2ubuntu4_armhf.deb ... 116s Unpacking udev (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Preparing to unpack .../libudev1_256.5-2ubuntu4_armhf.deb ... 116s Unpacking libudev1:armhf (256.5-2ubuntu4) over (256.5-2ubuntu3) ... 116s Setting up libudev1:armhf (256.5-2ubuntu4) ... 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61464 files and directories currently installed.) 117s Preparing to unpack .../0-python3-problem-report_2.30.0-0ubuntu5_all.deb ... 117s Unpacking python3-problem-report (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ... 117s Preparing to unpack .../1-python3-apport_2.30.0-0ubuntu5_all.deb ... 117s Unpacking python3-apport (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ... 117s Preparing to unpack .../2-python3-gi_3.50.0-3_armhf.deb ... 117s Unpacking python3-gi (3.50.0-3) over (3.48.2-1) ... 117s Preparing to unpack .../3-apport-core-dump-handler_2.30.0-0ubuntu5_all.deb ... 117s Unpacking apport-core-dump-handler (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ... 117s Preparing to unpack .../4-apport_2.30.0-0ubuntu5_all.deb ... 117s Unpacking apport (2.30.0-0ubuntu5) over (2.30.0-0ubuntu4) ... 117s Preparing to unpack .../5-libbsd0_0.12.2-2_armhf.deb ... 117s Unpacking libbsd0:armhf (0.12.2-2) over (0.12.2-1) ... 117s Setting up libbsd0:armhf (0.12.2-2) ... 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 117s Preparing to unpack .../0-libedit2_3.1-20240808-1_armhf.deb ... 117s Unpacking libedit2:armhf (3.1-20240808-1) over (3.1-20240517-1) ... 117s Preparing to unpack .../1-openssh-sftp-server_1%3a9.7p1-7ubuntu5_armhf.deb ... 117s Unpacking openssh-sftp-server (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ... 117s Preparing to unpack .../2-openssh-server_1%3a9.7p1-7ubuntu5_armhf.deb ... 117s Unpacking openssh-server (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ... 117s Preparing to unpack .../3-openssh-client_1%3a9.7p1-7ubuntu5_armhf.deb ... 118s Unpacking openssh-client (1:9.7p1-7ubuntu5) over (1:9.7p1-7ubuntu4) ... 118s Preparing to unpack .../4-libatomic1_14.2.0-8ubuntu1_armhf.deb ... 118s Unpacking libatomic1:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ... 118s Preparing to unpack .../5-gcc-14-base_14.2.0-8ubuntu1_armhf.deb ... 118s Unpacking gcc-14-base:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ... 118s Setting up gcc-14-base:armhf (14.2.0-8ubuntu1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../libstdc++6_14.2.0-8ubuntu1_armhf.deb ... 118s Unpacking libstdc++6:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ... 118s Setting up libstdc++6:armhf (14.2.0-8ubuntu1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../libgcc-s1_14.2.0-8ubuntu1_armhf.deb ... 118s Unpacking libgcc-s1:armhf (14.2.0-8ubuntu1) over (14.2.0-4ubuntu2) ... 118s Setting up libgcc-s1:armhf (14.2.0-8ubuntu1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../libattr1_1%3a2.5.2-2_armhf.deb ... 118s Unpacking libattr1:armhf (1:2.5.2-2) over (1:2.5.2-1build2) ... 118s Setting up libattr1:armhf (1:2.5.2-2) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../libgnutls30t64_3.8.8-2ubuntu1_armhf.deb ... 118s Unpacking libgnutls30t64:armhf (3.8.8-2ubuntu1) over (3.8.6-2ubuntu1) ... 118s Setting up libgnutls30t64:armhf (3.8.8-2ubuntu1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../install-info_7.1.1-1_armhf.deb ... 118s Unpacking install-info (7.1.1-1) over (7.1-3build2) ... 118s Setting up install-info (7.1.1-1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61456 files and directories currently installed.) 118s Preparing to unpack .../00-mawk_1.3.4.20240905-1_armhf.deb ... 118s Unpacking mawk (1.3.4.20240905-1) over (1.3.4.20240622-2) ... 118s Preparing to unpack .../01-dhcpcd-base_1%3a10.1.0-2_armhf.deb ... 118s Unpacking dhcpcd-base (1:10.1.0-2) over (1:10.0.8-3) ... 118s Preparing to unpack .../02-distro-info-data_0.63_all.deb ... 118s Unpacking distro-info-data (0.63) over (0.62) ... 118s Preparing to unpack .../03-libdw1t64_0.192-4_armhf.deb ... 118s Unpacking libdw1t64:armhf (0.192-4) over (0.191-2) ... 118s Preparing to unpack .../04-libelf1t64_0.192-4_armhf.deb ... 118s Unpacking libelf1t64:armhf (0.192-4) over (0.191-2) ... 118s Preparing to unpack .../05-libbpf1_1%3a1.5.0-1_armhf.deb ... 