0s autopkgtest [06:36:06]: starting date and time: 2025-02-22 06:36:06+0000 0s autopkgtest [06:36:06]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [06:36:06]: host juju-7f2275-prod-proposed-migration-environment-9; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.6h3jy7yl/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:postgresql-17 --apt-upgrade emboss --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=postgresql-17/17.4-1 -- lxd -r lxd-armhf-10.145.243.115 lxd-armhf-10.145.243.115:autopkgtest/ubuntu/plucky/armhf 51s autopkgtest [06:36:57]: testbed dpkg architecture: armhf 53s autopkgtest [06:36:59]: testbed apt version: 2.9.14ubuntu1 58s autopkgtest [06:37:04]: @@@@@@@@@@@@@@@@@@@@ test bed setup 61s autopkgtest [06:37:07]: testbed release detected to be: None 69s autopkgtest [06:37:15]: updating testbed package index (apt update) 71s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [110 kB] 72s Get:2 http://ftpmaster.internal/ubuntu plucky InRelease [249 kB] 72s Get:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease [110 kB] 72s Get:4 http://ftpmaster.internal/ubuntu plucky-security InRelease [110 kB] 72s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [13.5 kB] 72s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [504 kB] 72s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [80.9 kB] 72s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [3120 B] 72s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Packages [127 kB] 72s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf Components [26.6 kB] 72s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/restricted armhf Packages [760 B] 72s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/restricted armhf Components [216 B] 72s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Packages [424 kB] 72s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/universe armhf Components [213 kB] 72s Get:15 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Packages [1796 B] 72s Get:16 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse armhf Components [1076 B] 72s Get:17 http://ftpmaster.internal/ubuntu plucky/universe Sources [21.0 MB] 73s Get:18 http://ftpmaster.internal/ubuntu plucky/multiverse Sources [298 kB] 73s Get:19 http://ftpmaster.internal/ubuntu plucky/main Sources [1383 kB] 73s Get:20 http://ftpmaster.internal/ubuntu plucky/restricted Sources [16.3 kB] 73s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf Packages [1369 kB] 73s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf Components [401 kB] 73s Get:23 http://ftpmaster.internal/ubuntu plucky/restricted armhf Packages [2900 B] 73s Get:24 http://ftpmaster.internal/ubuntu plucky/restricted armhf Components [196 B] 73s Get:25 http://ftpmaster.internal/ubuntu plucky/universe armhf Packages [15.1 MB] 73s Get:26 http://ftpmaster.internal/ubuntu plucky/universe armhf Components [3953 kB] 73s Get:27 http://ftpmaster.internal/ubuntu plucky/multiverse armhf Packages [173 kB] 73s Get:28 http://ftpmaster.internal/ubuntu plucky/multiverse armhf Components [39.8 kB] 73s Get:29 http://ftpmaster.internal/ubuntu plucky-updates/main armhf Components [208 B] 73s Get:30 http://ftpmaster.internal/ubuntu plucky-updates/restricted armhf Components [212 B] 73s Get:31 http://ftpmaster.internal/ubuntu plucky-updates/universe armhf Components [212 B] 73s Get:32 http://ftpmaster.internal/ubuntu plucky-updates/multiverse armhf Components [212 B] 73s Get:33 http://ftpmaster.internal/ubuntu plucky-security/main armhf Components [204 B] 73s Get:34 http://ftpmaster.internal/ubuntu plucky-security/restricted armhf Components [208 B] 73s Get:35 http://ftpmaster.internal/ubuntu plucky-security/universe armhf Components [208 B] 74s Get:36 http://ftpmaster.internal/ubuntu plucky-security/multiverse armhf Components [208 B] 80s Fetched 45.7 MB in 7s (6756 kB/s) 82s Reading package lists... 88s autopkgtest [06:37:34]: upgrading testbed (apt dist-upgrade and autopurge) 90s Reading package lists... 90s Building dependency tree... 90s Reading state information... 91s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 91s Starting 2 pkgProblemResolver with broken count: 0 91s Done 92s Entering ResolveByKeep 93s 93s The following packages were automatically installed and are no longer required: 93s libapt-pkg6.0t64 libassuan0 libicu74 libnsl2 libpython3.12-minimal 93s libpython3.12-stdlib libunwind8 linux-headers-6.11.0-8 93s linux-headers-6.11.0-8-generic python3.12 python3.12-minimal 93s Use 'apt autoremove' to remove them. 93s The following NEW packages will be installed: 93s gcc-15-base libapt-pkg7.0 libicu76 libjemalloc2 libpython3.13-minimal 93s libpython3.13-stdlib linux-headers-6.12.0-15 linux-headers-6.12.0-15-generic 93s login.defs openssl-provider-legacy python3-bcrypt python3.13 93s python3.13-minimal 93s The following packages will be upgraded: 93s apparmor apport apport-core-dump-handler appstream apt apt-utils base-files 93s base-passwd bash bash-completion bind9-dnsutils bind9-host bind9-libs 93s binutils binutils-arm-linux-gnueabihf binutils-common bsdextrautils bsdutils 93s btrfs-progs busybox-initramfs busybox-static ca-certificates cloud-init 93s cloud-init-base console-setup console-setup-linux coreutils cron 93s cron-daemon-common cryptsetup-bin curl dash dbus dbus-bin dbus-daemon 93s dbus-session-bus-common dbus-system-bus-common dbus-user-session dhcpcd-base 93s diffutils dirmngr distro-info dmsetup dpkg dpkg-dev dracut-install e2fsprogs 93s e2fsprogs-l10n ed eject ethtool fdisk fwupd gcc-14-base gettext-base 93s gir1.2-girepository-2.0 gir1.2-glib-2.0 gir1.2-packagekitglib-1.0 gnupg 93s gnupg-l10n gnupg-utils gpg gpg-agent gpg-wks-client gpgconf gpgsm gpgv 93s groff-base gzip htop ibverbs-providers inetutils-telnet init 93s init-system-helpers initramfs-tools initramfs-tools-bin initramfs-tools-core 93s iproute2 iptables iputils-ping iputils-tracepath kbd keyboard-configuration 93s keyboxd kpartx krb5-locales libapparmor1 libappstream5 libapt-pkg6.0t64 93s libarchive13t64 libatomic1 libbinutils libblkid1 libblockdev-crypto3 93s libblockdev-fs3 libblockdev-loop3 libblockdev-mdraid3 libblockdev-nvme3 93s libblockdev-part3 libblockdev-swap3 libblockdev-utils3 libblockdev3 libbpf1 93s libc-bin libc6 libcap-ng0 libcbor0.10 libcom-err2 libcrypt1 libcryptsetup12 93s libctf-nobfd0 libctf0 libcurl3t64-gnutls libcurl4t64 libdbus-1-3 93s libdebconfclient0 libdevmapper1.02.1 libdpkg-perl libedit2 libext2fs2t64 93s libfdisk1 libffi8 libfribidi0 libftdi1-2 libfwupd3 libgcc-s1 93s libgirepository-1.0-1 libglib2.0-0t64 libglib2.0-bin libglib2.0-data 93s libgnutls30t64 libgpg-error-l10n libgpg-error0 libgpgme11t64 93s libgssapi-krb5-2 libgstreamer1.0-0 libgudev-1.0-0 libhogweed6t64 libibverbs1 93s libicu74 libip4tc2 libip6tc2 libjson-glib-1.0-0 libjson-glib-1.0-common 93s libk5crypto3 libkrb5-3 libkrb5support0 libldap-common libldap2 liblsof0 93s liblz4-1 libmaxminddb0 libmount1 libncurses6 libncursesw6 libnetplan1 93s libnettle8t64 libnewt0.52 libnftables1 libnftnl11 libnpth0t64 libnspr4 93s libnss-systemd libnss3 libnvme1t64 libp11-kit0 libpackagekit-glib2-18 93s libpam-systemd libpcap0.8t64 libperl5.40 libplymouth5 libpng16-16t64 93s libpolkit-agent-1-0 libpolkit-gobject-1-0 libprotobuf-c1 libpython3-stdlib 93s libpython3.12-minimal libpython3.12-stdlib libqmi-glib5 libqmi-proxy 93s libreadline8t64 libsasl2-2 libsasl2-modules libsasl2-modules-db libselinux1 93s libsemanage-common libsemanage2 libsframe1 libsmartcols1 libss2 libssl3t64 93s libstdc++6 libsystemd-shared libsystemd0 libtasn1-6 libtinfo6 libtraceevent1 93s libtraceevent1-plugin libudev1 libudisks2-0 libunistring5 liburcu8t64 93s libusb-1.0-0 libuuid1 libvolume-key1 libwrap0 libxdmcp6 libxkbcommon0 93s libxml2 libxtables12 libxxhash0 libyaml-0-2 libzstd1 linux-headers-generic 93s locales login logsave lshw lsof lto-disabled-list make mawk motd-news-config 93s mount multipath-tools nano ncurses-base ncurses-bin ncurses-term 93s netcat-openbsd netplan-generator netplan.io nftables openssl packagekit 93s packagekit-tools passwd pci.ids perl perl-base perl-modules-5.40 93s pinentry-curses plymouth plymouth-theme-ubuntu-text polkitd pollinate 93s powermgmt-base psmisc publicsuffix python-apt-common python-babel-localedata 93s python3 python3-apport python3-apt python3-attr python3-babel 93s python3-certifi python3-chardet python3-cryptography python3-distro-info 93s python3-gdbm python3-gi python3-idna python3-jinja2 python3-json-pointer 93s python3-jsonpatch python3-jsonschema python3-jwt python3-launchpadlib 93s python3-lazr.uri python3-minimal python3-more-itertools python3-netplan 93s python3-newt python3-oauthlib python3-openssl python3-pkg-resources 93s python3-problem-report python3-pygments python3-referencing python3-requests 93s python3-rich python3-setuptools python3-software-properties python3-urllib3 93s python3-wadllib python3.12 python3.12-gdbm python3.12-minimal 93s python3.13-gdbm readline-common rsync rsyslog software-properties-common 93s systemd systemd-cryptsetup systemd-resolved systemd-sysv systemd-timesyncd 93s sysvinit-utils tar telnet tmux tzdata ubuntu-minimal ubuntu-pro-client 93s ubuntu-pro-client-l10n ubuntu-standard ucf udev udisks2 ufw 93s unattended-upgrades usb.ids util-linux uuid-runtime vim-common vim-tiny 93s whiptail xauth xfsprogs xxd zstd 94s 323 upgraded, 13 newly installed, 0 to remove and 0 not upgraded. 94s Need to get 148 MB of archives. 94s After this operation, 204 MB of additional disk space will be used. 94s Get:1 http://ftpmaster.internal/ubuntu plucky/main armhf motd-news-config all 13.6ubuntu1 [5168 B] 94s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-15-base armhf 15-20250213-1ubuntu1 [53.2 kB] 94s Get:3 http://ftpmaster.internal/ubuntu plucky/main armhf libgcc-s1 armhf 15-20250213-1ubuntu1 [40.6 kB] 94s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf libc6 armhf 2.40-4ubuntu1 [2866 kB] 94s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf libcrypt1 armhf 1:4.4.38-1 [91.7 kB] 94s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf base-files armhf 13.6ubuntu1 [75.3 kB] 94s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf bash armhf 5.2.37-1ubuntu1 [677 kB] 94s Get:8 http://ftpmaster.internal/ubuntu plucky/main armhf bsdutils armhf 1:2.40.2-14ubuntu1 [110 kB] 94s Get:9 http://ftpmaster.internal/ubuntu plucky/main armhf coreutils armhf 9.5-1ubuntu1 [1275 kB] 94s Get:10 http://ftpmaster.internal/ubuntu plucky/main armhf dash armhf 0.5.12-12ubuntu1 [87.4 kB] 94s Get:11 http://ftpmaster.internal/ubuntu plucky/main armhf diffutils armhf 1:3.10-2 [172 kB] 94s Get:12 http://ftpmaster.internal/ubuntu plucky/main armhf libxxhash0 armhf 0.8.3-2 [30.8 kB] 94s Get:13 http://ftpmaster.internal/ubuntu plucky/main armhf liblz4-1 armhf 1.10.0-3 [57.2 kB] 94s Get:14 http://ftpmaster.internal/ubuntu plucky/main armhf openssl-provider-legacy armhf 3.4.1-1ubuntu1 [29.5 kB] 94s Get:15 http://ftpmaster.internal/ubuntu plucky/main armhf libssl3t64 armhf 3.4.1-1ubuntu1 [1771 kB] 94s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf libzstd1 armhf 1.5.6+dfsg-2 [266 kB] 94s Get:17 http://ftpmaster.internal/ubuntu plucky/main armhf libstdc++6 armhf 15-20250213-1ubuntu1 [725 kB] 94s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-timesyncd armhf 257.2-3ubuntu1 [42.1 kB] 94s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf dbus-session-bus-common all 1.16.0-1ubuntu1 [53.1 kB] 94s Get:20 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-sysv armhf 257.2-3ubuntu1 [11.9 kB] 94s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf libpam-systemd armhf 257.2-3ubuntu1 [238 kB] 94s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf dbus-user-session armhf 1.16.0-1ubuntu1 [9684 B] 94s Get:23 http://ftpmaster.internal/ubuntu plucky/main armhf libapparmor1 armhf 4.1.0~beta5-0ubuntu5 [48.7 kB] 94s Get:24 http://ftpmaster.internal/ubuntu plucky/main armhf libcap-ng0 armhf 0.8.5-4 [13.8 kB] 94s Get:25 http://ftpmaster.internal/ubuntu plucky/main armhf libselinux1 armhf 3.7-3ubuntu2 [73.2 kB] 94s Get:26 http://ftpmaster.internal/ubuntu plucky/main armhf dbus-system-bus-common all 1.16.0-1ubuntu1 [54.3 kB] 94s Get:27 http://ftpmaster.internal/ubuntu plucky/main armhf dbus-bin armhf 1.16.0-1ubuntu1 [37.9 kB] 94s Get:28 http://ftpmaster.internal/ubuntu plucky/main armhf dbus armhf 1.16.0-1ubuntu1 [28.1 kB] 94s Get:29 http://ftpmaster.internal/ubuntu plucky/main armhf dbus-daemon armhf 1.16.0-1ubuntu1 [111 kB] 94s Get:30 http://ftpmaster.internal/ubuntu plucky/main armhf libdbus-1-3 armhf 1.16.0-1ubuntu1 [162 kB] 94s Get:31 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-resolved armhf 257.2-3ubuntu1 [315 kB] 94s Get:32 http://ftpmaster.internal/ubuntu plucky/main armhf libncurses6 armhf 6.5+20250125-2 [88.8 kB] 94s Get:33 http://ftpmaster.internal/ubuntu plucky/main armhf libncursesw6 armhf 6.5+20250125-2 [118 kB] 94s Get:34 http://ftpmaster.internal/ubuntu plucky/main armhf libtinfo6 armhf 6.5+20250125-2 [91.9 kB] 94s Get:35 http://ftpmaster.internal/ubuntu plucky/main armhf bsdextrautils armhf 2.40.2-14ubuntu1 [94.2 kB] 94s Get:36 http://ftpmaster.internal/ubuntu plucky/main armhf eject armhf 2.40.2-14ubuntu1 [63.4 kB] 95s Get:37 http://ftpmaster.internal/ubuntu plucky/main armhf fdisk armhf 2.40.2-14ubuntu1 [157 kB] 95s Get:38 http://ftpmaster.internal/ubuntu plucky/main armhf libblkid1 armhf 2.40.2-14ubuntu1 [169 kB] 95s Get:39 http://ftpmaster.internal/ubuntu plucky/main armhf libmount1 armhf 2.40.2-14ubuntu1 [194 kB] 95s Get:40 http://ftpmaster.internal/ubuntu plucky/main armhf libsmartcols1 armhf 2.40.2-14ubuntu1 [137 kB] 95s Get:41 http://ftpmaster.internal/ubuntu plucky/main armhf libuuid1 armhf 2.40.2-14ubuntu1 [41.0 kB] 95s Get:42 http://ftpmaster.internal/ubuntu plucky/main armhf util-linux armhf 2.40.2-14ubuntu1 [1190 kB] 95s Get:43 http://ftpmaster.internal/ubuntu plucky/main armhf uuid-runtime armhf 2.40.2-14ubuntu1 [63.7 kB] 95s Get:44 http://ftpmaster.internal/ubuntu plucky/main armhf libfdisk1 armhf 2.40.2-14ubuntu1 [217 kB] 95s Get:45 http://ftpmaster.internal/ubuntu plucky/main armhf mount armhf 2.40.2-14ubuntu1 [158 kB] 95s Get:46 http://ftpmaster.internal/ubuntu plucky/main armhf readline-common all 8.2-6 [56.5 kB] 95s Get:47 http://ftpmaster.internal/ubuntu plucky/main armhf libreadline8t64 armhf 8.2-6 [131 kB] 95s Get:48 http://ftpmaster.internal/ubuntu plucky/main armhf systemd-cryptsetup armhf 257.2-3ubuntu1 [126 kB] 95s Get:49 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd-shared armhf 257.2-3ubuntu1 [2203 kB] 95s Get:50 http://ftpmaster.internal/ubuntu plucky/main armhf libnss-systemd armhf 257.2-3ubuntu1 [164 kB] 95s Get:51 http://ftpmaster.internal/ubuntu plucky/main armhf systemd armhf 257.2-3ubuntu1 [3028 kB] 95s Get:52 http://ftpmaster.internal/ubuntu plucky/main armhf udev armhf 257.2-3ubuntu1 [1402 kB] 95s Get:53 http://ftpmaster.internal/ubuntu plucky/main armhf libudev1 armhf 257.2-3ubuntu1 [193 kB] 95s Get:54 http://ftpmaster.internal/ubuntu plucky/main armhf libdevmapper1.02.1 armhf 2:1.02.201-1ubuntu1 [137 kB] 95s Get:55 http://ftpmaster.internal/ubuntu plucky/main armhf libcryptsetup12 armhf 2:2.7.5-1ubuntu2 [246 kB] 95s Get:56 http://ftpmaster.internal/ubuntu plucky/main armhf libsystemd0 armhf 257.2-3ubuntu1 [494 kB] 95s Get:57 http://ftpmaster.internal/ubuntu plucky/main armhf libapt-pkg6.0t64 armhf 2.9.29 [1086 kB] 95s Get:58 http://ftpmaster.internal/ubuntu plucky/main armhf tar armhf 1.35+dfsg-3.1 [240 kB] 95s Get:59 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg armhf 1.22.11ubuntu4 [1242 kB] 95s Get:60 http://ftpmaster.internal/ubuntu plucky/main armhf gzip armhf 1.13-1ubuntu2 [98.1 kB] 95s Get:61 http://ftpmaster.internal/ubuntu plucky/main armhf ncurses-bin armhf 6.5+20250125-2 [179 kB] 95s Get:62 http://ftpmaster.internal/ubuntu plucky/main armhf perl-modules-5.40 all 5.40.1-2 [3217 kB] 95s Get:63 http://ftpmaster.internal/ubuntu plucky/main armhf libperl5.40 armhf 5.40.1-2 [4135 kB] 95s Get:64 http://ftpmaster.internal/ubuntu plucky/main armhf perl armhf 5.40.1-2 [262 kB] 95s Get:65 http://ftpmaster.internal/ubuntu plucky/main armhf perl-base armhf 5.40.1-2 [1667 kB] 95s Get:66 http://ftpmaster.internal/ubuntu plucky/main armhf libdebconfclient0 armhf 0.274ubuntu1 [11.2 kB] 95s Get:67 http://ftpmaster.internal/ubuntu plucky/main armhf base-passwd armhf 3.6.6 [53.4 kB] 95s Get:68 http://ftpmaster.internal/ubuntu plucky/main armhf init-system-helpers all 1.68 [39.0 kB] 95s Get:69 http://ftpmaster.internal/ubuntu plucky/main armhf libc-bin armhf 2.40-4ubuntu1 [542 kB] 96s Get:70 http://ftpmaster.internal/ubuntu plucky/main armhf ncurses-base all 6.5+20250125-2 [25.8 kB] 96s Get:71 http://ftpmaster.internal/ubuntu plucky/main armhf ncurses-term all 6.5+20250125-2 [276 kB] 96s Get:72 http://ftpmaster.internal/ubuntu plucky/main armhf kbd armhf 2.7.1-2ubuntu1 [214 kB] 96s Get:73 http://ftpmaster.internal/ubuntu plucky/main armhf