118s Unpacking libbpf1:armhf (1:1.5.0-1) over (1:1.4.5-1) ... 118s Preparing to unpack .../06-libmnl0_1.0.5-3_armhf.deb ... 118s Unpacking libmnl0:armhf (1.0.5-3) over (1.0.5-2build1) ... 118s Preparing to unpack .../07-iproute2_6.10.0-2ubuntu1_armhf.deb ... 119s Unpacking iproute2 (6.10.0-2ubuntu1) over (6.10.0-2) ... 120s Preparing to unpack .../08-libfastjson4_1.2304.0-2_armhf.deb ... 120s Unpacking libfastjson4:armhf (1.2304.0-2) over (1.2304.0-1build1) ... 120s Preparing to unpack .../09-libjson-c5_0.18+ds-1_armhf.deb ... 120s Unpacking libjson-c5:armhf (0.18+ds-1) over (0.17-1build1) ... 120s Preparing to unpack .../10-libkeyutils1_1.6.3-4ubuntu2_armhf.deb ... 120s Unpacking libkeyutils1:armhf (1.6.3-4ubuntu2) over (1.6.3-3build1) ... 120s Preparing to unpack .../11-netplan-generator_1.1.1-1_armhf.deb ... 120s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 120s Unpacking netplan-generator (1.1.1-1) over (1.1-1) ... 120s Preparing to unpack .../12-python3-cffi-backend_1.17.1-2_armhf.deb ... 120s Unpacking python3-cffi-backend:armhf (1.17.1-2) over (1.17.1-1) ... 120s Preparing to unpack .../13-python3-netplan_1.1.1-1_armhf.deb ... 120s Unpacking python3-netplan (1.1.1-1) over (1.1-1) ... 120s Preparing to unpack .../14-netplan.io_1.1.1-1_armhf.deb ... 120s Unpacking netplan.io (1.1.1-1) over (1.1-1) ... 120s Preparing to unpack .../15-libnetplan1_1.1.1-1_armhf.deb ... 120s Unpacking libnetplan1:armhf (1.1.1-1) over (1.1-1) ... 120s Preparing to unpack .../16-libpopt0_1.19+dfsg-2_armhf.deb ... 120s Unpacking libpopt0:armhf (1.19+dfsg-2) over (1.19+dfsg-1build1) ... 120s Preparing to unpack .../17-vim-tiny_2%3a9.1.0777-1ubuntu1_armhf.deb ... 120s Unpacking vim-tiny (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ... 120s Preparing to unpack .../18-vim-common_2%3a9.1.0777-1ubuntu1_all.deb ... 120s Unpacking vim-common (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ... 120s Preparing to unpack .../19-xxd_2%3a9.1.0777-1ubuntu1_armhf.deb ... 120s Unpacking xxd (2:9.1.0777-1ubuntu1) over (2:9.1.0496-1ubuntu6) ... 120s Preparing to unpack .../20-bash-completion_1%3a2.14.0-2_all.deb ... 120s Unpacking bash-completion (1:2.14.0-2) over (1:2.14.0-1) ... 120s Preparing to unpack .../21-info_7.1.1-1_armhf.deb ... 120s Unpacking info (7.1.1-1) over (7.1-3build2) ... 120s Preparing to unpack .../22-libdrm-common_2.4.123-1_all.deb ... 120s Unpacking libdrm-common (2.4.123-1) over (2.4.122-1) ... 120s Preparing to unpack .../23-libdrm2_2.4.123-1_armhf.deb ... 120s Unpacking libdrm2:armhf (2.4.123-1) over (2.4.122-1) ... 120s Preparing to unpack .../24-libevdev2_1.13.3+dfsg-1_armhf.deb ... 120s Unpacking libevdev2:armhf (1.13.3+dfsg-1) over (1.13.2+dfsg-1) ... 120s Preparing to unpack .../25-libmaxminddb0_1.11.0-1_armhf.deb ... 120s Unpacking libmaxminddb0:armhf (1.11.0-1) over (1.10.0-1) ... 120s Preparing to unpack .../26-libnetfilter-conntrack3_1.1.0-1_armhf.deb ... 120s Unpacking libnetfilter-conntrack3:armhf (1.1.0-1) over (1.0.9-6build1) ... 120s Preparing to unpack .../27-libnghttp2-14_1.64.0-1_armhf.deb ... 120s Unpacking libnghttp2-14:armhf (1.64.0-1) over (1.62.1-2) ... 120s Preparing to unpack .../28-libpipeline1_1.5.8-1_armhf.deb ... 120s Unpacking libpipeline1:armhf (1.5.8-1) over (1.5.7-2) ... 120s Preparing to unpack .../29-libpng16-16t64_1.6.44-2_armhf.deb ... 120s Unpacking libpng16-16t64:armhf (1.6.44-2) over (1.6.44-1) ... 120s Preparing to unpack .../30-libplymouth5_24.004.60-1ubuntu11_armhf.deb ... 120s Unpacking libplymouth5:armhf (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ... 120s Preparing to unpack .../31-libtraceevent1-plugin_1%3a1.8.3-1ubuntu1_armhf.deb ... 120s Unpacking libtraceevent1-plugin:armhf (1:1.8.3-1ubuntu1) over (1:1.8.2-1ubuntu3) ... 120s Preparing to unpack .../32-libtraceevent1_1%3a1.8.3-1ubuntu1_armhf.deb ... 120s Unpacking libtraceevent1:armhf (1:1.8.3-1ubuntu1) over (1:1.8.2-1ubuntu3) ... 120s Preparing to unpack .../33-liburcu8t64_0.14.1-1_armhf.deb ... 120s Unpacking liburcu8t64:armhf (0.14.1-1) over (0.14.0-4) ... 120s Preparing to unpack .../34-libuv1t64_1.48.0-7_armhf.deb ... 120s Unpacking libuv1t64:armhf (1.48.0-7) over (1.48.0-5) ... 120s Preparing to unpack .../35-libx11-data_2%3a1.8.10-2_all.deb ... 120s Unpacking libx11-data (2:1.8.10-2) over (2:1.8.7-1build1) ... 120s Preparing to unpack .../36-libx11-6_2%3a1.8.10-2_armhf.deb ... 120s Unpacking libx11-6:armhf (2:1.8.10-2) over (2:1.8.7-1build1) ... 120s Preparing to unpack .../37-libxau6_1%3a1.0.11-1_armhf.deb ... 120s Unpacking libxau6:armhf (1:1.0.11-1) over (1:1.0.9-1build6) ... 120s Preparing to unpack .../38-nano_8.2-1_armhf.deb ... 120s Unpacking nano (8.2-1) over (8.1-1) ... 120s Preparing to unpack .../39-pci.ids_0.0~2024.10.24-1_all.deb ... 120s Unpacking pci.ids (0.0~2024.10.24-1) over (0.0~2024.09.12-1) ... 120s Preparing to unpack .../40-plymouth-theme-ubuntu-text_24.004.60-1ubuntu11_armhf.deb ... 120s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ... 120s Preparing to unpack .../41-plymouth_24.004.60-1ubuntu11_armhf.deb ... 120s Unpacking plymouth (24.004.60-1ubuntu11) over (24.004.60-1ubuntu10) ... 120s Preparing to unpack .../42-python3.12-gdbm_3.12.7-3_armhf.deb ... 120s Unpacking python3.12-gdbm (3.12.7-3) over (3.12.7-1) ... 120s Selecting previously unselected package python3.13-gdbm. 120s Preparing to unpack .../43-python3.13-gdbm_3.13.0-2_armhf.deb ... 120s Unpacking python3.13-gdbm (3.13.0-2) ... 120s Preparing to unpack .../44-python3-gdbm_3.12.7-1_armhf.deb ... 120s Unpacking python3-gdbm:armhf (3.12.7-1) over (3.12.6-1ubuntu1) ... 120s Preparing to unpack .../45-ufw_0.36.2-8_all.deb ... 120s Unpacking ufw (0.36.2-8) over (0.36.2-6) ... 121s Preparing to unpack .../46-usbutils_1%3a018-1_armhf.deb ... 121s Unpacking usbutils (1:018-1) over (1:017-3build1) ... 121s Preparing to unpack .../47-dpkg-dev_1.22.11ubuntu3_all.deb ... 121s Unpacking dpkg-dev (1.22.11ubuntu3) over (1.22.11ubuntu1) ... 121s Preparing to unpack .../48-libdpkg-perl_1.22.11ubuntu3_all.deb ... 121s Unpacking libdpkg-perl (1.22.11ubuntu3) over (1.22.11ubuntu1) ... 121s Preparing to unpack .../49-libarchive13t64_3.7.4-1.1_armhf.deb ... 121s Unpacking libarchive13t64:armhf (3.7.4-1.1) over (3.7.4-1) ... 121s Preparing to unpack .../50-libftdi1-2_1.5-7_armhf.deb ... 121s Unpacking libftdi1-2:armhf (1.5-7) over (1.5-6build5) ... 121s Preparing to unpack .../51-libflashrom1_1.4.0-3ubuntu1_armhf.deb ... 121s Unpacking libflashrom1:armhf (1.4.0-3ubuntu1) over (1.3.0-2.1ubuntu2) ... 121s Preparing to unpack .../52-libjson-glib-1.0-common_1.10.0+ds-3_all.deb ... 121s Unpacking libjson-glib-1.0-common (1.10.0+ds-3) over (1.8.0-2build2) ... 121s Preparing to unpack .../53-libjson-glib-1.0-0_1.10.0+ds-3_armhf.deb ... 121s Unpacking libjson-glib-1.0-0:armhf (1.10.0+ds-3) over (1.8.0-2build2) ... 121s Preparing to unpack .../54-libfwupd2_1.9.26-2_armhf.deb ... 121s Unpacking libfwupd2:armhf (1.9.26-2) over (1.9.24-1) ... 121s Preparing to unpack .../55-libxmlb2_0.3.21-1_armhf.deb ... 121s Unpacking libxmlb2:armhf (0.3.21-1) over (0.3.19-1) ... 121s Preparing to unpack .../56-fwupd_1.9.26-2_armhf.deb ... 121s Unpacking fwupd (1.9.26-2) over (1.9.24-1) ... 121s Preparing to unpack .../57-libblockdev-utils3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-utils3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../58-libblockdev-crypto3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-crypto3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../59-libblockdev-fs3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-fs3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../60-libblockdev-loop3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-loop3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../61-libbytesize1_2.11-1ubuntu1_armhf.deb ... 121s Unpacking libbytesize1:armhf (2.11-1ubuntu1) over (2.10-1ubuntu2) ... 121s Preparing to unpack .../62-libbytesize-common_2.11-1ubuntu1_all.deb ... 121s Unpacking libbytesize-common (2.11-1ubuntu1) over (2.10-1ubuntu2) ... 121s Preparing to unpack .../63-libblockdev-mdraid3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-mdraid3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../64-libnvme1t64_1.11-1_armhf.deb ... 121s Unpacking libnvme1t64 (1.11-1) over (1.10-1) ... 121s Preparing to unpack .../65-libblockdev-nvme3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-nvme3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../66-libblockdev-part3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-part3:armhf (3.2.1-1) over (3.1.1-2) ... 