console-setup-linux all 1.226ubuntu3 [1880 kB] 96s Get:74 http://ftpmaster.internal/ubuntu plucky/main armhf console-setup all 1.226ubuntu3 [110 kB] 96s Get:75 http://ftpmaster.internal/ubuntu plucky/main armhf keyboard-configuration all 1.226ubuntu3 [212 kB] 96s Get:76 http://ftpmaster.internal/ubuntu plucky/main armhf sysvinit-utils armhf 3.14-1ubuntu1 [35.1 kB] 96s Get:77 http://ftpmaster.internal/ubuntu plucky/main armhf libapt-pkg7.0 armhf 2.9.30ubuntu1 [1067 kB] 96s Get:78 http://ftpmaster.internal/ubuntu plucky/main armhf apt armhf 2.9.30ubuntu1 [1392 kB] 96s Get:79 http://ftpmaster.internal/ubuntu plucky/main armhf apt-utils armhf 2.9.30ubuntu1 [214 kB] 96s Get:80 http://ftpmaster.internal/ubuntu plucky/main armhf libgpg-error-l10n all 1.51-3 [8800 B] 96s Get:81 http://ftpmaster.internal/ubuntu plucky/main armhf libgpg-error0 armhf 1.51-3 [64.8 kB] 96s Get:82 http://ftpmaster.internal/ubuntu plucky/main armhf libnpth0t64 armhf 1.8-2 [7572 B] 96s Get:83 http://ftpmaster.internal/ubuntu plucky/main armhf gpg-wks-client armhf 2.4.4-2ubuntu22 [87.5 kB] 96s Get:84 http://ftpmaster.internal/ubuntu plucky/main armhf dirmngr armhf 2.4.4-2ubuntu22 [347 kB] 96s Get:85 http://ftpmaster.internal/ubuntu plucky/main armhf gpgsm armhf 2.4.4-2ubuntu22 [242 kB] 96s Get:86 http://ftpmaster.internal/ubuntu plucky/main armhf gnupg-utils armhf 2.4.4-2ubuntu22 [159 kB] 96s Get:87 http://ftpmaster.internal/ubuntu plucky/main armhf gpg-agent armhf 2.4.4-2ubuntu22 [237 kB] 96s Get:88 http://ftpmaster.internal/ubuntu plucky/main armhf gpg armhf 2.4.4-2ubuntu22 [525 kB] 96s Get:89 http://ftpmaster.internal/ubuntu plucky/main armhf gpgconf armhf 2.4.4-2ubuntu22 [116 kB] 96s Get:90 http://ftpmaster.internal/ubuntu plucky/main armhf gnupg all 2.4.4-2ubuntu22 [359 kB] 96s Get:91 http://ftpmaster.internal/ubuntu plucky/main armhf keyboxd armhf 2.4.4-2ubuntu22 [111 kB] 96s Get:92 http://ftpmaster.internal/ubuntu plucky/main armhf pinentry-curses armhf 1.3.1-2ubuntu2 [40.6 kB] 96s Get:93 http://ftpmaster.internal/ubuntu plucky/main armhf libnettle8t64 armhf 3.10.1-1 [188 kB] 96s Get:94 http://ftpmaster.internal/ubuntu plucky/main armhf libhogweed6t64 armhf 3.10.1-1 [188 kB] 96s Get:95 http://ftpmaster.internal/ubuntu plucky/main armhf libffi8 armhf 3.4.7-1 [21.1 kB] 96s Get:96 http://ftpmaster.internal/ubuntu plucky/main armhf libp11-kit0 armhf 0.25.5-2ubuntu3 [261 kB] 96s Get:97 http://ftpmaster.internal/ubuntu plucky/main armhf libtasn1-6 armhf 4.20.0-2 [38.2 kB] 96s Get:98 http://ftpmaster.internal/ubuntu plucky/main armhf libunistring5 armhf 1.3-1 [583 kB] 96s Get:99 http://ftpmaster.internal/ubuntu plucky/main armhf libgnutls30t64 armhf 3.8.9-2ubuntu2 [961 kB] 96s Get:100 http://ftpmaster.internal/ubuntu plucky/main armhf libsasl2-modules-db armhf 2.1.28+dfsg1-8build1 [19.0 kB] 96s Get:101 http://ftpmaster.internal/ubuntu plucky/main armhf libsasl2-2 armhf 2.1.28+dfsg1-8build1 [49.9 kB] 96s Get:102 http://ftpmaster.internal/ubuntu plucky/main armhf libldap-common all 2.6.9+dfsg-1~exp2ubuntu1 [33.2 kB] 96s Get:103 http://ftpmaster.internal/ubuntu plucky/main armhf libldap2 armhf 2.6.9+dfsg-1~exp2ubuntu1 [177 kB] 96s Get:104 http://ftpmaster.internal/ubuntu plucky/main armhf gpgv armhf 2.4.4-2ubuntu22 [225 kB] 96s Get:105 http://ftpmaster.internal/ubuntu plucky/main armhf e2fsprogs-l10n all 1.47.2-1ubuntu1 [7030 B] 96s Get:106 http://ftpmaster.internal/ubuntu plucky/main armhf logsave armhf 1.47.2-1ubuntu1 [25.7 kB] 96s Get:107 http://ftpmaster.internal/ubuntu plucky/main armhf ubuntu-minimal armhf 1.547 [11.4 kB] 96s Get:108 http://ftpmaster.internal/ubuntu plucky/main armhf initramfs-tools all 0.145ubuntu2 [7948 B] 96s Get:109 http://ftpmaster.internal/ubuntu plucky/main armhf initramfs-tools-core all 0.145ubuntu2 [51.5 kB] 96s Get:110 http://ftpmaster.internal/ubuntu plucky/main armhf libext2fs2t64 armhf 1.47.2-1ubuntu1 [207 kB] 97s Get:111 http://ftpmaster.internal/ubuntu plucky/main armhf e2fsprogs armhf 1.47.2-1ubuntu1 [588 kB] 97s Get:112 http://ftpmaster.internal/ubuntu plucky/main armhf dhcpcd-base armhf 1:10.1.0-7 [188 kB] 97s Get:113 http://ftpmaster.internal/ubuntu plucky/main armhf init armhf 1.68 [6296 B] 97s Get:114 http://ftpmaster.internal/ubuntu plucky/main armhf libbpf1 armhf 1:1.5.0-2 [158 kB] 97s Get:115 http://ftpmaster.internal/ubuntu plucky/main armhf iptables armhf 1.8.11-2ubuntu1 [342 kB] 97s Get:116 http://ftpmaster.internal/ubuntu plucky/main armhf libip4tc2 armhf 1.8.11-2ubuntu1 [21.7 kB] 97s Get:117 http://ftpmaster.internal/ubuntu plucky/main armhf libip6tc2 armhf 1.8.11-2ubuntu1 [22.1 kB] 97s Get:118 http://ftpmaster.internal/ubuntu plucky/main armhf libnftnl11 armhf 1.2.8-1 [53.3 kB] 97s Get:119 http://ftpmaster.internal/ubuntu plucky/main armhf libxtables12 armhf 1.8.11-2ubuntu1 [33.0 kB] 97s Get:120 http://ftpmaster.internal/ubuntu plucky/main armhf iproute2 armhf 6.13.0-1ubuntu1 [1096 kB] 97s Get:121 http://ftpmaster.internal/ubuntu plucky/main armhf iputils-ping armhf 3:20240905-1ubuntu1 [45.0 kB] 97s Get:122 http://ftpmaster.internal/ubuntu plucky/main armhf locales all 2.40-4ubuntu1 [4224 kB] 97s Get:123 http://ftpmaster.internal/ubuntu plucky/main armhf login.defs all 1:4.16.0-7ubuntu1 [38.5 kB] 97s Get:124 http://ftpmaster.internal/ubuntu plucky/main armhf login armhf 1:4.16.0-2+really2.40.2-14ubuntu1 [85.0 kB] 97s Get:125 http://ftpmaster.internal/ubuntu plucky/main armhf mawk armhf 1.3.4.20250131-1 [119 kB] 97s Get:126 http://ftpmaster.internal/ubuntu plucky/main armhf netcat-openbsd armhf 1.228-1 [42.4 kB] 97s Get:127 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.13-minimal armhf 3.13.2-1 [868 kB] 97s Get:128 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13-minimal armhf 3.13.2-1 [2012 kB] 97s Get:129 http://ftpmaster.internal/ubuntu plucky/main armhf python3-cryptography armhf 43.0.0-1 [925 kB] 97s Get:130 http://ftpmaster.internal/ubuntu plucky/main armhf python3-minimal armhf 3.13.1-1~exp2 [27.6 kB] 97s Get:131 http://ftpmaster.internal/ubuntu plucky/main armhf python3 armhf 3.13.1-1~exp2 [23.9 kB] 97s Get:132 http://ftpmaster.internal/ubuntu plucky/main armhf python3-bcrypt armhf 4.2.0-2.1 [239 kB] 97s Get:133 http://ftpmaster.internal/ubuntu plucky/main armhf tzdata all 2025a-2ubuntu1 [198 kB] 97s Get:134 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.13-stdlib armhf 3.13.2-1 [1969 kB] 97s Get:135 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13 armhf 3.13.2-1 [734 kB] 97s Get:136 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3-stdlib armhf 3.13.1-1~exp2 [10.2 kB] 97s Get:137 http://ftpmaster.internal/ubuntu plucky/main armhf gir1.2-girepository-2.0 armhf 1.82.0-4 [25.3 kB] 97s Get:138 http://ftpmaster.internal/ubuntu plucky/main armhf gir1.2-glib-2.0 armhf 2.83.3-2 [184 kB] 97s Get:139 http://ftpmaster.internal/ubuntu plucky/main armhf libgirepository-1.0-1 armhf 1.82.0-4 [109 kB] 97s Get:140 http://ftpmaster.internal/ubuntu plucky/main armhf libglib2.0-data all 2.83.3-2 [52.7 kB] 97s Get:141 http://ftpmaster.internal/ubuntu plucky/main armhf libglib2.0-bin armhf 2.83.3-2 [92.7 kB] 97s Get:142 http://ftpmaster.internal/ubuntu plucky/main armhf libatomic1 armhf 15-20250213-1ubuntu1 [7938 B] 97s Get:143 http://ftpmaster.internal/ubuntu plucky/main armhf libglib2.0-0t64 armhf 2.83.3-2 [1452 kB] 97s Get:144 http://ftpmaster.internal/ubuntu plucky/main armhf netplan-generator armhf 1.1.2-2ubuntu1 [60.8 kB] 97s Get:145 http://ftpmaster.internal/ubuntu plucky/main armhf libyaml-0-2 armhf 0.2.5-2 [45.3 kB] 97s Get:146 http://ftpmaster.internal/ubuntu plucky/main armhf python3-netplan armhf 1.1.2-2ubuntu1 [24.2 kB] 97s Get:147 http://ftpmaster.internal/ubuntu plucky/main armhf netplan.io armhf 1.1.2-2ubuntu1 [67.7 kB] 97s Get:148 http://ftpmaster.internal/ubuntu plucky/main armhf libnetplan1 armhf 1.1.2-2ubuntu1 [123 kB] 97s Get:149 http://ftpmaster.internal/ubuntu plucky/main armhf ethtool armhf 1:6.11-1 [222 kB] 97s Get:150 http://ftpmaster.internal/ubuntu plucky/main armhf libsemanage-common all 3.7-2.1 [7198 B] 97s Get:151 http://ftpmaster.internal/ubuntu plucky/main armhf libsemanage2 armhf 3.7-2.1 [85.4 kB] 97s Get:152 http://ftpmaster.internal/ubuntu plucky/main armhf passwd armhf 1:4.16.0-7ubuntu1 [1041 kB] 97s Get:153 http://ftpmaster.internal/ubuntu plucky/main armhf ubuntu-pro-client-l10n armhf 34.1.3 [18.3 kB] 97s Get:154 http://ftpmaster.internal/ubuntu plucky/main armhf python-apt-common all 2.9.9 [21.2 kB] 97s Get:155 http://ftpmaster.internal/ubuntu plucky/main armhf python3-apt armhf 2.9.9 [173 kB] 97s Get:156 http://ftpmaster.internal/ubuntu plucky/main armhf distro-info armhf 1.13 [19.1 kB] 97s Get:157 http://ftpmaster.internal/ubuntu plucky/main armhf ubuntu-pro-client armhf 34.1.3 [243 kB] 97s Get:158 http://ftpmaster.internal/ubuntu plucky/main armhf vim-tiny armhf 2:9.1.0967-1ubuntu2 [696 kB] 97s Get:159 http://ftpmaster.internal/ubuntu plucky/main armhf vim-common all 2:9.1.0967-1ubuntu2 [396 kB] 97s Get:160 http://ftpmaster.internal/ubuntu plucky/main armhf python3-newt armhf 0.52.24-4ubuntu1 [20.1 kB] 97s Get:161 http://ftpmaster.internal/ubuntu plucky/main armhf libnewt0.52 armhf 0.52.24-4ubuntu1 [39.7 kB] 97s Get:162 http://ftpmaster.internal/ubuntu plucky/main armhf whiptail armhf 0.52.24-4ubuntu1 [17.3 kB] 98s Get:163 http://ftpmaster.internal/ubuntu plucky/main armhf dracut-install armhf 106-2ubuntu1 [38.7 kB] 98s Get:164 http://ftpmaster.internal/ubuntu plucky/main armhf initramfs-tools-bin armhf 0.145ubuntu2 [24.5 kB] 98s Get:165 http://ftpmaster.internal/ubuntu plucky/main armhf busybox-initramfs armhf 1:1.37.0-4ubuntu1 [188 kB] 98s Get:166 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12 armhf 3.12.9-1 [671 kB] 98s Get:167 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-stdlib armhf 3.12.9-1 [1946 kB] 98s Get:168 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-minimal armhf 3.12.9-1 [2012 kB] 98s Get:169 http://ftpmaster.internal/ubuntu plucky/main armhf libpython3.12-minimal armhf 3.12.9-1 [825 kB] 98s Get:170 http://ftpmaster.internal/ubuntu plucky/main armhf cron armhf 3.0pl1-192ubuntu1 [84.2 kB] 98s Get:171 http://ftpmaster.internal/ubuntu plucky/main armhf rsync armhf 3.4.1-0syncable1 [422 kB] 98s Get:172 http://ftpmaster.internal/ubuntu plucky/main armhf python3-lazr.uri all 1.0.6-5 [13.6 kB] 98s Get:173 http://ftpmaster.internal/ubuntu plucky/main armhf python3-launchpadlib all 2.1.0-1 [126 kB] 98s Get:174 http://ftpmaster.internal/ubuntu plucky/main armhf python3-problem-report all 2.31.0+git20250220-0ubuntu1 [26.0 kB] 98s Get:175 http://ftpmaster.internal/ubuntu plucky/main armhf python3-apport all 2.31.0+git20250220-0ubuntu1 [93.5 kB] 98s Get:176 http://ftpmaster.internal/ubuntu plucky/main armhf python3-gi armhf 3.50.0-4 [260 kB] 98s Get:177 http://ftpmaster.internal/ubuntu plucky/main armhf apport-core-dump-handler all 2.31.0+git20250220-0ubuntu1 [18.7 kB] 98s Get:178 http://ftpmaster.internal/ubuntu plucky/main armhf apport all 2.31.0+git20250220-0ubuntu1 [83.1 kB] 98s Get:179 http://ftpmaster.internal/ubuntu plucky/main armhf gcc-14-base armhf 14.2.0-17ubuntu3 [53.6 kB] 98s Get:180 http://ftpmaster.internal/ubuntu plucky/main armhf libcom-err2 armhf 1.47.2-1ubuntu1 [25.6 kB] 98s Get:181 http://ftpmaster.internal/ubuntu plucky/main armhf libss2 armhf 1.47.2-1ubuntu1 [15.6 kB] 98s Get:182 http://ftpmaster.internal/ubuntu plucky/main armhf openssl armhf 3.4.1-1ubuntu1 [1152 kB] 98s Get:183 http://ftpmaster.internal/ubuntu plucky/main armhf ca-certificates all 20241223 [165 kB] 98s Get:184 http://ftpmaster.internal/ubuntu plucky/main armhf krb5-locales all 1.21.3-4ubuntu1 [14.7 kB] 98s Get:185 http://ftpmaster.internal/ubuntu plucky/main armhf libfribidi0 armhf 1.0.16-1 [24.3 kB] 98s Get:186 http://ftpmaster.internal/ubuntu plucky/main armhf libgssapi-krb5-2 armhf 1.21.3-4ubuntu1 [121 kB] 98s Get:187 http://ftpmaster.internal/ubuntu plucky/main armhf libkrb5-3 armhf 1.21.3-4ubuntu1 [314 kB] 98s Get:188 http://ftpmaster.internal/ubuntu plucky/main armhf libkrb5support0 armhf 1.21.3-4ubuntu1 [31.8 kB] 98s Get:189 http://ftpmaster.internal/ubuntu plucky/main armhf libk5crypto3 armhf 1.21.3-4ubuntu1 [78.6 kB] 98s Get:190 http://ftpmaster.internal/ubuntu plucky/main armhf libicu74 armhf 74.2-1ubuntu6 [10.5 MB] 98s Get:191 http://ftpmaster.internal/ubuntu plucky/main armhf libxml2 armhf 2.12.7+dfsg+really2.9.14-0.2ubuntu3 [599 kB] 98s Get:192 http://ftpmaster.internal/ubuntu plucky/main armhf python3-pygments all 2.18.0+dfsg-2 [835 kB] 98s Get:193 http://ftpmaster.internal/ubuntu plucky/main armhf python3-rich all 13.9.4-1 [190 kB] 98s Get:194 http://ftpmaster.internal/ubuntu plucky/main armhf ucf all 3.0050 [43.5 kB] 98s Get:195 http://ftpmaster.internal/ubuntu plucky/main armhf rsyslog armhf 8.2412.0-2ubuntu1 [471 kB] 98s Get:196 http://ftpmaster.internal/ubuntu plucky/main armhf xxd armhf 2:9.1.0967-1ubuntu2 [67.5 kB] 98s Get:197 http://ftpmaster.internal/ubuntu plucky/main armhf apparmor armhf 4.1.0~beta5-0ubuntu5 [605 kB] 98s Get:198 http://ftpmaster.internal/ubuntu plucky/main armhf bash-completion all 1:2.16.0-7 [214 kB] 98s Get:199 http://ftpmaster.internal/ubuntu plucky/main armhf libjemalloc2 armhf 5.3.0-2build1 [200 kB] 99s Get:200 http://ftpmaster.internal/ubuntu plucky/main armhf libmaxminddb0 armhf 1.12.2-1 [16.9 kB] 99s Get:201 http://ftpmaster.internal/ubuntu plucky/main armhf liburcu8t64 armhf 0.15.1-1 [57.1 kB] 99s Get:202 http://ftpmaster.internal/ubuntu plucky/main armhf bind9-dnsutils armhf 1:9.20.4-3ubuntu1 [155 kB] 99s Get:203 http://ftpmaster.internal/ubuntu plucky/main armhf bind9-host armhf 1:9.20.4-3ubuntu1 [46.4 kB] 99s Get:204 http://ftpmaster.internal/ubuntu plucky/main armhf bind9-libs armhf 1:9.20.4-3ubuntu1 [1186 kB] 99s Get:205 http://ftpmaster.internal/ubuntu plucky/main armhf libedit2 armhf 3.1-20250104-1 [79.3 kB] 99s Get:206 http://ftpmaster.internal/ubuntu plucky/main armhf busybox-static armhf 1:1.37.0-4ubuntu1 [857 kB] 99s Get:207 http://ftpmaster.internal/ubuntu plucky/main armhf cron-daemon-common all 3.0pl1-192ubuntu1 [14.5 kB] 99s Get:208 http://ftpmaster.internal/ubuntu plucky/main armhf dmsetup armhf 2:1.02.201-1ubuntu1 [80.4 kB] 99s Get:209 http://ftpmaster.internal/ubuntu plucky/main armhf ed armhf 1.21-1 [52.8 kB] 99s Get:210 http://ftpmaster.internal/ubuntu plucky/main armhf gettext-base armhf 0.23.1-1 [43.3 kB] 99s Get:211 http://ftpmaster.internal/ubuntu plucky/main armhf groff-base armhf 1.23.0-7 [949 kB] 99s Get:212 http://ftpmaster.internal/ubuntu plucky/main armhf libibverbs1 armhf 55.0-1ubuntu1 [58.5 kB] 99s Get:213 http://ftpmaster.internal/ubuntu plucky/main armhf ibverbs-providers armhf 55.0-1ubuntu1 [27.6 kB] 99s Get:214 http://ftpmaster.internal/ubuntu plucky/main armhf inetutils-telnet armhf 2:2.5-6ubuntu1 [94.7 kB] 99s Get:215 http://ftpmaster.internal/ubuntu plucky/main armhf iputils-tracepath armhf 3:20240905-1ubuntu1 [13.3 kB] 99s Get:216 http://ftpmaster.internal/ubuntu plucky/main armhf libcbor0.10 armhf 0.10.2-2ubuntu1 [22.0 kB] 99s Get:217 http://ftpmaster.internal/ubuntu plucky/main armhf nftables armhf 1.1.1-1build1 [70.8 kB] 99s Get:218 http://ftpmaster.internal/ubuntu plucky/main armhf libnftables1 armhf 1.1.1-1build1 [321 kB] 99s Get:219 http://ftpmaster.internal/ubuntu plucky/main armhf libpcap0.8t64 armhf 1.10.5-2ubuntu1 [140 kB] 99s Get:220 http://ftpmaster.internal/ubuntu plucky/main armhf libpng16-16t64 armhf 1.6.46-4 [171 kB] 99s Get:221 http://ftpmaster.internal/ubuntu plucky/main armhf libxkbcommon0 armhf 1.7.0-2 [113 kB] 99s Get:222 http://ftpmaster.internal/ubuntu plucky/main armhf libplymouth5 armhf 24.004.60-2ubuntu5 [142 kB] 99s Get:223 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1-plugin armhf 1:1.8.4-2 [19.0 kB] 99s Get:224 http://ftpmaster.internal/ubuntu plucky/main armhf libtraceevent1 armhf 1:1.8.4-2 [53.8 kB] 99s Get:225 http://ftpmaster.internal/ubuntu plucky/main armhf libusb-1.0-0 armhf 2:1.0.27-2 [49.5 kB] 99s Get:226 http://ftpmaster.internal/ubuntu plucky/main armhf libxdmcp6 armhf 1:1.1.5-1 [9060 B] 99s Get:227 http://ftpmaster.internal/ubuntu plucky/main armhf lshw armhf 02.19.git.2021.06.19.996aaad9c7-2.1ubuntu1 [311 kB] 99s Get:228 http://ftpmaster.internal/ubuntu plucky/main armhf lsof armhf 4.99.4+dfsg-2 [239 kB] 100s Get:229 http://ftpmaster.internal/ubuntu plucky/main armhf liblsof0 armhf 4.99.4+dfsg-2 [60.8 kB] 100s Get:230 http://ftpmaster.internal/ubuntu plucky/main armhf nano armhf 8.3-1 [277 kB] 100s Get:231 http://ftpmaster.internal/ubuntu plucky/main armhf pci.ids all 0.0~2025.02.12-1 [284 kB] 100s Get:232 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth-theme-ubuntu-text armhf 24.004.60-2ubuntu5 [9914 B] 100s Get:233 http://ftpmaster.internal/ubuntu plucky/main armhf libpackagekit-glib2-18 armhf 1.3.0-3build1 [109 kB] 100s Get:234 http://ftpmaster.internal/ubuntu plucky/main armhf packagekit-tools armhf 1.3.0-3build1 [28.0 kB] 100s Get:235 http://ftpmaster.internal/ubuntu plucky/main armhf polkitd armhf 126-2 [92.5 kB] 100s Get:236 http://ftpmaster.internal/ubuntu plucky/main armhf libpolkit-agent-1-0 armhf 126-2 [15.1 kB] 100s Get:237 http://ftpmaster.internal/ubuntu plucky/main armhf libpolkit-gobject-1-0 armhf 126-2 [45.0 kB] 100s Get:238 http://ftpmaster.internal/ubuntu plucky/main armhf libcurl3t64-gnutls armhf 8.12.1-2ubuntu1 [330 kB] 100s Get:239 http://ftpmaster.internal/ubuntu plucky/main armhf libappstream5 armhf 1.0.4-1 [211 kB] 100s Get:240 http://ftpmaster.internal/ubuntu plucky/main armhf libgstreamer1.0-0 armhf 1.25.50-1 [1164 kB] 100s Get:241 http://ftpmaster.internal/ubuntu plucky/main armhf packagekit armhf 1.3.0-3build1 [431 kB] 100s Get:242 http://ftpmaster.internal/ubuntu plucky/main armhf plymouth armhf 24.004.60-2ubuntu5 [143 kB] 100s Get:243 http://ftpmaster.internal/ubuntu plucky/main armhf powermgmt-base all 1.38 [7378 B] 100s Get:244 http://ftpmaster.internal/ubuntu plucky/main armhf psmisc armhf 23.7-2 [177 kB] 100s Get:245 http://ftpmaster.internal/ubuntu plucky/main armhf publicsuffix all 20250108.1153-0.1 [134 kB] 100s Get:246 http://ftpmaster.internal/ubuntu plucky/main armhf python3-distro-info all 1.13 [7798 B] 100s Get:247 http://ftpmaster.internal/ubuntu plucky/main armhf python3.13-gdbm armhf 3.13.2-1 [30.2 kB] 100s Get:248 http://ftpmaster.internal/ubuntu plucky/main armhf python3.12-gdbm armhf 3.12.9-1 [29.3 kB] 100s Get:249 http://ftpmaster.internal/ubuntu plucky/main armhf python3-gdbm armhf 3.13.1-1 [8668 B] 100s Get:250 http://ftpmaster.internal/ubuntu plucky/main armhf telnet all 0.17+2.5-6ubuntu1 [3694 B] 100s Get:251 http://ftpmaster.internal/ubuntu plucky/main armhf ubuntu-standard armhf 1.547 [11.4 kB] 100s Get:252 http://ftpmaster.internal/ubuntu plucky/main armhf ufw all 0.36.2-9 [170 kB] 100s Get:253 http://ftpmaster.internal/ubuntu plucky/main armhf usb.ids all 2025.01.14-1 [223 kB] 100s Get:254 http://ftpmaster.internal/ubuntu plucky/main armhf xauth armhf 1:1.1.2-1.1 [23.0 kB] 100s Get:255 http://ftpmaster.internal/ubuntu plucky/main armhf appstream armhf 1.0.4-1 [67.3 kB] 100s Get:256 http://ftpmaster.internal/ubuntu plucky/main armhf libctf0 armhf 2.44-2ubuntu1 [74.3 kB] 100s Get:257 http://ftpmaster.internal/ubuntu plucky/main armhf libctf-nobfd0 armhf 2.44-2ubuntu1 [77.6 kB] 100s Get:258 http://ftpmaster.internal/ubuntu plucky/main armhf binutils-arm-linux-gnueabihf armhf 2.44-2ubuntu1 [995 kB] 100s Get:259 http://ftpmaster.internal/ubuntu plucky/main armhf libbinutils armhf 2.44-2ubuntu1 [405 kB] 100s Get:260 http://ftpmaster.internal/ubuntu plucky/main armhf binutils armhf 2.44-2ubuntu1 [3234 B] 100s Get:261 http://ftpmaster.internal/ubuntu plucky/main armhf binutils-common armhf 2.44-2ubuntu1 [215 kB] 100s Get:262 http://ftpmaster.internal/ubuntu plucky/main armhf libsframe1 armhf 2.44-2ubuntu1 [12.4 kB] 100s Get:263 http://ftpmaster.internal/ubuntu plucky/main armhf btrfs-progs armhf 6.12-1build1 [884 kB] 100s Get:264 http://ftpmaster.internal/ubuntu plucky/main armhf python3-certifi all 2025.1.31+ds-1 [9816 B] 100s Get:265 http://ftpmaster.internal/ubuntu plucky/main armhf python3-chardet all 5.2.0+dfsg-2 [116 kB] 100s Get:266 http://ftpmaster.internal/ubuntu plucky/main armhf python3-idna all 3.10-1 [47.4 kB] 100s Get:267 http://ftpmaster.internal/ubuntu plucky/main armhf python3-urllib3 all 2.3.0-1 [94.0 kB] 100s Get:268 http://ftpmaster.internal/ubuntu plucky/main armhf python3-requests all 2.32.3+dfsg-4ubuntu1 [52.9 kB] 100s Get:269 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jinja2 all 3.1.5-2 [109 kB] 100s Get:270 http://ftpmaster.internal/ubuntu plucky/main armhf python3-json-pointer all 2.4-3 [8444 B] 100s Get:271 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jsonpatch all 1.32-5 [12.3 kB] 100s Get:272 http://ftpmaster.internal/ubuntu plucky/main armhf python3-attr all 25.1.0-1 [50.4 kB] 100s Get:273 http://ftpmaster.internal/ubuntu plucky/main armhf python3-referencing all 0.35.1-2ubuntu1 [21.9 kB] 100s Get:274 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jsonschema all 4.19.2-6ubuntu1 [65.5 kB] 100s Get:275 http://ftpmaster.internal/ubuntu plucky/main armhf python3-jwt all 2.10.1-2 [21.0 kB] 100s Get:276 http://ftpmaster.internal/ubuntu plucky/main armhf python3-oauthlib all 3.2.2-3 [89.9 kB] 100s Get:277 http://ftpmaster.internal/ubuntu plucky/main armhf cloud-init-base all 25.1-0ubuntu1 [616 kB] 100s Get:278 http://ftpmaster.internal/ubuntu plucky/main armhf cryptsetup-bin armhf 2:2.7.5-1ubuntu2 [220 kB] 100s Get:279 http://ftpmaster.internal/ubuntu plucky/main armhf curl armhf 8.12.1-2ubuntu1 [241 kB] 100s Get:280 http://ftpmaster.internal/ubuntu plucky/main armhf libcurl4t64 armhf 8.12.1-2ubuntu1 [335 kB] 100s Get:281 http://ftpmaster.internal/ubuntu plucky/main armhf dpkg-dev all 1.22.11ubuntu4 [1088 kB] 100s Get:282 http://ftpmaster.internal/ubuntu plucky/main armhf libdpkg-perl all 1.22.11ubuntu4 [279 kB] 100s Get:283 http://ftpmaster.internal/ubuntu plucky/main armhf make armhf 4.4.1-1 [180 kB] 100s Get:284 http://ftpmaster.internal/ubuntu plucky/main armhf lto-disabled-list all 56 [12.4 kB] 100s Get:285 http://ftpmaster.internal/ubuntu plucky/main armhf libarchive13t64 armhf 3.7.7-0ubuntu1 [335 kB] 100s Get:286 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-common all 1.10.6+ds-1 [5636 B] 100s Get:287 http://ftpmaster.internal/ubuntu plucky/main armhf libjson-glib-1.0-0 armhf 1.10.6+ds-1 [59.5 kB] 100s Get:288 http://ftpmaster.internal/ubuntu plucky/main armhf fwupd armhf 2.0.6-3 [5155 kB] 101s Get:289 http://ftpmaster.internal/ubuntu plucky/main armhf libfwupd3 armhf 2.0.6-3 [125 kB] 101s Get:290 http://ftpmaster.internal/ubuntu plucky/main armhf libprotobuf-c1 armhf 1.5.1-1ubuntu1 [18.1 kB] 101s Get:291 http://ftpmaster.internal/ubuntu plucky/main armhf libqmi-proxy armhf 1.35.6-1 [5878 B] 101s Get:292 http://ftpmaster.internal/ubuntu plucky/main armhf libqmi-glib5 armhf 1.35.6-1 [928 kB] 101s Get:293 http://ftpmaster.internal/ubuntu plucky/main armhf gir1.2-packagekitglib-1.0 armhf 1.3.0-3build1 [25.5 kB] 101s Get:294 http://ftpmaster.internal/ubuntu plucky/main armhf gnupg-l10n all 2.4.4-2ubuntu22 [66.4 kB] 101s Get:295 http://ftpmaster.internal/ubuntu plucky/main armhf htop armhf 3.3.0-5 [140 kB] 101s Get:296 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-utils3 armhf 3.3.0-1 [17.5 kB] 101s Get:297 http://ftpmaster.internal/ubuntu plucky/main armhf libnspr4 armhf 2:4.36-1ubuntu1 [94.5 kB] 101s Get:298 http://ftpmaster.internal/ubuntu plucky/main armhf libnss3 armhf 2:3.108-1ubuntu1 [1317 kB] 101s Get:299 http://ftpmaster.internal/ubuntu plucky/main armhf libgpgme11t64 armhf 1.24.2-1ubuntu1 [125 kB] 101s Get:300 http://ftpmaster.internal/ubuntu plucky/main armhf libvolume-key1 armhf 0.3.12-9 [39.1 kB] 101s Get:301 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-crypto3 armhf 3.3.0-1 [22.4 kB] 101s Get:302 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-fs3 armhf 3.3.0-1 [34.5 kB] 101s Get:303 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-loop3 armhf 3.3.0-1 [6594 B] 101s Get:304 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-mdraid3 armhf 3.3.0-1 [13.4 kB] 101s Get:305 http://ftpmaster.internal/ubuntu plucky/main armhf libnvme1t64 armhf 1.11.1-2 [73.6 kB] 101s Get:306 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-nvme3 armhf 3.3.0-1 [17.7 kB] 101s Get:307 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-part3 armhf 3.3.0-1 [16.6 kB] 101s Get:308 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev-swap3 armhf 3.3.0-1 [9010 B] 101s Get:309 http://ftpmaster.internal/ubuntu plucky/main armhf libblockdev3 armhf 3.3.0-1 [44.4 kB] 101s Get:310 http://ftpmaster.internal/ubuntu plucky/main armhf libftdi1-2 armhf 1.5-8 [26.3 kB] 101s Get:311 http://ftpmaster.internal/ubuntu plucky/main armhf libgudev-1.0-0 armhf 1:238-6 [13.7 kB] 101s Get:312 http://ftpmaster.internal/ubuntu plucky/main armhf libicu76 armhf 76.1-1ubuntu2 [10.8 MB] 102s Get:313 http://ftpmaster.internal/ubuntu plucky/main armhf libsasl2-modules armhf 2.1.28+dfsg1-8build1 [62.7 kB] 102s Get:314 http://ftpmaster.internal/ubuntu plucky/main armhf udisks2 armhf 2.10.1-11ubuntu2 [278 kB] 102s Get:315 http://ftpmaster.internal/ubuntu plucky/main armhf libudisks2-0 armhf 2.10.1-11ubuntu2 [142 kB] 102s Get:316 http://ftpmaster.internal/ubuntu plucky/main armhf libwrap0 armhf 7.6.q-35 [45.6 kB] 102s Get:317 http://ftpmaster.internal/ubuntu plucky/main armhf linux-headers-6.12.0-15 all 6.12.0-15.15 [14.1 MB] 103s Get:318 http://ftpmaster.internal/ubuntu plucky/main armhf linux-headers-6.12.0-15-generic armhf 6.12.0-15.15 [1414 kB] 103s Get:319 http://ftpmaster.internal/ubuntu plucky/main armhf linux-headers-generic armhf 6.12.0-15.15+1 [10.8 kB] 103s Get:320 http://ftpmaster.internal/ubuntu plucky/main armhf pollinate all 4.33-4ubuntu2 [12.4 kB] 103s Get:321 http://ftpmaster.internal/ubuntu plucky/main armhf python3-babel all 2.17.0-1 [101 kB] 103s Get:322 http://ftpmaster.internal/ubuntu plucky/main armhf python-babel-localedata all 2.17.0-1 [6678 kB] 103s Get:323 http://ftpmaster.internal/ubuntu plucky/main armhf python3-more-itertools all 10.6.0-1 [57.7 kB] 103s Get:324 http://ftpmaster.internal/ubuntu plucky/main armhf python3-openssl all 25.0.0-1 [46.1 kB] 103s Get:325 http://ftpmaster.internal/ubuntu plucky/main armhf python3-pkg-resources all 75.6.0-1 [144 kB] 103s Get:326 http://ftpmaster.internal/ubuntu plucky/main armhf python3-setuptools all 75.6.0-1 [645 kB] 103s Get:327 http://ftpmaster.internal/ubuntu plucky/main armhf software-properties-common all 0.109 [16.5 kB] 103s Get:328 http://ftpmaster.internal/ubuntu plucky/main armhf python3-software-properties all 0.109 [31.0 kB] 103s Get:329 http://ftpmaster.internal/ubuntu plucky/main armhf python3-wadllib all 2.0.0-2 [36.2 kB] 103s Get:330 http://ftpmaster.internal/ubuntu plucky/main armhf tmux armhf 3.5a-3 [406 kB] 103s Get:331 http://ftpmaster.internal/ubuntu plucky/main armhf unattended-upgrades all 2.12ubuntu4 [58.5 kB] 103s Get:332 http://ftpmaster.internal/ubuntu plucky/main armhf xfsprogs armhf 6.12.0-1ubuntu1 [958 kB] 103s Get:333 http://ftpmaster.internal/ubuntu plucky/main armhf zstd armhf 1.5.6+dfsg-2 [690 kB] 103s Get:334 http://ftpmaster.internal/ubuntu plucky/main armhf cloud-init all 25.1-0ubuntu1 [2088 B] 103s Get:335 http://ftpmaster.internal/ubuntu plucky/main armhf kpartx armhf 0.9.9-1ubuntu4 [35.0 kB] 103s Get:336 http://ftpmaster.internal/ubuntu plucky/main armhf multipath-tools armhf 0.9.9-1ubuntu4 [294 kB] 104s Preconfiguring packages ... 106s Fetched 148 MB in 10s (14.9 MB/s) 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59970 files and directories currently installed.) 107s Preparing to unpack .../motd-news-config_13.6ubuntu1_all.deb ... 107s Unpacking motd-news-config (13.6ubuntu1) over (13.5ubuntu3) ... 107s Selecting previously unselected package gcc-15-base:armhf. 107s Preparing to unpack .../gcc-15-base_15-20250213-1ubuntu1_armhf.deb ... 107s Unpacking gcc-15-base:armhf (15-20250213-1ubuntu1) ... 107s Setting up gcc-15-base:armhf (15-20250213-1ubuntu1) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 107s Preparing to unpack .../libgcc-s1_15-20250213-1ubuntu1_armhf.deb ... 107s Unpacking libgcc-s1:armhf (15-20250213-1ubuntu1) over (14.2.0-8ubuntu1) ... 107s Setting up libgcc-s1:armhf (15-20250213-1ubuntu1) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 107s Preparing to unpack .../libc6_2.40-4ubuntu1_armhf.deb ... 107s Unpacking libc6:armhf (2.40-4ubuntu1) over (2.40-1ubuntu3) ... 107s Setting up libc6:armhf (2.40-4ubuntu1) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 107s Preparing to unpack .../libcrypt1_1%3a4.4.38-1_armhf.deb ... 107s Unpacking libcrypt1:armhf (1:4.4.38-1) over (1:4.4.36-5) ... 107s Setting up libcrypt1:armhf (1:4.4.38-1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 108s Preparing to unpack .../base-files_13.6ubuntu1_armhf.deb ... 108s Unpacking base-files (13.6ubuntu1) over (13.5ubuntu3) ... 108s Setting up base-files (13.6ubuntu1) ... 108s Updating /root/.profile to current default. 108s motd-news.service is a disabled or a static unit not running, not starting it. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../bash_5.2.37-1ubuntu1_armhf.deb ... 109s Unpacking bash (5.2.37-1ubuntu1) over (5.2.32-1ubuntu2) ... 109s Setting up bash (5.2.37-1ubuntu1) ... 109s update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../bsdutils_1%3a2.40.2-14ubuntu1_armhf.deb ... 109s Unpacking bsdutils (1:2.40.2-14ubuntu1) over (1:2.40.2-1ubuntu1) ... 109s Setting up bsdutils (1:2.40.2-14ubuntu1) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../coreutils_9.5-1ubuntu1_armhf.deb ... 109s Unpacking coreutils (9.5-1ubuntu1) over (9.4-3.1ubuntu1) ... 109s Setting up coreutils (9.5-1ubuntu1) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../dash_0.5.12-12ubuntu1_armhf.deb ... 109s Unpacking dash (0.5.12-12ubuntu1) over (0.5.12-9ubuntu1) ... 109s Setting up dash (0.5.12-12ubuntu1) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../diffutils_1%3a3.10-2_armhf.deb ... 109s Unpacking diffutils (1:3.10-2) over (1:3.10-1build1) ... 109s Setting up diffutils (1:3.10-2) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../libxxhash0_0.8.3-2_armhf.deb ... 109s Unpacking libxxhash0:armhf (0.8.3-2) over (0.8.2-2build1) ... 109s Setting up libxxhash0:armhf (0.8.3-2) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../liblz4-1_1.10.0-3_armhf.deb ... 109s Unpacking liblz4-1:armhf (1.10.0-3) over (1.9.4-3) ... 109s Setting up liblz4-1:armhf (1.10.0-3) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59975 files and directories currently installed.) 109s Preparing to unpack .../libssl3t64_3.4.1-1ubuntu1_armhf.deb ... 109s Unpacking libssl3t64:armhf (3.4.1-1ubuntu1) over (3.3.1-2ubuntu2) ... 109s Selecting previously unselected package openssl-provider-legacy. 109s Preparing to unpack .../openssl-provider-legacy_3.4.1-1ubuntu1_armhf.deb ... 109s Unpacking openssl-provider-legacy (3.4.1-1ubuntu1) ... 110s Setting up libssl3t64:armhf (3.4.1-1ubuntu1) ... 110s Setting up openssl-provider-legacy (3.4.1-1ubuntu1) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59977 files and directories currently installed.) 110s Preparing to unpack .../libzstd1_1.5.6+dfsg-2_armhf.deb ... 110s Unpacking libzstd1:armhf (1.5.6+dfsg-2) over (1.5.6+dfsg-1) ... 110s Setting up libzstd1:armhf (1.5.6+dfsg-2) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59977 files and directories currently installed.) 110s Preparing to unpack .../libstdc++6_15-20250213-1ubuntu1_armhf.deb ... 110s Unpacking libstdc++6:armhf (15-20250213-1ubuntu1) over (14.2.0-8ubuntu1) ... 110s Setting up libstdc++6:armhf (15-20250213-1ubuntu1) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59977 files and directories currently installed.) 110s Preparing to unpack .../0-systemd-timesyncd_257.2-3ubuntu1_armhf.deb ... 110s Unpacking systemd-timesyncd (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 110s Preparing to unpack .../1-dbus-session-bus-common_1.16.0-1ubuntu1_all.deb ... 110s Unpacking dbus-session-bus-common (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 110s Preparing to unpack .../2-systemd-sysv_257.2-3ubuntu1_armhf.deb ... 110s Unpacking systemd-sysv (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 110s Preparing to unpack .../3-libpam-systemd_257.2-3ubuntu1_armhf.deb ... 110s Unpacking libpam-systemd:armhf (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 110s Preparing to unpack .../4-dbus-user-session_1.16.0-1ubuntu1_armhf.deb ... 110s Unpacking dbus-user-session (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 110s Preparing to unpack .../5-libapparmor1_4.1.0~beta5-0ubuntu5_armhf.deb ... 110s Unpacking libapparmor1:armhf (4.1.0~beta5-0ubuntu5) over (4.1.0~beta1-0ubuntu4) ... 110s Preparing to unpack .../6-libcap-ng0_0.8.5-4_armhf.deb ... 110s Unpacking libcap-ng0:armhf (0.8.5-4) over (0.8.5-3build1) ... 110s Setting up libcap-ng0:armhf (0.8.5-4) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59978 files and directories currently installed.) 110s Preparing to unpack .../libselinux1_3.7-3ubuntu2_armhf.deb ... 110s Unpacking libselinux1:armhf (3.7-3ubuntu2) over (3.7-3ubuntu1) ... 110s Setting up libselinux1:armhf (3.7-3ubuntu2) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59978 files and directories currently installed.) 110s Preparing to unpack .../0-dbus-system-bus-common_1.16.0-1ubuntu1_all.deb ... 110s Unpacking dbus-system-bus-common (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 110s Preparing to unpack .../1-dbus-bin_1.16.0-1ubuntu1_armhf.deb ... 110s Unpacking dbus-bin (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 110s Preparing to unpack .../2-dbus_1.16.0-1ubuntu1_armhf.deb ... 110s Unpacking dbus (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 110s Preparing to unpack .../3-dbus-daemon_1.16.0-1ubuntu1_armhf.deb ... 