121s Preparing to unpack .../67-libblockdev-swap3_3.2.1-1_armhf.deb ... 121s Unpacking libblockdev-swap3:armhf (3.2.1-1) over (3.1.1-2) ... 122s Preparing to unpack .../68-libblockdev3_3.2.1-1_armhf.deb ... 122s Unpacking libblockdev3:armhf (3.2.1-1) over (3.1.1-2) ... 122s Preparing to unpack .../69-libgpgme11t64_1.23.2-5ubuntu4_armhf.deb ... 122s Unpacking libgpgme11t64:armhf (1.23.2-5ubuntu4) over (1.18.0-4.1ubuntu4) ... 122s Preparing to unpack .../70-libinih1_58-1ubuntu1_armhf.deb ... 122s Unpacking libinih1:armhf (58-1ubuntu1) over (55-1ubuntu2) ... 122s Preparing to unpack .../71-libldap-common_2.6.8+dfsg-1~exp4ubuntu3_all.deb ... 122s Unpacking libldap-common (2.6.8+dfsg-1~exp4ubuntu3) over (2.6.8+dfsg-1~exp4ubuntu1) ... 122s Preparing to unpack .../72-libldap2_2.6.8+dfsg-1~exp4ubuntu3_armhf.deb ... 122s Unpacking libldap2:armhf (2.6.8+dfsg-1~exp4ubuntu3) over (2.6.8+dfsg-1~exp4ubuntu1) ... 122s Preparing to unpack .../73-libnspr4_2%3a4.35-1.1ubuntu2_armhf.deb ... 122s Unpacking libnspr4:armhf (2:4.35-1.1ubuntu2) over (2:4.35-1.1ubuntu1) ... 122s Preparing to unpack .../74-libsgutils2-1.46-2_1.46-3ubuntu5_armhf.deb ... 122s Unpacking libsgutils2-1.46-2:armhf (1.46-3ubuntu5) over (1.46-3ubuntu4) ... 122s Preparing to unpack .../75-libssh2-1t64_1.11.1-1_armhf.deb ... 122s Unpacking libssh2-1t64:armhf (1.11.1-1) over (1.11.0-7) ... 122s Preparing to unpack .../76-udisks2_2.10.1-11ubuntu1_armhf.deb ... 122s Unpacking udisks2 (2.10.1-11ubuntu1) over (2.10.1-9ubuntu2) ... 122s Preparing to unpack .../77-libudisks2-0_2.10.1-11ubuntu1_armhf.deb ... 122s Unpacking libudisks2-0:armhf (2.10.1-11ubuntu1) over (2.10.1-9ubuntu2) ... 122s Preparing to unpack .../78-libutempter0_1.2.1-4_armhf.deb ... 122s Unpacking libutempter0:armhf (1.2.1-4) over (1.2.1-3build1) ... 122s Preparing to unpack .../79-python3-certifi_2024.8.30+dfsg-1_all.deb ... 122s Unpacking python3-certifi (2024.8.30+dfsg-1) over (2024.6.2-1) ... 122s Preparing to unpack .../80-python3-configobj_5.0.9-1_all.deb ... 122s Unpacking python3-configobj (5.0.9-1) over (5.0.8-3) ... 122s Preparing to unpack .../81-python3-idna_3.8-2_all.deb ... 122s Unpacking python3-idna (3.8-2) over (3.6-2.1) ... 122s Preparing to unpack .../82-python3-more-itertools_10.5.0-1_all.deb ... 122s Unpacking python3-more-itertools (10.5.0-1) over (10.3.0-1) ... 122s Preparing to unpack .../83-python3-jaraco.functools_4.1.0-1_all.deb ... 122s Unpacking python3-jaraco.functools (4.1.0-1) over (4.0.2-1) ... 122s Preparing to unpack .../84-python3-json-pointer_2.4-2_all.deb ... 122s Unpacking python3-json-pointer (2.4-2) over (2.0-0ubuntu1) ... 122s Preparing to unpack .../85-python3-jsonpatch_1.32-4_all.deb ... 123s Unpacking python3-jsonpatch (1.32-4) over (1.32-3) ... 123s Preparing to unpack .../86-python3-lazr.uri_1.0.6-4_all.deb ... 123s Unpacking python3-lazr.uri (1.0.6-4) over (1.0.6-3) ... 123s Preparing to unpack .../87-python3-wadllib_2.0.0-1_all.deb ... 123s Unpacking python3-wadllib (2.0.0-1) over (1.3.6-5) ... 123s Preparing to unpack .../88-python3-oauthlib_3.2.2-2_all.deb ... 123s Unpacking python3-oauthlib (3.2.2-2) over (3.2.2-1) ... 123s Preparing to unpack .../89-python3-lazr.restfulclient_0.14.6-2_all.deb ... 123s Unpacking python3-lazr.restfulclient (0.14.6-2) over (0.14.6-1) ... 123s Preparing to unpack .../90-python3-typeguard_4.4.1-1_all.deb ... 123s Unpacking python3-typeguard (4.4.1-1) over (4.3.0-1) ... 123s Preparing to unpack .../91-python3-urllib3_2.0.7-2ubuntu0.1_all.deb ... 123s Unpacking python3-urllib3 (2.0.7-2ubuntu0.1) over (2.0.7-2) ... 123s Preparing to unpack .../92-python3-zipp_3.21.0-1_all.deb ... 123s Unpacking python3-zipp (3.21.0-1) over (3.20.0-1) ... 123s Preparing to unpack .../93-sg3-utils_1.46-3ubuntu5_armhf.deb ... 123s Unpacking sg3-utils (1.46-3ubuntu5) over (1.46-3ubuntu4) ... 123s Preparing to unpack .../94-sg3-utils-udev_1.46-3ubuntu5_all.deb ... 123s Unpacking sg3-utils-udev (1.46-3ubuntu5) over (1.46-3ubuntu4) ... 123s Selecting previously unselected package systemd-cryptsetup. 123s Preparing to unpack .../95-systemd-cryptsetup_256.5-2ubuntu4_armhf.deb ... 123s Unpacking systemd-cryptsetup (256.5-2ubuntu4) ... 