110s Unpacking dbus-daemon (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 111s Preparing to unpack .../4-libdbus-1-3_1.16.0-1ubuntu1_armhf.deb ... 111s Unpacking libdbus-1-3:armhf (1.16.0-1ubuntu1) over (1.14.10-4ubuntu5) ... 111s Preparing to unpack .../5-systemd-resolved_257.2-3ubuntu1_armhf.deb ... 111s Unpacking systemd-resolved (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 111s Preparing to unpack .../6-libncurses6_6.5+20250125-2_armhf.deb ... 111s Unpacking libncurses6:armhf (6.5+20250125-2) over (6.5-2) ... 111s Preparing to unpack .../7-libncursesw6_6.5+20250125-2_armhf.deb ... 111s Unpacking libncursesw6:armhf (6.5+20250125-2) over (6.5-2) ... 111s Preparing to unpack .../8-libtinfo6_6.5+20250125-2_armhf.deb ... 111s Unpacking libtinfo6:armhf (6.5+20250125-2) over (6.5-2) ... 111s Setting up libtinfo6:armhf (6.5+20250125-2) ... 111s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59978 files and directories currently installed.) 111s Preparing to unpack .../bsdextrautils_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking bsdextrautils (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Preparing to unpack .../eject_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking eject (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Preparing to unpack .../fdisk_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking fdisk (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Preparing to unpack .../libblkid1_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking libblkid1:armhf (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Setting up libblkid1:armhf (2.40.2-14ubuntu1) ... 111s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59974 files and directories currently installed.) 111s Preparing to unpack .../libmount1_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking libmount1:armhf (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Setting up libmount1:armhf (2.40.2-14ubuntu1) ... 111s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59974 files and directories currently installed.) 111s Preparing to unpack .../libsmartcols1_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking libsmartcols1:armhf (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Setting up libsmartcols1:armhf (2.40.2-14ubuntu1) ... 111s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59974 files and directories currently installed.) 111s Preparing to unpack .../libuuid1_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking libuuid1:armhf (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Setting up libuuid1:armhf (2.40.2-14ubuntu1) ... 111s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59974 files and directories currently installed.) 111s Preparing to unpack .../util-linux_2.40.2-14ubuntu1_armhf.deb ... 111s Unpacking util-linux (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 111s Setting up util-linux (2.40.2-14ubuntu1) ... 112s fstrim.service is a disabled or a static unit not running, not starting it. 112s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59967 files and directories currently installed.) 112s Preparing to unpack .../0-uuid-runtime_2.40.2-14ubuntu1_armhf.deb ... 112s Unpacking uuid-runtime (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 112s Preparing to unpack .../1-libfdisk1_2.40.2-14ubuntu1_armhf.deb ... 112s Unpacking libfdisk1:armhf (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 112s Preparing to unpack .../2-mount_2.40.2-14ubuntu1_armhf.deb ... 112s Unpacking mount (2.40.2-14ubuntu1) over (2.40.2-1ubuntu1) ... 112s Preparing to unpack .../3-readline-common_8.2-6_all.deb ... 112s Unpacking readline-common (8.2-6) over (8.2-5) ... 112s Preparing to unpack .../4-libreadline8t64_8.2-6_armhf.deb ... 112s Leaving 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8 to /lib/arm-linux-gnueabihf/libhistory.so.8.usr-is-merged by libreadline8t64' 112s Leaving 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8.2 to /lib/arm-linux-gnueabihf/libhistory.so.8.2.usr-is-merged by libreadline8t64' 112s Leaving 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8 to /lib/arm-linux-gnueabihf/libreadline.so.8.usr-is-merged by libreadline8t64' 112s Leaving 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8.2 to /lib/arm-linux-gnueabihf/libreadline.so.8.2.usr-is-merged by libreadline8t64' 112s Unpacking libreadline8t64:armhf (8.2-6) over (8.2-5) ... 112s Preparing to unpack .../5-systemd-cryptsetup_257.2-3ubuntu1_armhf.deb ... 112s Unpacking systemd-cryptsetup (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Preparing to unpack .../6-libsystemd-shared_257.2-3ubuntu1_armhf.deb ... 113s Unpacking libsystemd-shared:armhf (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Preparing to unpack .../7-libnss-systemd_257.2-3ubuntu1_armhf.deb ... 113s Unpacking libnss-systemd:armhf (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Setting up libsystemd-shared:armhf (257.2-3ubuntu1) ... 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59967 files and directories currently installed.) 113s Preparing to unpack .../systemd_257.2-3ubuntu1_armhf.deb ... 113s Unpacking systemd (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Preparing to unpack .../udev_257.2-3ubuntu1_armhf.deb ... 113s Unpacking udev (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Preparing to unpack .../libudev1_257.2-3ubuntu1_armhf.deb ... 113s Unpacking libudev1:armhf (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Setting up libudev1:armhf (257.2-3ubuntu1) ... 113s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 113s Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.201-1ubuntu1_armhf.deb ... 113s Unpacking libdevmapper1.02.1:armhf (2:1.02.201-1ubuntu1) over (2:1.02.196-1ubuntu2) ... 113s Preparing to unpack .../libcryptsetup12_2%3a2.7.5-1ubuntu2_armhf.deb ... 113s Unpacking libcryptsetup12:armhf (2:2.7.5-1ubuntu2) over (2:2.7.2-2ubuntu1) ... 113s Preparing to unpack .../libsystemd0_257.2-3ubuntu1_armhf.deb ... 113s Unpacking libsystemd0:armhf (257.2-3ubuntu1) over (256.5-2ubuntu4) ... 113s Setting up libsystemd0:armhf (257.2-3ubuntu1) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 114s Preparing to unpack .../libapt-pkg6.0t64_2.9.29_armhf.deb ... 114s Unpacking libapt-pkg6.0t64:armhf (2.9.29) over (2.9.14ubuntu1) ... 114s Setting up libapt-pkg6.0t64:armhf (2.9.29) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 114s Preparing to unpack .../tar_1.35+dfsg-3.1_armhf.deb ... 114s Unpacking tar (1.35+dfsg-3.1) over (1.35+dfsg-3build1) ... 114s Setting up tar (1.35+dfsg-3.1) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 114s Preparing to unpack .../dpkg_1.22.11ubuntu4_armhf.deb ... 114s Unpacking dpkg (1.22.11ubuntu4) over (1.22.11ubuntu3) ... 114s Setting up dpkg (1.22.11ubuntu4) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 114s Preparing to unpack .../gzip_1.13-1ubuntu2_armhf.deb ... 114s Unpacking gzip (1.13-1ubuntu2) over (1.12-1.1ubuntu1) ... 115s Setting up gzip (1.13-1ubuntu2) ... 115s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 115s Preparing to unpack .../ncurses-bin_6.5+20250125-2_armhf.deb ... 115s Unpacking ncurses-bin (6.5+20250125-2) over (6.5-2) ... 115s Setting up ncurses-bin (6.5+20250125-2) ... 115s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 115s Preparing to unpack .../perl_5.40.1-2_armhf.deb ... 115s Unpacking perl (5.40.1-2) over (5.40.0-8) ... 115s Preparing to unpack .../perl-modules-5.40_5.40.1-2_all.deb ... 115s Unpacking perl-modules-5.40 (5.40.1-2) over (5.40.0-8) ... 115s Preparing to unpack .../libperl5.40_5.40.1-2_armhf.deb ... 115s Unpacking libperl5.40:armhf (5.40.1-2) over (5.40.0-8) ... 115s Preparing to unpack .../perl-base_5.40.1-2_armhf.deb ... 115s Unpacking perl-base (5.40.1-2) over (5.40.0-8) ... 116s Setting up perl-base (5.40.1-2) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 116s Preparing to unpack .../libdebconfclient0_0.274ubuntu1_armhf.deb ... 116s Unpacking libdebconfclient0:armhf (0.274ubuntu1) over (0.272ubuntu1) ... 116s Setting up libdebconfclient0:armhf (0.274ubuntu1) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 116s Preparing to unpack .../base-passwd_3.6.6_armhf.deb ... 116s Unpacking base-passwd (3.6.6) over (3.6.5) ... 116s Setting up base-passwd (3.6.6) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 116s Preparing to unpack .../init-system-helpers_1.68_all.deb ... 116s Unpacking init-system-helpers (1.68) over (1.67ubuntu1) ... 116s Setting up init-system-helpers (1.68) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 116s Preparing to unpack .../libc-bin_2.40-4ubuntu1_armhf.deb ... 116s Unpacking libc-bin (2.40-4ubuntu1) over (2.40-1ubuntu3) ... 116s Setting up libc-bin (2.40-4ubuntu1) ... 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 117s Preparing to unpack .../ncurses-base_6.5+20250125-2_all.deb ... 117s Unpacking ncurses-base (6.5+20250125-2) over (6.5-2) ... 117s Setting up ncurses-base (6.5+20250125-2) ... 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59961 files and directories currently installed.) 117s Preparing to unpack .../0-ncurses-term_6.5+20250125-2_all.deb ... 117s Unpacking ncurses-term (6.5+20250125-2) over (6.5-2) ... 117s Preparing to unpack .../1-kbd_2.7.1-2ubuntu1_armhf.deb ... 117s Unpacking kbd (2.7.1-2ubuntu1) over (2.6.4-2ubuntu3) ... 117s Preparing to unpack .../2-console-setup-linux_1.226ubuntu3_all.deb ... 117s Unpacking console-setup-linux (1.226ubuntu3) over (1.226ubuntu2) ... 118s Preparing to unpack .../3-console-setup_1.226ubuntu3_all.deb ... 118s Unpacking console-setup (1.226ubuntu3) over (1.226ubuntu2) ... 118s Preparing to unpack .../4-keyboard-configuration_1.226ubuntu3_all.deb ... 118s Unpacking keyboard-configuration (1.226ubuntu3) over (1.226ubuntu2) ... 118s Preparing to unpack .../5-sysvinit-utils_3.14-1ubuntu1_armhf.deb ... 118s Unpacking sysvinit-utils (3.14-1ubuntu1) over (3.08-6ubuntu3) ... 118s Setting up sysvinit-utils (3.14-1ubuntu1) ... 118s Selecting previously unselected package libapt-pkg7.0:armhf. 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 59966 files and directories currently installed.) 118s Preparing to unpack .../libapt-pkg7.0_2.9.30ubuntu1_armhf.deb ... 118s Unpacking libapt-pkg7.0:armhf (2.9.30ubuntu1) ... 118s Setting up libapt-pkg7.0:armhf (2.9.30ubuntu1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60015 files and directories currently installed.) 118s Preparing to unpack .../apt_2.9.30ubuntu1_armhf.deb ... 118s Unpacking apt (2.9.30ubuntu1) over (2.9.14ubuntu1) ... 118s Setting up apt (2.9.30ubuntu1) ... 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 119s Preparing to unpack .../apt-utils_2.9.30ubuntu1_armhf.deb ... 119s Unpacking apt-utils (2.9.30ubuntu1) over (2.9.14ubuntu1) ... 119s Preparing to unpack .../libgpg-error-l10n_1.51-3_all.deb ... 119s Unpacking libgpg-error-l10n (1.51-3) over (1.50-4) ... 119s Preparing to unpack .../libgpg-error0_1.51-3_armhf.deb ... 119s Unpacking libgpg-error0:armhf (1.51-3) over (1.50-4) ... 119s Setting up libgpg-error0:armhf (1.51-3) ... 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 119s Preparing to unpack .../libnpth0t64_1.8-2_armhf.deb ... 119s Unpacking libnpth0t64:armhf (1.8-2) over (1.6-3.1build1) ... 119s Setting up libnpth0t64:armhf (1.8-2) ... 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 119s Preparing to unpack .../00-gpg-wks-client_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gpg-wks-client (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../01-dirmngr_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking dirmngr (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../02-gpgsm_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gpgsm (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../03-gnupg-utils_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gnupg-utils (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../04-gpg-agent_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gpg-agent (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../05-gpg_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gpg (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../06-gpgconf_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking gpgconf (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../07-gnupg_2.4.4-2ubuntu22_all.deb ... 119s Unpacking gnupg (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../08-keyboxd_2.4.4-2ubuntu22_armhf.deb ... 119s Unpacking keyboxd (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 119s Preparing to unpack .../09-pinentry-curses_1.3.1-2ubuntu2_armhf.deb ... 119s Unpacking pinentry-curses (1.3.1-2ubuntu2) over (1.3.1-0ubuntu2) ... 120s Preparing to unpack .../10-libnettle8t64_3.10.1-1_armhf.deb ... 120s Unpacking libnettle8t64:armhf (3.10.1-1) over (3.10-1) ... 120s Setting up libnettle8t64:armhf (3.10.1-1) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libhogweed6t64_3.10.1-1_armhf.deb ... 120s Unpacking libhogweed6t64:armhf (3.10.1-1) over (3.10-1) ... 120s Setting up libhogweed6t64:armhf (3.10.1-1) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libffi8_3.4.7-1_armhf.deb ... 120s Unpacking libffi8:armhf (3.4.7-1) over (3.4.6-1build1) ... 120s Setting up libffi8:armhf (3.4.7-1) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libp11-kit0_0.25.5-2ubuntu3_armhf.deb ... 120s Unpacking libp11-kit0:armhf (0.25.5-2ubuntu3) over (0.25.5-2ubuntu1) ... 120s Setting up libp11-kit0:armhf (0.25.5-2ubuntu3) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libtasn1-6_4.20.0-2_armhf.deb ... 120s Unpacking libtasn1-6:armhf (4.20.0-2) over (4.19.0-3build1) ... 120s Setting up libtasn1-6:armhf (4.20.0-2) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libunistring5_1.3-1_armhf.deb ... 120s Unpacking libunistring5:armhf (1.3-1) over (1.2-1) ... 120s Setting up libunistring5:armhf (1.3-1) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libgnutls30t64_3.8.9-2ubuntu2_armhf.deb ... 120s Unpacking libgnutls30t64:armhf (3.8.9-2ubuntu2) over (3.8.8-2ubuntu1) ... 120s Setting up libgnutls30t64:armhf (3.8.9-2ubuntu2) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60017 files and directories currently installed.) 120s Preparing to unpack .../libsasl2-modules-db_2.1.28+dfsg1-8build1_armhf.deb ... 120s Unpacking libsasl2-modules-db:armhf (2.1.28+dfsg1-8build1) over (2.1.28+dfsg1-8) ... 120s Preparing to unpack .../libsasl2-2_2.1.28+dfsg1-8build1_armhf.deb ... 120s Unpacking libsasl2-2:armhf (2.1.28+dfsg1-8build1) over (2.1.28+dfsg1-8) ... 120s Preparing to unpack .../libldap-common_2.6.9+dfsg-1~exp2ubuntu1_all.deb ... 120s Unpacking libldap-common (2.6.9+dfsg-1~exp2ubuntu1) over (2.6.8+dfsg-1~exp4ubuntu3) ... 120s Preparing to unpack .../libldap2_2.6.9+dfsg-1~exp2ubuntu1_armhf.deb ... 120s Unpacking libldap2:armhf (2.6.9+dfsg-1~exp2ubuntu1) over (2.6.8+dfsg-1~exp4ubuntu3) ... 120s Preparing to unpack .../gpgv_2.4.4-2ubuntu22_armhf.deb ... 120s Unpacking gpgv (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 120s Setting up gpgv (2.4.4-2ubuntu22) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60016 files and directories currently installed.) 120s Preparing to unpack .../0-e2fsprogs-l10n_1.47.2-1ubuntu1_all.deb ... 120s Unpacking e2fsprogs-l10n (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 120s Preparing to unpack .../1-logsave_1.47.2-1ubuntu1_armhf.deb ... 120s Unpacking logsave (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 121s Preparing to unpack .../2-ubuntu-minimal_1.547_armhf.deb ... 121s Unpacking ubuntu-minimal (1.547) over (1.544) ... 121s Preparing to unpack .../3-initramfs-tools_0.145ubuntu2_all.deb ... 121s Unpacking initramfs-tools (0.145ubuntu2) over (0.142ubuntu35) ... 121s Preparing to unpack .../4-initramfs-tools-core_0.145ubuntu2_all.deb ... 121s Unpacking initramfs-tools-core (0.145ubuntu2) over (0.142ubuntu35) ... 121s Preparing to unpack .../5-libext2fs2t64_1.47.2-1ubuntu1_armhf.deb ... 121s Leaving 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2 to /lib/arm-linux-gnueabihf/libe2p.so.2.usr-is-merged by libext2fs2t64' 121s Leaving 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2.3 to /lib/arm-linux-gnueabihf/libe2p.so.2.3.usr-is-merged by libext2fs2t64' 121s Leaving 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2 to /lib/arm-linux-gnueabihf/libext2fs.so.2.usr-is-merged by libext2fs2t64' 121s Leaving 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2.4 to /lib/arm-linux-gnueabihf/libext2fs.so.2.4.usr-is-merged by libext2fs2t64' 121s Unpacking libext2fs2t64:armhf (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 121s Setting up libext2fs2t64:armhf (1.47.2-1ubuntu1) ... 121s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60016 files and directories currently installed.) 121s Preparing to unpack .../e2fsprogs_1.47.2-1ubuntu1_armhf.deb ... 121s Unpacking e2fsprogs (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 121s Preparing to unpack .../dhcpcd-base_1%3a10.1.0-7_armhf.deb ... 121s Unpacking dhcpcd-base (1:10.1.0-7) over (1:10.1.0-2) ... 121s Setting up libapparmor1:armhf (4.1.0~beta5-0ubuntu5) ... 121s Setting up mount (2.40.2-14ubuntu1) ... 121s Setting up systemd (257.2-3ubuntu1) ... 121s Installing new version of config file /etc/systemd/logind.conf ... 121s Installing new version of config file /etc/systemd/sleep.conf ... 121s /usr/lib/tmpfiles.d/legacy.conf:14: Duplicate line for path "/run/lock", ignoring. 121s Created symlink '/run/systemd/system/tmp.mount' → '/dev/null'. 121s /usr/lib/tmpfiles.d/legacy.conf:14: Duplicate line for path "/run/lock", ignoring. 122s Setting up systemd-sysv (257.2-3ubuntu1) ... 122s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60015 files and directories currently installed.) 122s Preparing to unpack .../00-init_1.68_armhf.deb ... 122s Unpacking init (1.68) over (1.67ubuntu1) ... 122s Preparing to unpack .../01-libbpf1_1%3a1.5.0-2_armhf.deb ... 122s Unpacking libbpf1:armhf (1:1.5.0-2) over (1:1.5.0-1) ... 122s Preparing to unpack .../02-iptables_1.8.11-2ubuntu1_armhf.deb ... 122s Unpacking iptables (1.8.11-2ubuntu1) over (1.8.10-3ubuntu2) ... 122s Preparing to unpack .../03-libip4tc2_1.8.11-2ubuntu1_armhf.deb ... 122s Unpacking libip4tc2:armhf (1.8.11-2ubuntu1) over (1.8.10-3ubuntu2) ... 122s Preparing to unpack .../04-libip6tc2_1.8.11-2ubuntu1_armhf.deb ... 122s Unpacking libip6tc2:armhf (1.8.11-2ubuntu1) over (1.8.10-3ubuntu2) ... 122s Preparing to unpack .../05-libnftnl11_1.2.8-1_armhf.deb ... 122s Unpacking libnftnl11:armhf (1.2.8-1) over (1.2.7-1) ... 122s Preparing to unpack .../06-libxtables12_1.8.11-2ubuntu1_armhf.deb ... 122s Unpacking libxtables12:armhf (1.8.11-2ubuntu1) over (1.8.10-3ubuntu2) ... 122s Preparing to unpack .../07-iproute2_6.13.0-1ubuntu1_armhf.deb ... 122s Unpacking iproute2 (6.13.0-1ubuntu1) over (6.10.0-2ubuntu1) ... 122s Preparing to unpack .../08-iputils-ping_3%3a20240905-1ubuntu1_armhf.deb ... 122s Unpacking iputils-ping (3:20240905-1ubuntu1) over (3:20240117-1build1) ... 122s Preparing to unpack .../09-locales_2.40-4ubuntu1_all.deb ... 122s Unpacking locales (2.40-4ubuntu1) over (2.40-1ubuntu3) ... 123s Selecting previously unselected package login.defs. 123s Preparing to unpack .../10-login.defs_1%3a4.16.0-7ubuntu1_all.deb ... 123s Unpacking login.defs (1:4.16.0-7ubuntu1) ... 123s Replacing files in old package login (1:4.15.3-3ubuntu2) ... 123s Setting up login.defs (1:4.16.0-7ubuntu1) ... 123s Installing new version of config file /etc/login.defs ... 123s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60022 files and directories currently installed.) 123s Preparing to unpack .../0-login_1%3a4.16.0-2+really2.40.2-14ubuntu1_armhf.deb ... 123s Unpacking login (1:4.16.0-2+really2.40.2-14ubuntu1) over (1:4.15.3-3ubuntu2) ... 123s Preparing to unpack .../1-mawk_1.3.4.20250131-1_armhf.deb ... 123s Unpacking mawk (1.3.4.20250131-1) over (1.3.4.20240905-1) ... 123s Preparing to unpack .../2-netcat-openbsd_1.228-1_armhf.deb ... 123s Unpacking netcat-openbsd (1.228-1) over (1.226-1.1) ... 123s Selecting previously unselected package libpython3.13-minimal:armhf. 123s Preparing to unpack .../3-libpython3.13-minimal_3.13.2-1_armhf.deb ... 123s Unpacking libpython3.13-minimal:armhf (3.13.2-1) ... 123s Selecting previously unselected package python3.13-minimal. 123s Preparing to unpack .../4-python3.13-minimal_3.13.2-1_armhf.deb ... 123s Unpacking python3.13-minimal (3.13.2-1) ... 123s Preparing to unpack .../5-python3-cryptography_43.0.0-1_armhf.deb ... 123s Unpacking python3-cryptography (43.0.0-1) over (42.0.5-2build1) ... 123s Setting up libpython3.13-minimal:armhf (3.13.2-1) ... 123s Setting up python3.13-minimal (3.13.2-1) ... 124s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60304 files and directories currently installed.) 124s Preparing to unpack .../python3-minimal_3.13.1-1~exp2_armhf.deb ... 124s Unpacking python3-minimal (3.13.1-1~exp2) over (3.12.6-0ubuntu1) ... 124s Setting up python3-minimal (3.13.1-1~exp2) ... 125s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60304 files and directories currently installed.) 125s Preparing to unpack .../00-python3_3.13.1-1~exp2_armhf.deb ... 125s Unpacking python3 (3.13.1-1~exp2) over (3.12.6-0ubuntu1) ... 125s Selecting previously unselected package python3-bcrypt. 125s Preparing to unpack .../01-python3-bcrypt_4.2.0-2.1_armhf.deb ... 125s Unpacking python3-bcrypt (4.2.0-2.1) ... 125s Preparing to unpack .../02-tzdata_2025a-2ubuntu1_all.deb ... 125s Unpacking tzdata (2025a-2ubuntu1) over (2024b-1ubuntu2) ... 125s Selecting previously unselected package libpython3.13-stdlib:armhf. 125s Preparing to unpack .../03-libpython3.13-stdlib_3.13.2-1_armhf.deb ... 125s Unpacking libpython3.13-stdlib:armhf (3.13.2-1) ... 125s Selecting previously unselected package python3.13. 125s Preparing to unpack .../04-python3.13_3.13.2-1_armhf.deb ... 125s Unpacking python3.13 (3.13.2-1) ... 125s Preparing to unpack .../05-libpython3-stdlib_3.13.1-1~exp2_armhf.deb ... 125s Unpacking libpython3-stdlib:armhf (3.13.1-1~exp2) over (3.12.6-0ubuntu1) ... 125s Preparing to unpack .../06-gir1.2-girepository-2.0_1.82.0-4_armhf.deb ... 125s Unpacking gir1.2-girepository-2.0:armhf (1.82.0-4) over (1.82.0-2) ... 125s Preparing to unpack .../07-gir1.2-glib-2.0_2.83.3-2_armhf.deb ... 125s Unpacking gir1.2-glib-2.0:armhf (2.83.3-2) over (2.82.2-3) ... 125s Preparing to unpack .../08-libgirepository-1.0-1_1.82.0-4_armhf.deb ... 125s Unpacking libgirepository-1.0-1:armhf (1.82.0-4) over (1.82.0-2) ... 125s Preparing to unpack .../09-libglib2.0-data_2.83.3-2_all.deb ... 125s Unpacking libglib2.0-data (2.83.3-2) over (2.82.2-3) ... 125s Preparing to unpack .../10-libglib2.0-bin_2.83.3-2_armhf.deb ... 125s Unpacking libglib2.0-bin (2.83.3-2) over (2.82.2-3) ... 125s Preparing to unpack .../11-libatomic1_15-20250213-1ubuntu1_armhf.deb ... 125s Unpacking libatomic1:armhf (15-20250213-1ubuntu1) over (14.2.0-8ubuntu1) ... 125s Preparing to unpack .../12-libglib2.0-0t64_2.83.3-2_armhf.deb ... 125s Unpacking libglib2.0-0t64:armhf (2.83.3-2) over (2.82.2-3) ... 125s Preparing to unpack .../13-netplan-generator_1.1.2-2ubuntu1_armhf.deb ... 125s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 125s Unpacking netplan-generator (1.1.2-2ubuntu1) over (1.1.1-1) ... 125s Preparing to unpack .../14-libyaml-0-2_0.2.5-2_armhf.deb ... 125s Unpacking libyaml-0-2:armhf (0.2.5-2) over (0.2.5-1build1) ... 125s Preparing to unpack .../15-python3-netplan_1.1.2-2ubuntu1_armhf.deb ... 126s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 126s for fn in glob1(directory, "%s.*" % fname): 126s Unpacking python3-netplan (1.1.2-2ubuntu1) over (1.1.1-1) ... 126s Preparing to unpack .../16-netplan.io_1.1.2-2ubuntu1_armhf.deb ... 126s Unpacking netplan.io (1.1.2-2ubuntu1) over (1.1.1-1) ... 126s Preparing to unpack .../17-libnetplan1_1.1.2-2ubuntu1_armhf.deb ... 126s Unpacking libnetplan1:armhf (1.1.2-2ubuntu1) over (1.1.1-1) ... 126s Preparing to unpack .../18-ethtool_1%3a6.11-1_armhf.deb ... 126s Unpacking ethtool (1:6.11-1) over (1:6.10-1) ... 126s Preparing to unpack .../19-libsemanage-common_3.7-2.1_all.deb ... 126s Unpacking libsemanage-common (3.7-2.1) over (3.7-2build1) ... 126s Setting up libsemanage-common (3.7-2.1) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60727 files and directories currently installed.) 126s Preparing to unpack .../libsemanage2_3.7-2.1_armhf.deb ... 126s Unpacking libsemanage2:armhf (3.7-2.1) over (3.7-2build1) ... 126s Setting up libsemanage2:armhf (3.7-2.1) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60727 files and directories currently installed.) 126s Preparing to unpack .../passwd_1%3a4.16.0-7ubuntu1_armhf.deb ... 126s Unpacking passwd (1:4.16.0-7ubuntu1) over (1:4.15.3-3ubuntu2) ... 126s Setting up passwd (1:4.16.0-7ubuntu1) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60762 files and directories currently installed.) 126s Preparing to unpack .../000-ubuntu-pro-client-l10n_34.1.3_armhf.deb ... 126s Unpacking ubuntu-pro-client-l10n (34.1.3) over (34.1.2) ... 126s Preparing to unpack .../001-python-apt-common_2.9.9_all.deb ... 126s Unpacking python-apt-common (2.9.9) over (2.9.0ubuntu2) ... 126s Preparing to unpack .../002-python3-apt_2.9.9_armhf.deb ... 126s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 126s for fn in glob1(directory, "%s.*" % fname): 126s Unpacking python3-apt (2.9.9) over (2.9.0ubuntu2) ... 126s Preparing to unpack .../003-distro-info_1.13_armhf.deb ... 126s Unpacking distro-info (1.13) over (1.12) ... 126s Preparing to unpack .../004-ubuntu-pro-client_34.1.3_armhf.deb ... 126s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 126s for fn in glob1(directory, "%s.*" % fname): 127s Unpacking ubuntu-pro-client (34.1.3) over (34.1.2) ... 127s Preparing to unpack .../005-vim-tiny_2%3a9.1.0967-1ubuntu2_armhf.deb ... 127s Unpacking vim-tiny (2:9.1.0967-1ubuntu2) over (2:9.1.0861-1ubuntu1) ... 127s Preparing to unpack .../006-vim-common_2%3a9.1.0967-1ubuntu2_all.deb ... 127s Unpacking vim-common (2:9.1.0967-1ubuntu2) over (2:9.1.0861-1ubuntu1) ... 127s Preparing to unpack .../007-python3-newt_0.52.24-4ubuntu1_armhf.deb ... 127s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 127s for fn in glob1(directory, "%s.*" % fname): 127s Unpacking python3-newt:armhf (0.52.24-4ubuntu1) over (0.52.24-2ubuntu4) ... 127s Preparing to unpack .../008-libnewt0.52_0.52.24-4ubuntu1_armhf.deb ... 127s Unpacking libnewt0.52:armhf (0.52.24-4ubuntu1) over (0.52.24-2ubuntu4) ... 127s Preparing to unpack .../009-whiptail_0.52.24-4ubuntu1_armhf.deb ... 127s Unpacking whiptail (0.52.24-4ubuntu1) over (0.52.24-2ubuntu4) ... 127s Preparing to unpack .../010-dracut-install_106-2ubuntu1_armhf.deb ... 127s Unpacking dracut-install (106-2ubuntu1) over (105-2ubuntu3) ... 127s Preparing to unpack .../011-initramfs-tools-bin_0.145ubuntu2_armhf.deb ... 127s Unpacking initramfs-tools-bin (0.145ubuntu2) over (0.142ubuntu35) ... 127s Preparing to unpack .../012-busybox-initramfs_1%3a1.37.0-4ubuntu1_armhf.deb ... 127s Unpacking busybox-initramfs (1:1.37.0-4ubuntu1) over (1:1.36.1-9ubuntu1) ... 127s Preparing to unpack .../013-python3.12_3.12.9-1_armhf.deb ... 127s Unpacking python3.12 (3.12.9-1) over (3.12.7-3) ... 127s Preparing to unpack .../014-libpython3.12-stdlib_3.12.9-1_armhf.deb ... 127s Unpacking libpython3.12-stdlib:armhf (3.12.9-1) over (3.12.7-3) ... 128s Preparing to unpack .../015-python3.12-minimal_3.12.9-1_armhf.deb ... 128s Unpacking python3.12-minimal (3.12.9-1) over (3.12.7-3) ... 128s Preparing to unpack .../016-libpython3.12-minimal_3.12.9-1_armhf.deb ... 128s Unpacking libpython3.12-minimal:armhf (3.12.9-1) over (3.12.7-3) ... 128s Preparing to unpack .../017-cron_3.0pl1-192ubuntu1_armhf.deb ... 128s Unpacking cron (3.0pl1-192ubuntu1) over (3.0pl1-189ubuntu1) ... 128s Preparing to unpack .../018-rsync_3.4.1-0syncable1_armhf.deb ... 128s Unpacking rsync (3.4.1-0syncable1) over (3.3.0-1) ... 128s Preparing to unpack .../019-python3-lazr.uri_1.0.6-5_all.deb ... 128s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 128s for fn in glob1(directory, "%s.*" % fname): 128s Unpacking python3-lazr.uri (1.0.6-5) over (1.0.6-4) ... 128s Preparing to unpack .../020-python3-launchpadlib_2.1.0-1_all.deb ... 128s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 128s for fn in glob1(directory, "%s.*" % fname): 128s Unpacking python3-launchpadlib (2.1.0-1) over (2.0.0-1) ... 128s Preparing to unpack .../021-python3-problem-report_2.31.0+git20250220-0ubuntu1_all.deb ... 128s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 128s for fn in glob1(directory, "%s.*" % fname): 128s Unpacking python3-problem-report (2.31.0+git20250220-0ubuntu1) over (2.30.0-0ubuntu5) ... 128s Preparing to unpack .../022-python3-apport_2.31.0+git20250220-0ubuntu1_all.deb ... 128s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 128s for fn in glob1(directory, "%s.*" % fname): 128s Unpacking python3-apport (2.31.0+git20250220-0ubuntu1) over (2.30.0-0ubuntu5) ... 128s Preparing to unpack .../023-python3-gi_3.50.0-4_armhf.deb ... 128s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 128s for fn in glob1(directory, "%s.*" % fname): 128s Unpacking python3-gi (3.50.0-4) over (3.50.0-3build1) ... 129s Preparing to unpack .../024-apport-core-dump-handler_2.31.0+git20250220-0ubuntu1_all.deb ... 129s Unpacking apport-core-dump-handler (2.31.0+git20250220-0ubuntu1) over (2.30.0-0ubuntu5) ... 129s Preparing to unpack .../025-apport_2.31.0+git20250220-0ubuntu1_all.deb ... 129s Unpacking apport (2.31.0+git20250220-0ubuntu1) over (2.30.0-0ubuntu5) ... 129s Preparing to unpack .../026-gcc-14-base_14.2.0-17ubuntu3_armhf.deb ... 129s Unpacking gcc-14-base:armhf (14.2.0-17ubuntu3) over (14.2.0-8ubuntu1) ... 129s Preparing to unpack .../027-libcom-err2_1.47.2-1ubuntu1_armhf.deb ... 129s Unpacking libcom-err2:armhf (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 129s Preparing to unpack .../028-libss2_1.47.2-1ubuntu1_armhf.deb ... 129s Unpacking libss2:armhf (1.47.2-1ubuntu1) over (1.47.1-1ubuntu1) ... 129s Preparing to unpack .../029-openssl_3.4.1-1ubuntu1_armhf.deb ... 129s Unpacking openssl (3.4.1-1ubuntu1) over (3.3.1-2ubuntu2) ... 129s Preparing to unpack .../030-ca-certificates_20241223_all.deb ... 129s Unpacking ca-certificates (20241223) over (20240203) ... 129s Preparing to unpack .../031-krb5-locales_1.21.3-4ubuntu1_all.deb ... 129s Unpacking krb5-locales (1.21.3-4ubuntu1) over (1.21.3-3) ... 129s Preparing to unpack .../032-libfribidi0_1.0.16-1_armhf.deb ... 129s Unpacking libfribidi0:armhf (1.0.16-1) over (1.0.15-1) ... 129s Preparing to unpack .../033-libgssapi-krb5-2_1.21.3-4ubuntu1_armhf.deb ... 129s Unpacking libgssapi-krb5-2:armhf (1.21.3-4ubuntu1) over (1.21.3-3) ... 129s Preparing to unpack .../034-libkrb5-3_1.21.3-4ubuntu1_armhf.deb ... 129s Unpacking libkrb5-3:armhf (1.21.3-4ubuntu1) over (1.21.3-3) ... 129s Preparing to unpack .../035-libkrb5support0_1.21.3-4ubuntu1_armhf.deb ... 129s Unpacking libkrb5support0:armhf (1.21.3-4ubuntu1) over (1.21.3-3) ... 129s Preparing to unpack .../036-libk5crypto3_1.21.3-4ubuntu1_armhf.deb ... 129s Unpacking libk5crypto3:armhf (1.21.3-4ubuntu1) over (1.21.3-3) ... 129s Preparing to unpack .../037-libicu74_74.2-1ubuntu6_armhf.deb ... 129s Unpacking libicu74:armhf (74.2-1ubuntu6) over (74.2-1ubuntu4) ... 129s Preparing to unpack .../038-libxml2_2.12.7+dfsg+really2.9.14-0.2ubuntu3_armhf.deb ... 129s Unpacking libxml2:armhf (2.12.7+dfsg+really2.9.14-0.2ubuntu3) over (2.12.7+dfsg-3) ... 129s Preparing to unpack .../039-python3-pygments_2.18.0+dfsg-2_all.deb ... 130s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 130s for fn in glob1(directory, "%s.*" % fname): 130s Unpacking python3-pygments (2.18.0+dfsg-2) over (2.18.0+dfsg-1ubuntu1) ... 130s Preparing to unpack .../040-python3-rich_13.9.4-1_all.deb ... 130s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 130s for fn in glob1(directory, "%s.*" % fname): 130s Unpacking python3-rich (13.9.4-1) over (13.7.1-1) ... 130s Preparing to unpack .../041-ucf_3.0050_all.deb ... 130s Unpacking ucf (3.0050) over (3.0043+nmu1) ... 130s Preparing to unpack .../042-rsyslog_8.2412.0-2ubuntu1_armhf.deb ... 130s Unpacking rsyslog (8.2412.0-2ubuntu1) over (8.2406.0-1ubuntu2) ... 130s Preparing to unpack .../043-xxd_2%3a9.1.0967-1ubuntu2_armhf.deb ... 130s Unpacking xxd (2:9.1.0967-1ubuntu2) over (2:9.1.0861-1ubuntu1) ... 130s Preparing to unpack .../044-apparmor_4.1.0~beta5-0ubuntu5_armhf.deb ... 131s Unpacking apparmor (4.1.0~beta5-0ubuntu5) over (4.1.0~beta1-0ubuntu4) ... 131s dpkg: warning: unable to delete old directory '/lib/apparmor': Directory not empty 131s Preparing to unpack .../045-bash-completion_1%3a2.16.0-7_all.deb ... 131s Unpacking bash-completion (1:2.16.0-7) over (1:2.14.0-2) ... 132s Selecting previously unselected package libjemalloc2:armhf. 132s Preparing to unpack .../046-libjemalloc2_5.3.0-2build1_armhf.deb ... 132s Unpacking libjemalloc2:armhf (5.3.0-2build1) ... 132s Preparing to unpack .../047-libmaxminddb0_1.12.2-1_armhf.deb ... 132s Unpacking libmaxminddb0:armhf (1.12.2-1) over (1.11.0-1) ... 132s Preparing to unpack .../048-liburcu8t64_0.15.1-1_armhf.deb ... 132s Unpacking liburcu8t64:armhf (0.15.1-1) over (0.14.1-1) ... 132s Preparing to unpack .../049-bind9-dnsutils_1%3a9.20.4-3ubuntu1_armhf.deb ... 132s Unpacking bind9-dnsutils (1:9.20.4-3ubuntu1) over (1:9.20.0-2ubuntu3) ... 132s Preparing to unpack .../050-bind9-host_1%3a9.20.4-3ubuntu1_armhf.deb ... 132s Unpacking bind9-host (1:9.20.4-3ubuntu1) over (1:9.20.0-2ubuntu3) ... 132s Preparing to unpack .../051-bind9-libs_1%3a9.20.4-3ubuntu1_armhf.deb ... 132s Unpacking bind9-libs:armhf (1:9.20.4-3ubuntu1) over (1:9.20.0-2ubuntu3) ... 132s Preparing to unpack .../052-libedit2_3.1-20250104-1_armhf.deb ... 132s Unpacking libedit2:armhf (3.1-20250104-1) over (3.1-20240808-1) ... 132s Preparing to unpack .../053-busybox-static_1%3a1.37.0-4ubuntu1_armhf.deb ... 