123s Preparing to unpack .../96-ssh-import-id_5.11-0ubuntu3_all.deb ... 123s Unpacking ssh-import-id (5.11-0ubuntu3) over (5.11-0ubuntu2) ... 123s Setting up libpipeline1:armhf (1.5.8-1) ... 123s Setting up motd-news-config (13.5ubuntu3) ... 123s Setting up libtext-iconv-perl:armhf (1.7-8build4) ... 123s Setting up libtext-charwidth-perl:armhf (0.04-11build4) ... 123s Setting up liburcu8t64:armhf (0.14.1-1) ... 123s Setting up libxau6:armhf (1:1.0.11-1) ... 123s Setting up libkeyutils1:armhf (1.6.3-4ubuntu2) ... 123s Setting up pci.ids (0.0~2024.10.24-1) ... 123s Setting up distro-info-data (0.63) ... 123s Setting up libfastjson4:armhf (1.2304.0-2) ... 123s Setting up libinih1:armhf (58-1ubuntu1) ... 123s Setting up libmaxminddb0:armhf (1.11.0-1) ... 123s Setting up python3.12-gdbm (3.12.7-3) ... 123s Setting up libxmlb2:armhf (0.3.21-1) ... 123s Setting up libedit2:armhf (3.1-20240808-1) ... 123s Setting up libuv1t64:armhf (1.48.0-7) ... 123s Setting up libpython3.12-minimal:armhf (3.12.7-3) ... 123s Setting up libnghttp2-14:armhf (1.64.0-1) ... 123s Setting up libsgutils2-1.46-2:armhf (1.46-3ubuntu5) ... 123s Setting up libnetplan1:armhf (1.1.1-1) ... 123s Setting up libldap-common (2.6.8+dfsg-1~exp4ubuntu3) ... 123s Setting up usbutils (1:018-1) ... 123s Setting up xxd (2:9.1.0777-1ubuntu1) ... 123s Setting up libelf1t64:armhf (0.192-4) ... 123s Setting up libdw1t64:armhf (0.192-4) ... 123s Setting up tzdata (2024b-1ubuntu2) ... 124s 124s Current default time zone: 'Etc/UTC' 124s Local time is now: Wed Nov 13 18:28:42 UTC 2024. 124s Universal Time is now: Wed Nov 13 18:28:42 UTC 2024. 124s Run 'dpkg-reconfigure tzdata' if you wish to change it. 124s 124s Setting up libftdi1-2:armhf (1.5-7) ... 124s Setting up libflashrom1:armhf (1.4.0-3ubuntu1) ... 124s Setting up vim-common (2:9.1.0777-1ubuntu1) ... 124s Installing new version of config file /etc/vim/vimrc ... 124s Setting up libx11-data (2:1.8.10-2) ... 124s Setting up libnspr4:armhf (2:4.35-1.1ubuntu2) ... 124s Setting up bash-completion (1:2.14.0-2) ... 124s Setting up libbytesize-common (2.11-1ubuntu1) ... 124s Setting up libblockdev-utils3:armhf (3.2.1-1) ... 124s Setting up libpng16-16t64:armhf (1.6.44-2) ... 124s Setting up libmnl0:armhf (1.0.5-3) ... 124s Setting up libatomic1:armhf (14.2.0-8ubuntu1) ... 124s Setting up libsystemd-shared:armhf (256.5-2ubuntu4) ... 124s Setting up dhcpcd-base (1:10.1.0-2) ... 124s Setting up libutempter0:armhf (1.2.1-4) ... 124s Setting up nano (8.2-1) ... 124s Setting up libblockdev-fs3:armhf (3.2.1-1) ... 124s Setting up perl-modules-5.40 (5.40.0-7) ... 124s Setting up libnetfilter-conntrack3:armhf (1.1.0-1) ... 124s Setting up libtraceevent1:armhf (1:1.8.3-1ubuntu1) ... 124s Setting up libx11-6:armhf (2:1.8.10-2) ... 124s Setting up libjson-glib-1.0-common (1.10.0+ds-3) ... 124s Setting up mawk (1.3.4.20240905-1) ... 124s Setting up libbytesize1:armhf (2.11-1ubuntu1) ... 124s Setting up libgpgme11t64:armhf (1.23.2-5ubuntu4) ... 124s Setting up libssh2-1t64:armhf (1.11.1-1) ... 124s Setting up libdrm-common (2.4.123-1) ... 124s Setting up libarchive13t64:armhf (3.7.4-1.1) ... 124s Setting up libjson-c5:armhf (0.18+ds-1) ... 124s Setting up libevdev2:armhf (1.13.3+dfsg-1) ... 124s Setting up libldap2:armhf (2.6.8+dfsg-1~exp4ubuntu3) ... 124s Setting up info (7.1.1-1) ... 124s Setting up liblocale-gettext-perl (1.07-7build1) ... 124s Setting up libbpf1:armhf (1:1.5.0-1) ... 124s Setting up libudisks2-0:armhf (2.10.1-11ubuntu1) ... 124s Setting up python3.13-gdbm (3.13.0-2) ... 124s Setting up libpopt0:armhf (1.19+dfsg-2) ... 124s Setting up sg3-utils (1.46-3ubuntu5) ... 124s Setting up python3.12-minimal (3.12.7-3) ... 125s Setting up libpython3.12-stdlib:armhf (3.12.7-3) ... 125s Setting up libblockdev-mdraid3:armhf (3.2.1-1) ... 125s Setting up libblockdev-crypto3:armhf (3.2.1-1) ... 125s Setting up libblockdev-swap3:armhf (3.2.1-1) ... 125s Setting up iproute2 (6.10.0-2ubuntu1) ... 125s Setting up openssh-client (1:9.7p1-7ubuntu5) ... 125s Setting up python3.12 (3.12.7-3) ... 126s Setting up libblockdev-loop3:armhf (3.2.1-1) ... 126s Setting up systemd (256.5-2ubuntu4) ... 126s /usr/lib/tmpfiles.d/legacy.conf:13: Duplicate line for path "/run/lock", ignoring. 