132s Unpacking busybox-static (1:1.37.0-4ubuntu1) over (1:1.36.1-9ubuntu1) ... 132s Preparing to unpack .../054-cron-daemon-common_3.0pl1-192ubuntu1_all.deb ... 132s Unpacking cron-daemon-common (3.0pl1-192ubuntu1) over (3.0pl1-189ubuntu1) ... 132s Preparing to unpack .../055-dmsetup_2%3a1.02.201-1ubuntu1_armhf.deb ... 132s Unpacking dmsetup (2:1.02.201-1ubuntu1) over (2:1.02.196-1ubuntu2) ... 132s Preparing to unpack .../056-ed_1.21-1_armhf.deb ... 132s Unpacking ed (1.21-1) over (1.20.2-2) ... 132s Preparing to unpack .../057-gettext-base_0.23.1-1_armhf.deb ... 132s Unpacking gettext-base (0.23.1-1) over (0.22.5-2) ... 132s Preparing to unpack .../058-groff-base_1.23.0-7_armhf.deb ... 132s Unpacking groff-base (1.23.0-7) over (1.23.0-5) ... 132s Preparing to unpack .../059-libibverbs1_55.0-1ubuntu1_armhf.deb ... 132s Unpacking libibverbs1:armhf (55.0-1ubuntu1) over (52.0-2ubuntu1) ... 132s Preparing to unpack .../060-ibverbs-providers_55.0-1ubuntu1_armhf.deb ... 132s Unpacking ibverbs-providers:armhf (55.0-1ubuntu1) over (52.0-2ubuntu1) ... 132s Preparing to unpack .../061-inetutils-telnet_2%3a2.5-6ubuntu1_armhf.deb ... 132s Unpacking inetutils-telnet (2:2.5-6ubuntu1) over (2:2.5-5ubuntu1) ... 133s Preparing to unpack .../062-iputils-tracepath_3%3a20240905-1ubuntu1_armhf.deb ... 133s Unpacking iputils-tracepath (3:20240905-1ubuntu1) over (3:20240117-1build1) ... 133s Preparing to unpack .../063-libcbor0.10_0.10.2-2ubuntu1_armhf.deb ... 133s Unpacking libcbor0.10:armhf (0.10.2-2ubuntu1) over (0.10.2-1.2ubuntu2) ... 133s Preparing to unpack .../064-nftables_1.1.1-1build1_armhf.deb ... 133s Unpacking nftables (1.1.1-1build1) over (1.1.0-2) ... 133s Preparing to unpack .../065-libnftables1_1.1.1-1build1_armhf.deb ... 133s Unpacking libnftables1:armhf (1.1.1-1build1) over (1.1.0-2) ... 133s Preparing to unpack .../066-libpcap0.8t64_1.10.5-2ubuntu1_armhf.deb ... 133s Unpacking libpcap0.8t64:armhf (1.10.5-2ubuntu1) over (1.10.5-1ubuntu1) ... 133s Preparing to unpack .../067-libpng16-16t64_1.6.46-4_armhf.deb ... 133s Unpacking libpng16-16t64:armhf (1.6.46-4) over (1.6.44-2) ... 133s Preparing to unpack .../068-libxkbcommon0_1.7.0-2_armhf.deb ... 133s Unpacking libxkbcommon0:armhf (1.7.0-2) over (1.7.0-1) ... 133s Preparing to unpack .../069-libplymouth5_24.004.60-2ubuntu5_armhf.deb ... 133s Unpacking libplymouth5:armhf (24.004.60-2ubuntu5) over (24.004.60-2ubuntu4) ... 133s Preparing to unpack .../070-libtraceevent1-plugin_1%3a1.8.4-2_armhf.deb ... 133s Unpacking libtraceevent1-plugin:armhf (1:1.8.4-2) over (1:1.8.4-1) ... 133s Preparing to unpack .../071-libtraceevent1_1%3a1.8.4-2_armhf.deb ... 133s Unpacking libtraceevent1:armhf (1:1.8.4-2) over (1:1.8.4-1) ... 133s Preparing to unpack .../072-libusb-1.0-0_2%3a1.0.27-2_armhf.deb ... 133s Unpacking libusb-1.0-0:armhf (2:1.0.27-2) over (2:1.0.27-1) ... 133s Preparing to unpack .../073-libxdmcp6_1%3a1.1.5-1_armhf.deb ... 133s Unpacking libxdmcp6:armhf (1:1.1.5-1) over (1:1.1.3-0ubuntu6) ... 133s Preparing to unpack .../074-lshw_02.19.git.2021.06.19.996aaad9c7-2.1ubuntu1_armhf.deb ... 133s Unpacking lshw (02.19.git.2021.06.19.996aaad9c7-2.1ubuntu1) over (02.19.git.2021.06.19.996aaad9c7-2ubuntu2) ... 133s Preparing to unpack .../075-lsof_4.99.4+dfsg-2_armhf.deb ... 133s Unpacking lsof (4.99.4+dfsg-2) over (4.99.3+dfsg-2) ... 133s Preparing to unpack .../076-liblsof0_4.99.4+dfsg-2_armhf.deb ... 133s Unpacking liblsof0 (4.99.4+dfsg-2) over (4.99.3+dfsg-2) ... 133s Preparing to unpack .../077-nano_8.3-1_armhf.deb ... 133s Unpacking nano (8.3-1) over (8.2-1) ... 133s Preparing to unpack .../078-pci.ids_0.0~2025.02.12-1_all.deb ... 133s Unpacking pci.ids (0.0~2025.02.12-1) over (0.0~2024.10.24-1) ... 133s Preparing to unpack .../079-plymouth-theme-ubuntu-text_24.004.60-2ubuntu5_armhf.deb ... 133s Unpacking plymouth-theme-ubuntu-text (24.004.60-2ubuntu5) over (24.004.60-2ubuntu4) ... 133s Preparing to unpack .../080-libpackagekit-glib2-18_1.3.0-3build1_armhf.deb ... 133s Unpacking libpackagekit-glib2-18:armhf (1.3.0-3build1) over (1.3.0-2) ... 133s Preparing to unpack .../081-packagekit-tools_1.3.0-3build1_armhf.deb ... 133s Unpacking packagekit-tools (1.3.0-3build1) over (1.3.0-2) ... 133s Preparing to unpack .../082-polkitd_126-2_armhf.deb ... 134s Unpacking polkitd (126-2) over (125-2ubuntu1) ... 134s Preparing to unpack .../083-libpolkit-agent-1-0_126-2_armhf.deb ... 134s Unpacking libpolkit-agent-1-0:armhf (126-2) over (125-2ubuntu1) ... 134s Preparing to unpack .../084-libpolkit-gobject-1-0_126-2_armhf.deb ... 134s Unpacking libpolkit-gobject-1-0:armhf (126-2) over (125-2ubuntu1) ... 134s Preparing to unpack .../085-libcurl3t64-gnutls_8.12.1-2ubuntu1_armhf.deb ... 134s Unpacking libcurl3t64-gnutls:armhf (8.12.1-2ubuntu1) over (8.11.0-1ubuntu2) ... 134s Preparing to unpack .../086-libappstream5_1.0.4-1_armhf.deb ... 134s Unpacking libappstream5:armhf (1.0.4-1) over (1.0.3-1) ... 134s Preparing to unpack .../087-libgstreamer1.0-0_1.25.50-1_armhf.deb ... 134s Unpacking libgstreamer1.0-0:armhf (1.25.50-1) over (1.24.9-1) ... 134s Preparing to unpack .../088-packagekit_1.3.0-3build1_armhf.deb ... 134s Unpacking packagekit (1.3.0-3build1) over (1.3.0-2) ... 134s Preparing to unpack .../089-plymouth_24.004.60-2ubuntu5_armhf.deb ... 134s Unpacking plymouth (24.004.60-2ubuntu5) over (24.004.60-2ubuntu4) ... 134s Preparing to unpack .../090-powermgmt-base_1.38_all.deb ... 134s Unpacking powermgmt-base (1.38) over (1.37+nmu1ubuntu1) ... 134s Preparing to unpack .../091-psmisc_23.7-2_armhf.deb ... 134s Unpacking psmisc (23.7-2) over (23.7-1build1) ... 134s Preparing to unpack .../092-publicsuffix_20250108.1153-0.1_all.deb ... 134s Unpacking publicsuffix (20250108.1153-0.1) over (20231001.0357-0.1) ... 134s Preparing to unpack .../093-python3-distro-info_1.13_all.deb ... 134s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 134s for fn in glob1(directory, "%s.*" % fname): 134s Unpacking python3-distro-info (1.13) over (1.12) ... 134s Preparing to unpack .../094-python3.13-gdbm_3.13.2-1_armhf.deb ... 134s Unpacking python3.13-gdbm (3.13.2-1) over (3.13.0-2) ... 134s Preparing to unpack .../095-python3.12-gdbm_3.12.9-1_armhf.deb ... 134s Unpacking python3.12-gdbm (3.12.9-1) over (3.12.7-3) ... 134s Preparing to unpack .../096-python3-gdbm_3.13.1-1_armhf.deb ... 134s Unpacking python3-gdbm:armhf (3.13.1-1) over (3.12.7-1) ... 134s Preparing to unpack .../097-telnet_0.17+2.5-6ubuntu1_all.deb ... 134s Unpacking telnet (0.17+2.5-6ubuntu1) over (0.17+2.5-5ubuntu1) ... 134s Preparing to unpack .../098-ubuntu-standard_1.547_armhf.deb ... 134s Unpacking ubuntu-standard (1.547) over (1.544) ... 134s Preparing to unpack .../099-ufw_0.36.2-9_all.deb ... 135s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 135s for fn in glob1(directory, "%s.*" % fname): 135s Unpacking ufw (0.36.2-9) over (0.36.2-8) ... 135s Preparing to unpack .../100-usb.ids_2025.01.14-1_all.deb ... 135s Unpacking usb.ids (2025.01.14-1) over (2024.07.04-1) ... 135s Preparing to unpack .../101-xauth_1%3a1.1.2-1.1_armhf.deb ... 135s Unpacking xauth (1:1.1.2-1.1) over (1:1.1.2-1build1) ... 135s Preparing to unpack .../102-appstream_1.0.4-1_armhf.deb ... 135s Unpacking appstream (1.0.4-1) over (1.0.3-1) ... 135s Preparing to unpack .../103-libctf0_2.44-2ubuntu1_armhf.deb ... 135s Unpacking libctf0:armhf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../104-libctf-nobfd0_2.44-2ubuntu1_armhf.deb ... 135s Unpacking libctf-nobfd0:armhf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../105-binutils-arm-linux-gnueabihf_2.44-2ubuntu1_armhf.deb ... 135s Unpacking binutils-arm-linux-gnueabihf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../106-libbinutils_2.44-2ubuntu1_armhf.deb ... 135s Unpacking libbinutils:armhf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../107-binutils_2.44-2ubuntu1_armhf.deb ... 135s Unpacking binutils (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../108-binutils-common_2.44-2ubuntu1_armhf.deb ... 135s Unpacking binutils-common:armhf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../109-libsframe1_2.44-2ubuntu1_armhf.deb ... 135s Unpacking libsframe1:armhf (2.44-2ubuntu1) over (2.43.1-4ubuntu1) ... 135s Preparing to unpack .../110-btrfs-progs_6.12-1build1_armhf.deb ... 135s Unpacking btrfs-progs (6.12-1build1) over (6.6.3-1.2) ... 135s Preparing to unpack .../111-python3-certifi_2025.1.31+ds-1_all.deb ... 135s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 135s for fn in glob1(directory, "%s.*" % fname): 135s Unpacking python3-certifi (2025.1.31+ds-1) over (2024.8.30+dfsg-1) ... 135s Preparing to unpack .../112-python3-chardet_5.2.0+dfsg-2_all.deb ... 135s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 135s for fn in glob1(directory, "%s.*" % fname): 135s Unpacking python3-chardet (5.2.0+dfsg-2) over (5.2.0+dfsg-1) ... 135s Preparing to unpack .../113-python3-idna_3.10-1_all.deb ... 135s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 135s for fn in glob1(directory, "%s.*" % fname): 135s Unpacking python3-idna (3.10-1) over (3.8-2) ... 136s Preparing to unpack .../114-python3-urllib3_2.3.0-1_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-urllib3 (2.3.0-1) over (2.0.7-2ubuntu0.1) ... 136s Preparing to unpack .../115-python3-requests_2.32.3+dfsg-4ubuntu1_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-requests (2.32.3+dfsg-4ubuntu1) over (2.32.3+dfsg-1ubuntu1) ... 136s Preparing to unpack .../116-python3-jinja2_3.1.5-2_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-jinja2 (3.1.5-2) over (3.1.3-1ubuntu1) ... 136s Preparing to unpack .../117-python3-json-pointer_2.4-3_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-json-pointer (2.4-3) over (2.4-2) ... 136s Preparing to unpack .../118-python3-jsonpatch_1.32-5_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-jsonpatch (1.32-5) over (1.32-4) ... 136s Preparing to unpack .../119-python3-attr_25.1.0-1_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-attr (25.1.0-1) over (23.2.0-2) ... 136s Preparing to unpack .../120-python3-referencing_0.35.1-2ubuntu1_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-referencing (0.35.1-2ubuntu1) over (0.35.1-1ubuntu1) ... 136s Preparing to unpack .../121-python3-jsonschema_4.19.2-6ubuntu1_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 136s Unpacking python3-jsonschema (4.19.2-6ubuntu1) over (4.19.2-3ubuntu1) ... 136s Preparing to unpack .../122-python3-jwt_2.10.1-2_all.deb ... 136s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 136s for fn in glob1(directory, "%s.*" % fname): 137s Unpacking python3-jwt (2.10.1-2) over (2.7.0-1) ... 137s Preparing to unpack .../123-python3-oauthlib_3.2.2-3_all.deb ... 137s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 137s for fn in glob1(directory, "%s.*" % fname): 137s Unpacking python3-oauthlib (3.2.2-3) over (3.2.2-2) ... 137s Preparing to unpack .../124-cloud-init-base_25.1-0ubuntu1_all.deb ... 137s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 137s for fn in glob1(directory, "%s.*" % fname): 137s Unpacking cloud-init-base (25.1-0ubuntu1) over (24.4-0ubuntu1) ... 137s dpkg: warning: unable to delete old directory '/lib/systemd/system/sshd-keygen@.service.d': Directory not empty 137s Preparing to unpack .../125-cryptsetup-bin_2%3a2.7.5-1ubuntu2_armhf.deb ... 137s Unpacking cryptsetup-bin (2:2.7.5-1ubuntu2) over (2:2.7.2-2ubuntu1) ... 137s Preparing to unpack .../126-curl_8.12.1-2ubuntu1_armhf.deb ... 137s Unpacking curl (8.12.1-2ubuntu1) over (8.11.0-1ubuntu2) ... 137s Preparing to unpack .../127-libcurl4t64_8.12.1-2ubuntu1_armhf.deb ... 137s Unpacking libcurl4t64:armhf (8.12.1-2ubuntu1) over (8.11.0-1ubuntu2) ... 137s Preparing to unpack .../128-dpkg-dev_1.22.11ubuntu4_all.deb ... 137s Unpacking dpkg-dev (1.22.11ubuntu4) over (1.22.11ubuntu3) ... 137s Preparing to unpack .../129-libdpkg-perl_1.22.11ubuntu4_all.deb ... 137s Unpacking libdpkg-perl (1.22.11ubuntu4) over (1.22.11ubuntu3) ... 137s Preparing to unpack .../130-make_4.4.1-1_armhf.deb ... 137s Unpacking make (4.4.1-1) over (4.3-4.1build2) ... 138s Preparing to unpack .../131-lto-disabled-list_56_all.deb ... 138s Unpacking lto-disabled-list (56) over (54) ... 138s Preparing to unpack .../132-libarchive13t64_3.7.7-0ubuntu1_armhf.deb ... 138s Unpacking libarchive13t64:armhf (3.7.7-0ubuntu1) over (3.7.4-1.1) ... 138s Preparing to unpack .../133-libjson-glib-1.0-common_1.10.6+ds-1_all.deb ... 138s Unpacking libjson-glib-1.0-common (1.10.6+ds-1) over (1.10.0+ds-3) ... 138s Preparing to unpack .../134-libjson-glib-1.0-0_1.10.6+ds-1_armhf.deb ... 138s Unpacking libjson-glib-1.0-0:armhf (1.10.6+ds-1) over (1.10.0+ds-3) ... 138s Preparing to unpack .../135-fwupd_2.0.6-3_armhf.deb ... 138s Unpacking fwupd (2.0.6-3) over (2.0.2-1) ... 138s Preparing to unpack .../136-libfwupd3_2.0.6-3_armhf.deb ... 138s Unpacking libfwupd3:armhf (2.0.6-3) over (2.0.2-1) ... 138s Preparing to unpack .../137-libprotobuf-c1_1.5.1-1ubuntu1_armhf.deb ... 138s Unpacking libprotobuf-c1:armhf (1.5.1-1ubuntu1) over (1.4.1-1ubuntu4) ... 138s Preparing to unpack .../138-libqmi-proxy_1.35.6-1_armhf.deb ... 138s Unpacking libqmi-proxy (1.35.6-1) over (1.35.2-0ubuntu2) ... 138s Preparing to unpack .../139-libqmi-glib5_1.35.6-1_armhf.deb ... 138s Unpacking libqmi-glib5:armhf (1.35.6-1) over (1.35.2-0ubuntu2) ... 138s Preparing to unpack .../140-gir1.2-packagekitglib-1.0_1.3.0-3build1_armhf.deb ... 138s Unpacking gir1.2-packagekitglib-1.0 (1.3.0-3build1) over (1.3.0-2) ... 138s Preparing to unpack .../141-gnupg-l10n_2.4.4-2ubuntu22_all.deb ... 138s Unpacking gnupg-l10n (2.4.4-2ubuntu22) over (2.4.4-2ubuntu18) ... 138s Preparing to unpack .../142-htop_3.3.0-5_armhf.deb ... 138s Unpacking htop (3.3.0-5) over (3.3.0-4build1) ... 138s Preparing to unpack .../143-libblockdev-utils3_3.3.0-1_armhf.deb ... 138s Unpacking libblockdev-utils3:armhf (3.3.0-1) over (3.2.1-1) ... 138s Preparing to unpack .../144-libnspr4_2%3a4.36-1ubuntu1_armhf.deb ... 138s Unpacking libnspr4:armhf (2:4.36-1ubuntu1) over (2:4.35-1.1ubuntu2) ... 138s Preparing to unpack .../145-libnss3_2%3a3.108-1ubuntu1_armhf.deb ... 138s Unpacking libnss3:armhf (2:3.108-1ubuntu1) over (2:3.103-1) ... 138s Preparing to unpack .../146-libgpgme11t64_1.24.2-1ubuntu1_armhf.deb ... 138s Unpacking libgpgme11t64:armhf (1.24.2-1ubuntu1) over (1.24.0-2ubuntu1) ... 138s Preparing to unpack .../147-libvolume-key1_0.3.12-9_armhf.deb ... 138s Unpacking libvolume-key1:armhf (0.3.12-9) over (0.3.12-8) ... 138s Preparing to unpack .../148-libblockdev-crypto3_3.3.0-1_armhf.deb ... 138s Unpacking libblockdev-crypto3:armhf (3.3.0-1) over (3.2.1-1) ... 138s Preparing to unpack .../149-libblockdev-fs3_3.3.0-1_armhf.deb ... 138s Unpacking libblockdev-fs3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../150-libblockdev-loop3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev-loop3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../151-libblockdev-mdraid3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev-mdraid3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../152-libnvme1t64_1.11.1-2_armhf.deb ... 139s Unpacking libnvme1t64 (1.11.1-2) over (1.11.1-1) ... 139s Preparing to unpack .../153-libblockdev-nvme3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev-nvme3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../154-libblockdev-part3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev-part3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../155-libblockdev-swap3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev-swap3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../156-libblockdev3_3.3.0-1_armhf.deb ... 139s Unpacking libblockdev3:armhf (3.3.0-1) over (3.2.1-1) ... 139s Preparing to unpack .../157-libftdi1-2_1.5-8_armhf.deb ... 139s Unpacking libftdi1-2:armhf (1.5-8) over (1.5-7build1) ... 139s Preparing to unpack .../158-libgudev-1.0-0_1%3a238-6_armhf.deb ... 139s Unpacking libgudev-1.0-0:armhf (1:238-6) over (1:238-5ubuntu1) ... 139s Selecting previously unselected package libicu76:armhf. 139s Preparing to unpack .../159-libicu76_76.1-1ubuntu2_armhf.deb ... 139s Unpacking libicu76:armhf (76.1-1ubuntu2) ... 139s Preparing to unpack .../160-libsasl2-modules_2.1.28+dfsg1-8build1_armhf.deb ... 139s Unpacking libsasl2-modules:armhf (2.1.28+dfsg1-8build1) over (2.1.28+dfsg1-8) ... 139s Preparing to unpack .../161-udisks2_2.10.1-11ubuntu2_armhf.deb ... 139s Unpacking udisks2 (2.10.1-11ubuntu2) over (2.10.1-11ubuntu1) ... 139s Preparing to unpack .../162-libudisks2-0_2.10.1-11ubuntu2_armhf.deb ... 139s Unpacking libudisks2-0:armhf (2.10.1-11ubuntu2) over (2.10.1-11ubuntu1) ... 139s Preparing to unpack .../163-libwrap0_7.6.q-35_armhf.deb ... 139s Unpacking libwrap0:armhf (7.6.q-35) over (7.6.q-33) ... 139s Selecting previously unselected package linux-headers-6.12.0-15. 139s Preparing to unpack .../164-linux-headers-6.12.0-15_6.12.0-15.15_all.deb ... 139s Unpacking linux-headers-6.12.0-15 (6.12.0-15.15) ... 