126s Created symlink '/run/systemd/system/tmp.mount' → '/dev/null'. 126s /usr/lib/tmpfiles.d/legacy.conf:13: Duplicate line for path "/run/lock", ignoring. 127s Setting up vim-tiny (2:9.1.0777-1ubuntu1) ... 127s Setting up libblockdev3:armhf (3.2.1-1) ... 127s Installing new version of config file /etc/libblockdev/3/conf.d/00-default.cfg ... 127s Setting up libjson-glib-1.0-0:armhf (1.10.0+ds-3) ... 127s Setting up libblockdev-part3:armhf (3.2.1-1) ... 127s Setting up sg3-utils-udev (1.46-3ubuntu5) ... 127s update-initramfs: deferring update (trigger activated) 127s Setting up libperl5.40:armhf (5.40.0-7) ... 127s Setting up perl (5.40.0-7) ... 127s Setting up systemd-cryptsetup (256.5-2ubuntu4) ... 127s Setting up libnvme1t64 (1.11-1) ... 127s Setting up systemd-timesyncd (256.5-2ubuntu4) ... 127s systemd-time-wait-sync.service is a disabled or a static unit not running, not starting it. 127s Setting up udev (256.5-2ubuntu4) ... 128s Setting up libdpkg-perl (1.22.11ubuntu3) ... 128s Setting up libblockdev-nvme3:armhf (3.2.1-1) ... 128s Setting up libdrm2:armhf (2.4.123-1) ... 128s Setting up libtraceevent1-plugin:armhf (1:1.8.3-1ubuntu1) ... 128s Setting up libplymouth5:armhf (24.004.60-1ubuntu11) ... 128s Setting up netplan-generator (1.1.1-1) ... 128s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 128s Setting up libpython3-stdlib:armhf (3.12.7-1) ... 128s Setting up systemd-resolved (256.5-2ubuntu4) ... 128s Setting up openssh-sftp-server (1:9.7p1-7ubuntu5) ... 128s Setting up udisks2 (2.10.1-11ubuntu1) ... 128s vda: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/uevent': Permission denied 128s vda1: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda1/uevent': Permission denied 128s vda15: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda15/uevent': Permission denied 128s vda2: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda2/uevent': Permission denied 128s loop0: Failed to write 'change' to '/sys/devices/virtual/block/loop0/uevent': Permission denied 128s loop1: Failed to write 'change' to '/sys/devices/virtual/block/loop1/uevent': Permission denied 128s loop2: Failed to write 'change' to '/sys/devices/virtual/block/loop2/uevent': Permission denied 128s loop3: Failed to write 'change' to '/sys/devices/virtual/block/loop3/uevent': Permission denied 128s loop4: Failed to write 'change' to '/sys/devices/virtual/block/loop4/uevent': Permission denied 128s loop5: Failed to write 'change' to '/sys/devices/virtual/block/loop5/uevent': Permission denied 128s loop6: Failed to write 'change' to '/sys/devices/virtual/block/loop6/uevent': Permission denied 128s loop7: Failed to write 'change' to '/sys/devices/virtual/block/loop7/uevent': Permission denied 128s loop8: Failed to write 'change' to '/sys/devices/virtual/block/loop8/uevent': Permission denied 129s Setting up systemd-sysv (256.5-2ubuntu4) ... 129s Setting up openssh-server (1:9.7p1-7ubuntu5) ... 130s Setting up plymouth (24.004.60-1ubuntu11) ... 130s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 130s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 130s Setting up libfwupd2:armhf (1.9.26-2) ... 130s Setting up libnss-systemd:armhf (256.5-2ubuntu4) ... 130s Setting up python3 (3.12.7-1) ... 131s Setting up python3-zipp (3.21.0-1) ... 131s Setting up dpkg-dev (1.22.11ubuntu3) ... 131s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu11) ... 131s update-initramfs: deferring update (trigger activated) 131s Setting up python3-oauthlib (3.2.2-2) ... 131s Setting up python3-configobj (5.0.9-1) ... 131s Setting up python3-certifi (2024.8.30+dfsg-1) ... 131s Setting up python3-gi (3.50.0-3) ... 131s Setting up python3-idna (3.8-2) ... 132s Setting up python3-urllib3 (2.0.7-2ubuntu0.1) ... 132s Setting up python3-json-pointer (2.4-2) ... 132s Setting up libpam-systemd:armhf (256.5-2ubuntu4) ... 132s Setting up fwupd (1.9.26-2) ... 133s fwupd-offline-update.service is a disabled or a static unit not running, not starting it. 133s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 133s fwupd.service is a disabled or a static unit not running, not starting it. 133s Setting up python3-cffi-backend:armhf (1.17.1-2) ... 133s Setting up python3-more-itertools (10.5.0-1) ... 133s Setting up python3-jaraco.functools (4.1.0-1) ... 133s Setting up python3-gdbm:armhf (3.12.7-1) ... 133s Setting up python3-problem-report (2.30.0-0ubuntu5) ... 133s Setting up ssh-import-id (5.11-0ubuntu3) ... 133s Setting up python3-jsonpatch (1.32-4) ... 133s Setting up python3-typeguard (4.4.1-1) ... 133s Setting up ufw (0.36.2-8) ... 134s Setting up python3-lazr.uri (1.0.6-4) ... 134s Setting up python3-apport (2.30.0-0ubuntu5) ... 135s Setting up python3-wadllib (2.0.0-1) ... 135s Setting up python3-netplan (1.1.1-1) ... 135s Setting up python3-lazr.restfulclient (0.14.6-2) ... 135s Setting up netplan.io (1.1.1-1) ... 135s Setting up apport-core-dump-handler (2.30.0-0ubuntu5) ... 136s Setting up apport (2.30.0-0ubuntu5) ... 136s Installing new version of config file /etc/apport/crashdb.conf ... 136s apport-autoreport.service is a disabled or a static unit not running, not starting it. 136s Processing triggers for dbus (1.14.10-4ubuntu5) ... 136s Processing triggers for shared-mime-info (2.4-5) ... 137s Processing triggers for install-info (7.1.1-1) ... 137s Processing triggers for initramfs-tools (0.142ubuntu34) ... 137s Processing triggers for libc-bin (2.40-1ubuntu3) ... 137s Processing triggers for rsyslog (8.2406.0-1ubuntu2) ... 137s Processing triggers for man-db (2.12.1-3) ... 139s Reading package lists... 139s Building dependency tree... 139s Reading state information... 140s The following packages will be REMOVED: 140s libperl5.38t64* perl-modules-5.38* python3-netifaces* 140s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 140s After this operation, 41.7 MB disk space will be freed. 140s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 61506 files and directories currently installed.) 140s Removing libperl5.38t64:armhf (5.38.2-5) ... 140s Removing perl-modules-5.38 (5.38.2-5) ... 140s Removing python3-netifaces:armhf (0.11.0-2build3) ... 140s Processing triggers for man-db (2.12.1-3) ... 141s Processing triggers for libc-bin (2.40-1ubuntu3) ... 143s autopkgtest [18:29:01]: rebooting testbed after setup commands that affected boot 212s autopkgtest [18:30:10]: testbed running kernel: Linux 6.8.0-47-generic #47~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Oct 2 16:39:14 UTC 2 241s autopkgtest [18:30:39]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 258s Get:1 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (dsc) [2498 B] 258s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (tar) [18.4 MB] 258s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6 (diff) [40.7 kB] 258s gpgv: Signature made Wed Aug 7 01:47:58 2024 UTC 258s gpgv: using RSA key 7C3AB9CFD230BD30DD009C591E7091B1F14A64A2 258s gpgv: Can't check signature: No public key 258s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6.dsc: no acceptable signature found 259s autopkgtest [18:30:57]: testing package ncbi-blast+ version 2.16.0+ds-6 261s autopkgtest [18:30:59]: build not needed 268s autopkgtest [18:31:06]: test run-unit-test: preparing testbed 278s Reading package lists... 279s Building dependency tree... 279s Reading state information... 279s Starting pkgProblemResolver with broken count: 0 279s Starting 2 pkgProblemResolver with broken count: 0 279s Done 280s The following additional packages will be installed: 280s libgomp1 libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 ncbi-blast+ 280s ncbi-blast+-legacy ncbi-data 280s The following NEW packages will be installed: 280s autopkgtest-satdep libgomp1 libmbedcrypto7t64 libmbedtls14t64 280s libmbedx509-1t64 ncbi-blast+ ncbi-blast+-legacy ncbi-data 280s 0 upgraded, 8 newly installed, 0 to remove and 0 not upgraded. 280s Need to get 19.2 MB/19.2 MB of archives. 280s After this operation, 72.7 MB of additional disk space will be used. 280s Get:1 /tmp/autopkgtest.1SZDyx/1-autopkgtest-satdep.deb autopkgtest-satdep armhf 0 [716 B] 280s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf libgomp1 armhf 14.2.0-8ubuntu1 [125 kB] 280s Get:3 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedcrypto7t64 armhf 2.28.8-1 [182 kB] 280s Get:4 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedx509-1t64 armhf 2.28.8-1 [43.0 kB] 280s Get:5 http://ftpmaster.internal/ubuntu plucky/universe armhf libmbedtls14t64 armhf 2.28.8-1 [77.2 kB] 280s Get:6 http://ftpmaster.internal/ubuntu plucky/universe armhf ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 281s Get:7 http://ftpmaster.internal/ubuntu plucky/universe armhf ncbi-blast+ armhf 2.16.0+ds-6 [14.8 MB] 281s Get:8 http://ftpmaster.internal/ubuntu plucky/universe armhf ncbi-blast+-legacy all 2.16.0+ds-6 [4990 B] 281s Fetched 19.2 MB in 1s (15.0 MB/s) 281s Selecting previously unselected package libgomp1:armhf. 282s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59566 files and directories currently installed.) 282s Preparing to unpack .../0-libgomp1_14.2.0-8ubuntu1_armhf.deb ... 282s Unpacking libgomp1:armhf (14.2.0-8ubuntu1) ... 282s Selecting previously unselected package libmbedcrypto7t64:armhf. 282s Preparing to unpack .../1-libmbedcrypto7t64_2.28.8-1_armhf.deb ... 282s Unpacking libmbedcrypto7t64:armhf (2.28.8-1) ... 282s Selecting previously unselected package libmbedx509-1t64:armhf. 282s Preparing to unpack .../2-libmbedx509-1t64_2.28.8-1_armhf.deb ... 282s Unpacking libmbedx509-1t64:armhf (2.28.8-1) ... 282s Selecting previously unselected package libmbedtls14t64:armhf. 282s Preparing to unpack .../3-libmbedtls14t64_2.28.8-1_armhf.deb ... 282s Unpacking libmbedtls14t64:armhf (2.28.8-1) ... 282s Selecting previously unselected package ncbi-data. 282s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 282s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 282s Selecting previously unselected package ncbi-blast+. 282s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6_armhf.deb ... 282s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 282s Selecting previously unselected package ncbi-blast+-legacy. 282s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6_all.deb ... 282s Unpacking ncbi-blast+-legacy (2.16.0+ds-6) ... 282s Selecting previously unselected package autopkgtest-satdep. 282s Preparing to unpack .../7-1-autopkgtest-satdep.deb ... 282s Unpacking autopkgtest-satdep (0) ... 282s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 282s Setting up libmbedcrypto7t64:armhf (2.28.8-1) ... 282s Setting up libgomp1:armhf (14.2.0-8ubuntu1) ... 282s Setting up libmbedx509-1t64:armhf (2.28.8-1) ... 282s Setting up libmbedtls14t64:armhf (2.28.8-1) ... 282s Setting up ncbi-blast+ (2.16.0+ds-6) ... 282s Setting up ncbi-blast+-legacy (2.16.0+ds-6) ... 282s Setting up autopkgtest-satdep (0) ... 282s Processing triggers for man-db (2.12.1-3) ... 283s Processing triggers for libc-bin (2.40-1ubuntu3) ... 297s (Reading database ... 59840 files and directories currently installed.) 297s Removing autopkgtest-satdep (0) ... 303s autopkgtest [18:31:41]: test run-unit-test: [----------------------- 305s ---Creating Database-- 305s 305s 305s Building a new DB, current time: 11/13/2024 18:31:43 305s New DB name: /tmp/autopkgtest.1SZDyx/autopkgtest_tmp/testdb 305s New DB title: testdatabase.fa 305s Sequence type: Nucleotide 305s Keep MBits: T 305s Maximum file size: 3000000000B 305s Adding sequences from FASTA; added 3 sequences in 0.203172 seconds. 305s 305s 305s ---Searching Database for Hits--- 306s Warning: [blastn] Examining 5 or more matches is recommended 306s # BLASTN 2.16.0+ 306s # Query: gnl|MYDB|1 this is sequence 1 306s # Database: testdb 306s # Fields: query id, subject id, evalue, bit score 306s # 2 hits found 306s gnl|MYDB|1 gnl2 0.0 1299 306s gnl|MYDB|1 gnl1 0.0 1299 306s # BLAST processed 1 queries 306s ---Search and Fetch An Entry From Database--- 306s >gnl1 306s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 306s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 306s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 306s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 306s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 306s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 306s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 306s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 306s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 306s PASS 306s autopkgtest [18:31:44]: test run-unit-test: -----------------------] 310s run-unit-test PASS 310s autopkgtest [18:31:48]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 314s autopkgtest [18:31:52]: @@@@@@@@@@@@@@@@@@@@ summary 314s run-unit-test PASS