142s Selecting previously unselected package linux-headers-6.12.0-15-generic. 142s Preparing to unpack .../165-linux-headers-6.12.0-15-generic_6.12.0-15.15_armhf.deb ... 142s Unpacking linux-headers-6.12.0-15-generic (6.12.0-15.15) ... 143s Preparing to unpack .../166-linux-headers-generic_6.12.0-15.15+1_armhf.deb ... 143s Unpacking linux-headers-generic (6.12.0-15.15+1) over (6.11.0-8.8) ... 143s Preparing to unpack .../167-pollinate_4.33-4ubuntu2_all.deb ... 143s Unpacking pollinate (4.33-4ubuntu2) over (4.33-4ubuntu1) ... 143s Preparing to unpack .../168-python3-babel_2.17.0-1_all.deb ... 143s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 143s for fn in glob1(directory, "%s.*" % fname): 143s Unpacking python3-babel (2.17.0-1) over (2.16.0-1) ... 144s Preparing to unpack .../169-python-babel-localedata_2.17.0-1_all.deb ... 144s Unpacking python-babel-localedata (2.17.0-1) over (2.16.0-1) ... 144s Preparing to unpack .../170-python3-more-itertools_10.6.0-1_all.deb ... 144s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 144s for fn in glob1(directory, "%s.*" % fname): 144s Unpacking python3-more-itertools (10.6.0-1) over (10.5.0-1) ... 144s Preparing to unpack .../171-python3-openssl_25.0.0-1_all.deb ... 144s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 144s for fn in glob1(directory, "%s.*" % fname): 144s Unpacking python3-openssl (25.0.0-1) over (24.2.1-1) ... 144s Preparing to unpack .../172-python3-pkg-resources_75.6.0-1_all.deb ... 144s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 144s for fn in glob1(directory, "%s.*" % fname): 144s Unpacking python3-pkg-resources (75.6.0-1) over (75.2.0-1) ... 144s Preparing to unpack .../173-python3-setuptools_75.6.0-1_all.deb ... 144s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 144s for fn in glob1(directory, "%s.*" % fname): 145s Unpacking python3-setuptools (75.6.0-1) over (75.2.0-1) ... 145s Preparing to unpack .../174-software-properties-common_0.109_all.deb ... 145s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 145s for fn in glob1(directory, "%s.*" % fname): 145s Unpacking software-properties-common (0.109) over (0.105) ... 145s Preparing to unpack .../175-python3-software-properties_0.109_all.deb ... 145s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 145s for fn in glob1(directory, "%s.*" % fname): 145s Unpacking python3-software-properties (0.109) over (0.105) ... 145s Preparing to unpack .../176-python3-wadllib_2.0.0-2_all.deb ... 145s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 145s for fn in glob1(directory, "%s.*" % fname): 145s Unpacking python3-wadllib (2.0.0-2) over (2.0.0-1) ... 145s Preparing to unpack .../177-tmux_3.5a-3_armhf.deb ... 145s Unpacking tmux (3.5a-3) over (3.4-7) ... 145s Preparing to unpack .../178-unattended-upgrades_2.12ubuntu4_all.deb ... 145s Unpacking unattended-upgrades (2.12ubuntu4) over (2.9.1+nmu4ubuntu1) ... 145s dpkg: warning: unable to delete old directory '/lib/systemd/system-sleep': Directory not empty 145s Preparing to unpack .../179-xfsprogs_6.12.0-1ubuntu1_armhf.deb ... 145s Unpacking xfsprogs (6.12.0-1ubuntu1) over (6.8.0-2.2ubuntu2) ... 145s Preparing to unpack .../180-zstd_1.5.6+dfsg-2_armhf.deb ... 145s Unpacking zstd (1.5.6+dfsg-2) over (1.5.6+dfsg-1) ... 145s Preparing to unpack .../181-cloud-init_25.1-0ubuntu1_all.deb ... 145s Unpacking cloud-init (25.1-0ubuntu1) over (24.4-0ubuntu1) ... 145s Preparing to unpack .../182-kpartx_0.9.9-1ubuntu4_armhf.deb ... 145s Unpacking kpartx (0.9.9-1ubuntu4) over (0.9.9-1ubuntu3) ... 145s Preparing to unpack .../183-multipath-tools_0.9.9-1ubuntu4_armhf.deb ... 145s Unpacking multipath-tools (0.9.9-1ubuntu4) over (0.9.9-1ubuntu3) ... 145s Setting up libip4tc2:armhf (1.8.11-2ubuntu1) ... 145s Setting up powermgmt-base (1.38) ... 145s Setting up motd-news-config (13.6ubuntu1) ... 145s Setting up distro-info (1.13) ... 145s Setting up liburcu8t64:armhf (0.15.1-1) ... 145s Setting up libibverbs1:armhf (55.0-1ubuntu1) ... 145s Setting up libxdmcp6:armhf (1:1.1.5-1) ... 145s Setting up lto-disabled-list (56) ... 145s Setting up pci.ids (0.0~2025.02.12-1) ... 145s Setting up libnewt0.52:armhf (0.52.24-4ubuntu1) ... 145s Setting up apt-utils (2.9.30ubuntu1) ... 145s Setting up bsdextrautils (2.40.2-14ubuntu1) ... 145s Setting up init (1.68) ... 145s Setting up ibverbs-providers:armhf (55.0-1ubuntu1) ... 145s Setting up gcc-14-base:armhf (14.2.0-17ubuntu3) ... 145s Setting up psmisc (23.7-2) ... 145s Setting up libcbor0.10:armhf (0.10.2-2ubuntu1) ... 145s Setting up libyaml-0-2:armhf (0.2.5-2) ... 145s Setting up libip6tc2:armhf (1.8.11-2ubuntu1) ... 145s Setting up liblsof0 (4.99.4+dfsg-2) ... 145s Setting up libmaxminddb0:armhf (1.12.2-1) ... 145s Setting up python3.12-gdbm (3.12.9-1) ... 145s Setting up libedit2:armhf (3.1-20250104-1) ... 145s Setting up libsasl2-modules:armhf (2.1.28+dfsg1-8build1) ... 145s Setting up netcat-openbsd (1.228-1) ... 145s Setting up libpython3.12-minimal:armhf (3.12.9-1) ... 145s Setting up binutils-common:armhf (2.44-2ubuntu1) ... 145s Setting up libctf-nobfd0:armhf (2.44-2ubuntu1) ... 145s Setting up gettext-base (0.23.1-1) ... 145s Setting up libnss-systemd:armhf (257.2-3ubuntu1) ... 145s Setting up libnftnl11:armhf (1.2.8-1) ... 145s Setting up krb5-locales (1.21.3-4ubuntu1) ... 145s Setting up libcom-err2:armhf (1.47.2-1ubuntu1) ... 145s Setting up libjemalloc2:armhf (5.3.0-2build1) ... 145s Setting up lshw (02.19.git.2021.06.19.996aaad9c7-2.1ubuntu1) ... 145s Setting up locales (2.40-4ubuntu1) ... 146s Generating locales (this might take a while)... 148s en_US.UTF-8... done 148s Generation complete. 148s Setting up libldap-common (2.6.9+dfsg-1~exp2ubuntu1) ... 148s Installing new version of config file /etc/ldap/ldap.conf ... 148s Setting up libprotobuf-c1:armhf (1.5.1-1ubuntu1) ... 148s Setting up xxd (2:9.1.0967-1ubuntu2) ... 148s Setting up libsframe1:armhf (2.44-2ubuntu1) ... 148s Setting up python-babel-localedata (2.17.0-1) ... 148s Setting up libkrb5support0:armhf (1.21.3-4ubuntu1) ... 148s Setting up libsasl2-modules-db:armhf (2.1.28+dfsg1-8build1) ... 148s Setting up tzdata (2025a-2ubuntu1) ... 148s 148s Current default time zone: 'Etc/UTC' 148s Local time is now: Sat Feb 22 06:38:34 UTC 2025. 148s Universal Time is now: Sat Feb 22 06:38:34 UTC 2025. 148s Run 'dpkg-reconfigure tzdata' if you wish to change it. 148s 148s Setting up eject (2.40.2-14ubuntu1) ... 148s Setting up apparmor (4.1.0~beta5-0ubuntu5) ... 148s Installing new version of config file /etc/apparmor.d/abstractions/dconf ... 148s Installing new version of config file /etc/apparmor.d/abstractions/mesa ... 148s Installing new version of config file /etc/apparmor.d/abstractions/nameservice ... 148s Installing new version of config file /etc/apparmor.d/abstractions/php ... 148s Installing new version of config file /etc/apparmor.d/abstractions/python ... 148s Installing new version of config file /etc/apparmor.d/sbuild ... 148s Installing new version of config file /etc/apparmor.d/sbuild-abort ... 148s Installing new version of config file /etc/apparmor.d/sbuild-adduser ... 148s Installing new version of config file /etc/apparmor.d/sbuild-apt ... 148s Installing new version of config file /etc/apparmor.d/sbuild-checkpackages ... 148s Installing new version of config file /etc/apparmor.d/sbuild-clean ... 148s Installing new version of config file /etc/apparmor.d/sbuild-createchroot ... 148s Installing new version of config file /etc/apparmor.d/sbuild-destroychroot ... 148s Installing new version of config file /etc/apparmor.d/sbuild-distupgrade ... 148s Installing new version of config file /etc/apparmor.d/sbuild-hold ... 148s Installing new version of config file /etc/apparmor.d/sbuild-shell ... 148s Installing new version of config file /etc/apparmor.d/sbuild-unhold ... 148s Installing new version of config file /etc/apparmor.d/sbuild-update ... 148s Installing new version of config file /etc/apparmor.d/sbuild-upgrade ... 148s Installing new version of config file /etc/apparmor.d/slirp4netns ... 148s Installing new version of config file /etc/apparmor.d/toybox ... 148s Installing new version of config file /etc/apparmor.d/transmission ... 148s Installing new version of config file /etc/apparmor.d/tunables/global ... 149s apparmor_parser: Unable to replace "lsb_release". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s apparmor_parser: Unable to replace "kmod". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s apparmor_parser: Unable to replace "nvidia_modprobe". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s Reloading AppArmor profiles 149s /sbin/apparmor_parser: Unable to replace "1password". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "Discord". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "MongoDB Compass". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "balena-etcher". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "brave". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "buildah". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "busybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "cam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "babeld". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ch-checkns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ch-run". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "chromium". /sbin/apparmor_parser: Unable to replace "bwrap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "chrome". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "vscode". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "bfdd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "bgpd". /sbin/apparmor_parser: Unable to replace "alsamixer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "devhelp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "crun". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "element-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "epiphany". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "evolution". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "firefox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "flatpak". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "foliate". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "geary". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "github-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "eigrpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "goldendict". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "dnstracer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ipa_verify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "fabricd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "Xorg". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "fusermount3". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "kchmviewer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "keybase". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lc-compliance". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "libcamerify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "linux-sandbox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "loupe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "iotop-c". /sbin/apparmor_parser: Unable to replace "isisd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ldpd". /sbin/apparmor_parser: Unable to replace "lxc-create". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-attach". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-execute". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-destroy". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-stop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-unshare". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lxc-usernsexec". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "mmdebstrap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "msedge". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lsusb". /sbin/apparmor_parser: Unable to replace "lsblk". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "nautilus". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "notepadqq". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "obsidian". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "irssi". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "opam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "lsb_release". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "opera". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "nhrpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "pageedit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "mosquitto". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "mbsync". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "nc.openbsd". /sbin/apparmor_parser: Unable to replace "pbrd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ospf6d". /sbin/apparmor_parser: Unable to replace "ospfd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "polypane". /sbin/apparmor_parser: Unable to replace "kmod". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "podman". /sbin/apparmor_parser: Unable to replace "nvidia_modprobe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "pathd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "qcam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "qmapshack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "privacybrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "qutebrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "rootlesskit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "rpm". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "rssguard". /sbin/apparmor_parser: Unable to replace "pim6d". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "plasmashell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "runc". /sbin/apparmor_parser: Unable to replace "pimd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ip". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "openvpn". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ripngd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "sbuild". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "ripd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "sbuild-abort". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "sbuild-adduser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 149s /sbin/apparmor_parser: Unable to replace "sbuild-apt". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 149s 150s /sbin/apparmor_parser: Unable to replace "sbuild-createchroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-distupgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-destroychroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-checkpackages". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-hold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-clean". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-unhold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-upgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "scide". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "slack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "signal-desktop". /sbin/apparmor_parser: Unable to replace "slirp4netns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "steam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "sbuild-update". /sbin/apparmor_parser: Unable to replace "sbuild-shell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "surfshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "thunderbird". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "stress-ng". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "systemd-coredump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "toybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "trinity". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tup". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tuxedo-control-center". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "staticd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tinyproxy". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "mx-extract". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "rygel". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "unprivileged_userns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "unpriv_unshare". /sbin/apparmor_parser: Unable to replace "unix-chkpwd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "userbindmount". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_apt_news". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "rsyslogd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "uwsgi-core". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "vdens". /sbin/apparmor_parser: Unable to replace "dumpcap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "vivaldi-bin". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "virtiofsd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "vpnns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "cmds". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tnftp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "/usr/bin/man". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "wike". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "wg". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "wpcom". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "vrrpd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "remmina". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "ip". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "wg-quick". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "znc". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "tcpdump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "transmission-cli". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "apt_methods". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s Error: At least one profile failed to load 150s Setting up libglib2.0-data (2.83.3-2) ... 150s Setting up vim-common (2:9.1.0967-1ubuntu2) ... 150s Setting up busybox-static (1:1.37.0-4ubuntu1) ... 150s Setting up libwrap0:armhf (7.6.q-35) ... 150s Setting up libnvme1t64 (1.11.1-2) ... 150s Setting up make (4.4.1-1) ... 150s Setting up libnspr4:armhf (2:4.36-1ubuntu1) ... 150s Setting up gnupg-l10n (2.4.4-2ubuntu22) ... 150s Setting up ed (1.21-1) ... 150s Setting up bash-completion (1:2.16.0-7) ... 150s Setting up libncurses6:armhf (6.5+20250125-2) ... 150s Setting up libdbus-1-3:armhf (1.16.0-1ubuntu1) ... 150s Setting up libfribidi0:armhf (1.0.16-1) ... 150s Setting up libpng16-16t64:armhf (1.6.46-4) ... 150s Setting up systemd-timesyncd (257.2-3ubuntu1) ... 150s systemd-time-wait-sync.service is a disabled or a static unit not running, not starting it. 150s Setting up libatomic1:armhf (15-20250213-1ubuntu1) ... 150s Setting up udev (257.2-3ubuntu1) ... 151s Setting up libss2:armhf (1.47.2-1ubuntu1) ... 151s Setting up usb.ids (2025.01.14-1) ... 151s Setting up dhcpcd-base (1:10.1.0-7) ... 151s Installing new version of config file /etc/dhcpcd.conf ... 151s Setting up ucf (3.0050) ... 151s Installing new version of config file /etc/ucf.conf ... 151s Setting up libncursesw6:armhf (6.5+20250125-2) ... 151s Setting up libk5crypto3:armhf (1.21.3-4ubuntu1) ... 151s Setting up busybox-initramfs (1:1.37.0-4ubuntu1) ... 151s Setting up libxtables12:armhf (1.8.11-2ubuntu1) ... 151s Setting up logsave (1.47.2-1ubuntu1) ... 151s Setting up libsasl2-2:armhf (2.1.28+dfsg1-8build1) ... 151s Setting up lsof (4.99.4+dfsg-2) ... 151s Setting up libfdisk1:armhf (2.40.2-14ubuntu1) ... 151s Setting up libicu74:armhf (74.2-1ubuntu6) ... 151s Setting up nano (8.3-1) ... 151s Installing new version of config file /etc/nanorc ... 151s Setting up libdevmapper1.02.1:armhf (2:1.02.201-1ubuntu1) ... 151s Setting up whiptail (0.52.24-4ubuntu1) ... 151s Setting up python-apt-common (2.9.9) ... 151s Setting up dracut-install (106-2ubuntu1) ... 151s Setting up perl-modules-5.40 (5.40.1-2) ... 151s Setting up dmsetup (2:1.02.201-1ubuntu1) ... 151s Setting up uuid-runtime (2.40.2-14ubuntu1) ... 152s uuidd.service is a disabled or a static unit not running, not starting it. 152s Setting up xauth (1:1.1.2-1.1) ... 152s Setting up groff-base (1.23.0-7) ... 152s Setting up libtraceevent1:armhf (1:1.8.4-2) ... 152s Setting up dbus-session-bus-common (1.16.0-1ubuntu1) ... 152s Setting up kpartx (0.9.9-1ubuntu4) ... 152s Setting up libpcap0.8t64:armhf (1.10.5-2ubuntu1) ... 152s Setting up libcryptsetup12:armhf (2:2.7.5-1ubuntu2) ... 152s Setting up libjson-glib-1.0-common (1.10.6+ds-1) ... 152s Setting up mawk (1.3.4.20250131-1) ... 152s Setting up libkrb5-3:armhf (1.21.3-4ubuntu1) ... 152s Setting up libusb-1.0-0:armhf (2:1.0.27-2) ... 152s Setting up libicu76:armhf (76.1-1ubuntu2) ... 152s Setting up linux-headers-6.12.0-15 (6.12.0-15.15) ... 152s Setting up keyboard-configuration (1.226ubuntu3) ... 153s Your console font configuration will be updated the next time your system 153s boots. If you want to update it now, run 'setupcon' from a virtual console. 153s update-initramfs: deferring update (trigger activated) 153s Setting up libbinutils:armhf (2.44-2ubuntu1) ... 153s Setting up dbus-system-bus-common (1.16.0-1ubuntu1) ... 153s Setting up openssl (3.4.1-1ubuntu1) ... 153s Installing new version of config file /etc/ssl/openssl.cnf ... 153s Setting up libgpg-error-l10n (1.51-3) ... 153s Setting up iputils-ping (3:20240905-1ubuntu1) ... 153s Setting up readline-common (8.2-6) ... 153s Setting up publicsuffix (20250108.1153-0.1) ... 153s Setting up libxml2:armhf (2.12.7+dfsg+really2.9.14-0.2ubuntu3) ... 153s Setting up tmux (3.5a-3) ... 153s Setting up zstd (1.5.6+dfsg-2) ... 153s Setting up libldap2:armhf (2.6.9+dfsg-1~exp2ubuntu1) ... 153s Setting up dbus-bin (1.16.0-1ubuntu1) ... 153s Setting up libbpf1:armhf (1:1.5.0-2) ... 153s Setting up iputils-tracepath (3:20240905-1ubuntu1) ... 153s Setting up rsync (3.4.1-0syncable1) ... 154s rsync.service is a disabled or a static unit not running, not starting it. 154s Setting up python3.13-gdbm (3.13.2-1) ... 154s Setting up ethtool (1:6.11-1) ... 154s Setting up gnupg-utils (2.4.4-2ubuntu22) ... 154s Setting up initramfs-tools-bin (0.145ubuntu2) ... 154s Setting up ncurses-term (6.5+20250125-2) ... 154s Setting up login (1:4.16.0-2+really2.40.2-14ubuntu1) ... 154s Setting up cron-daemon-common (3.0pl1-192ubuntu1) ... 154s Setting up libxkbcommon0:armhf (1.7.0-2) ... 154s Setting up libctf0:armhf (2.44-2ubuntu1) ... 154s Setting up cryptsetup-bin (2:2.7.5-1ubuntu2) ... 154s Setting up pinentry-curses (1.3.1-2ubuntu2) ... 154s Setting up python3.12-minimal (3.12.9-1) ... 155s Setting up libnftables1:armhf (1.1.1-1build1) ... 155s Setting up nftables (1.1.1-1build1) ... 155s Setting up iptables (1.8.11-2ubuntu1) ... 155s Setting up htop (3.3.0-5) ... 155s Setting up iproute2 (6.13.0-1ubuntu1) ... 156s Setting up btrfs-progs (6.12-1build1) ... 156s Setting up cron (3.0pl1-192ubuntu1) ... 156s Setting up rsyslog (8.2412.0-2ubuntu1) ... 156s Installing new version of config file /etc/apparmor.d/usr.sbin.rsyslogd ... 156s info: The user `syslog' is already a member of `adm'. 157s apparmor_parser: Unable to replace "rsyslogd". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 157s 157s Setting up inetutils-telnet (2:2.5-6ubuntu1) ... 157s Setting up e2fsprogs (1.47.2-1ubuntu1) ... 157s update-initramfs: deferring update (trigger activated) 158s Setting up libnss3:armhf (2:3.108-1ubuntu1) ... 158s Setting up dbus-daemon (1.16.0-1ubuntu1) ... 158s Setting up vim-tiny (2:9.1.0967-1ubuntu2) ... 158s Setting up multipath-tools (0.9.9-1ubuntu4) ... 158s Setting up libperl5.40:armhf (5.40.1-2) ... 158s Setting up libftdi1-2:armhf (1.5-8) ... 158s Setting up ca-certificates (20241223) ... 161s Updating certificates in /etc/ssl/certs... 162s rehash: warning: skipping ca-certificates.crt, it does not contain exactly one certificate or CRL 162s 7 added, 1 removed; done. 162s Setting up perl (5.40.1-2) ... 162s Setting up libglib2.0-0t64:armhf (2.83.3-2) ... 162s No schema files found: doing nothing. 162s Setting up systemd-cryptsetup (257.2-3ubuntu1) ... 162s Setting up dbus (1.16.0-1ubuntu1) ... 162s A reboot is required to replace the running dbus-daemon. 162s Please reboot the system when convenient. 163s Setting up libblockdev-utils3:armhf (3.3.0-1) ... 163s Setting up linux-headers-6.12.0-15-generic (6.12.0-15.15) ... 163s Setting up libgssapi-krb5-2:armhf (1.21.3-4ubuntu1) ... 163s Setting up gir1.2-glib-2.0:armhf (2.83.3-2) ... 163s Setting up libdpkg-perl (1.22.11ubuntu4) ... 163s Setting up libreadline8t64:armhf (8.2-6) ... 163s Setting up libblockdev-nvme3:armhf (3.3.0-1) ... 163s Setting up libblockdev-fs3:armhf (3.3.0-1) ... 163s Setting up libtraceevent1-plugin:armhf (1:1.8.4-2) ... 163s Setting up libplymouth5:armhf (24.004.60-2ubuntu5) ... 163s Setting up gpgconf (2.4.4-2ubuntu22) ... 163s Setting up libpam-systemd:armhf (257.2-3ubuntu1) ... 163s Setting up libgirepository-1.0-1:armhf (1.82.0-4) ... 163s Setting up initramfs-tools-core (0.145ubuntu2) ... 163s Setting up binutils-arm-linux-gnueabihf (2.44-2ubuntu1) ... 163s Setting up libarchive13t64:armhf (3.7.7-0ubuntu1) ... 163s Setting up libpython3.13-stdlib:armhf (3.13.2-1) ... 163s Setting up gpg (2.4.4-2ubuntu22) ... 163s Setting up libgudev-1.0-0:armhf (1:238-6) ... 163s Setting up libpolkit-gobject-1-0:armhf (126-2) ... 163s Setting up libgstreamer1.0-0:armhf (1.25.50-1) ... 163s Setcap worked! gst-ptp-helper is not suid! 163s Setting up libudisks2-0:armhf (2.10.1-11ubuntu2) ... 163s Setting up libpython3-stdlib:armhf (3.13.1-1~exp2) ... 163s Setting up systemd-resolved (257.2-3ubuntu1) ... 164s Setting up gpg-agent (2.4.4-2ubuntu22) ... 164s Setting up telnet (0.17+2.5-6ubuntu1) ... 164s Setting up libpython3.12-stdlib:armhf (3.12.9-1) ... 164s Setting up initramfs-tools (0.145ubuntu2) ... 164s update-initramfs: deferring update (trigger activated) 164s Setting up libblockdev-mdraid3:armhf (3.3.0-1) ... 164s Setting up libcurl4t64:armhf (8.12.1-2ubuntu1) ... 164s Setting up bind9-libs:armhf (1:9.20.4-3ubuntu1) ... 164s Setting up e2fsprogs-l10n (1.47.2-1ubuntu1) ... 164s Setting up python3.13 (3.13.2-1) ... 165s Setting up libblockdev-swap3:armhf (3.3.0-1) ... 165s Setting up plymouth (24.004.60-2ubuntu5) ... 165s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 166s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 166s Setting up python3.12 (3.12.9-1) ... 167s Setting up libblockdev-loop3:armhf (3.3.0-1) ... 167s Setting up gpgsm (2.4.4-2ubuntu22) ... 167s Setting up libcurl3t64-gnutls:armhf (8.12.1-2ubuntu1) ... 167s Setting up libglib2.0-bin (2.83.3-2) ... 167s Setting up libpackagekit-glib2-18:armhf (1.3.0-3build1) ... 167s Setting up libappstream5:armhf (1.0.4-1) ... 167s Setting up libqmi-glib5:armhf (1.35.6-1) ... 167s Setting up python3 (3.13.1-1~exp2) ... 167s /usr/bin/py3clean:101: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 167s for fn in glob1(directory, "%s.*" % fname): 167s Setting up linux-headers-generic (6.12.0-15.15+1) ... 167s Setting up binutils (2.44-2ubuntu1) ... 167s Setting up libnetplan1:armhf (1.1.2-2ubuntu1) ... 167s Setting up python3-newt:armhf (0.52.24-4ubuntu1) ... 168s Setting up libblockdev3:armhf (3.3.0-1) ... 168s Setting up fdisk (2.40.2-14ubuntu1) ... 168s Setting up dpkg-dev (1.22.11ubuntu4) ... 168s Setting up libjson-glib-1.0-0:armhf (1.10.6+ds-1) ... 168s Setting up libblockdev-part3:armhf (3.3.0-1) ... 168s Setting up dirmngr (2.4.4-2ubuntu22) ... 168s Setting up gir1.2-packagekitglib-1.0 (1.3.0-3build1) ... 168s Setting up dbus-user-session (1.16.0-1ubuntu1) ... 168s Setting up python3-jinja2 (3.1.5-2) ... 168s Setting up python3-pygments (2.18.0+dfsg-2) ... 170s Setting up python3-chardet (5.2.0+dfsg-2) ... 170s Setting up appstream (1.0.4-1) ... 172s ✔ Metadata cache was updated successfully. 172s Setting up python3-certifi (2025.1.31+ds-1) ... 172s Setting up gir1.2-girepository-2.0:armhf (1.82.0-4) ... 172s Setting up python3-gi (3.50.0-4) ... 173s Setting up python3-idna (3.10-1) ... 173s Setting up xfsprogs (6.12.0-1ubuntu1) ... 173s update-initramfs: deferring update (trigger activated) 174s Setting up keyboxd (2.4.4-2ubuntu22) ... 174s Setting up python3-urllib3 (2.3.0-1) ... 174s Setting up python3-json-pointer (2.4-3) ... 174s Setting up gnupg (2.4.4-2ubuntu22) ... 174s Setting up python3-netplan (1.1.2-2ubuntu1) ... 174s Setting up libpolkit-agent-1-0:armhf (126-2) ... 174s Setting up libgpgme11t64:armhf (1.24.2-1ubuntu1) ... 174s Setting up curl (8.12.1-2ubuntu1) ... 174s Setting up libvolume-key1:armhf (0.3.12-9) ... 174s Setting up netplan-generator (1.1.2-2ubuntu1) ... 174s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 174s Setting up bind9-host (1:9.20.4-3ubuntu1) ... 174s Setting up python3-distro-info (1.13) ... 175s Setting up polkitd (126-2) ... 175s Setting up python3-more-itertools (10.6.0-1) ... 175s Setting up python3-attr (25.1.0-1) ... 175s Setting up gpg-wks-client (2.4.4-2ubuntu22) ... 175s Setting up libblockdev-crypto3:armhf (3.3.0-1) ... 175s Setting up python3-jwt (2.10.1-2) ... 176s Setting up python3-babel (2.17.0-1) ... 176s Setting up python3-rich (13.9.4-1) ... 177s Setting up python3-gdbm:armhf (3.13.1-1) ... 177s Setting up python3-problem-report (2.31.0+git20250220-0ubuntu1) ... 177s Setting up python3-apt (2.9.9) ... 177s Setting up python3-jsonpatch (1.32-5) ... 177s Setting up python3-bcrypt (4.2.0-2.1) ... 177s Setting up libqmi-proxy (1.35.6-1) ... 177s Setting up libfwupd3:armhf (2.0.6-3) ... 177s Setting up ufw (0.36.2-9) ... 178s Setting up python3-lazr.uri (1.0.6-5) ... 178s Setting up netplan.io (1.1.2-2ubuntu1) ... 178s Setting up unattended-upgrades (2.12ubuntu4) ... 179s Replacing config file /etc/apt/apt.conf.d/50unattended-upgrades with new version 179s Setting up pollinate (4.33-4ubuntu2) ... 179s Setting up python3-cryptography (43.0.0-1) ... 180s Setting up python3-wadllib (2.0.0-2) ... 180s Setting up python3-requests (2.32.3+dfsg-4ubuntu1) ... 180s Setting up bind9-dnsutils (1:9.20.4-3ubuntu1) ... 180s Setting up ubuntu-pro-client (34.1.3) ... 180s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 180s 181s apparmor_parser: Unable to replace "apt_methods". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 181s 181s apparmor_parser: Unable to replace "ubuntu_pro_esm_cache". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 181s 182s Setting up fwupd (2.0.6-3) ... 183s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 183s fwupd.service is a disabled or a static unit not running, not starting it. 183s Setting up python3-referencing (0.35.1-2ubuntu1) ... 183s Setting up python3-pkg-resources (75.6.0-1) ... 183s Setting up ubuntu-pro-client-l10n (34.1.3) ... 183s Setting up udisks2 (2.10.1-11ubuntu2) ... 183s vda: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/uevent': Permission denied 183s vda1: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda1/uevent': Permission denied 183s vda15: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda15/uevent': Permission denied 183s vda2: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda2/uevent': Permission denied 183s loop0: Failed to write 'change' to '/sys/devices/virtual/block/loop0/uevent': Permission denied 183s loop1: Failed to write 'change' to '/sys/devices/virtual/block/loop1/uevent': Permission denied 183s loop2: Failed to write 'change' to '/sys/devices/virtual/block/loop2/uevent': Permission denied 183s loop3: Failed to write 'change' to '/sys/devices/virtual/block/loop3/uevent': Permission denied 183s loop4: Failed to write 'change' to '/sys/devices/virtual/block/loop4/uevent': Permission denied 183s loop5: Failed to write 'change' to '/sys/devices/virtual/block/loop5/uevent': Permission denied 183s loop6: Failed to write 'change' to '/sys/devices/virtual/block/loop6/uevent': Permission denied 183s loop7: Failed to write 'change' to '/sys/devices/virtual/block/loop7/uevent': Permission denied 183s loop8: Failed to write 'change' to '/sys/devices/virtual/block/loop8/uevent': Permission denied 184s Setting up python3-setuptools (75.6.0-1) ... 186s Setting up python3-openssl (25.0.0-1) ... 186s Setting up python3-launchpadlib (2.1.0-1) ... 186s Setting up ubuntu-standard (1.547) ... 186s Setting up python3-apport (2.31.0+git20250220-0ubuntu1) ... 187s Setting up python3-oauthlib (3.2.2-3) ... 187s Setting up python3-software-properties (0.109) ... 187s Setting up python3-jsonschema (4.19.2-6ubuntu1) ... 187s Setting up cloud-init-base (25.1-0ubuntu1) ... 187s Installing new version of config file /etc/cloud/templates/sources.list.debian.deb822.tmpl ... 187s Installing new version of config file /etc/cloud/templates/sources.list.ubuntu.deb822.tmpl ... 190s Setting up cloud-init (25.1-0ubuntu1) ... 190s Setting up apport-core-dump-handler (2.31.0+git20250220-0ubuntu1) ... 190s Setting up apport (2.31.0+git20250220-0ubuntu1) ... 191s apport-autoreport.service is a disabled or a static unit not running, not starting it. 191s Setting up kbd (2.7.1-2ubuntu1) ... 191s Setting up console-setup-linux (1.226ubuntu3) ... 192s Setting up console-setup (1.226ubuntu3) ... 193s update-initramfs: deferring update (trigger activated) 193s Setting up ubuntu-minimal (1.547) ... 193s Processing triggers for libc-bin (2.40-4ubuntu1) ... 193s Processing triggers for systemd (257.2-3ubuntu1) ... 193s Processing triggers for man-db (2.13.0-1) ... 194s Processing triggers for shared-mime-info (2.4-5) ... 194s Warning: program compiled against libxml 212 using older 209 195s Processing triggers for sgml-base (1.31) ... 195s Processing triggers for debianutils (5.21) ... 195s Processing triggers for install-info (7.1.1-1) ... 195s Setting up packagekit (1.3.0-3build1) ... 195s Setting up packagekit-tools (1.3.0-3build1) ... 195s Setting up software-properties-common (0.109) ... 195s Processing triggers for initramfs-tools (0.145ubuntu2) ... 195s Setting up plymouth-theme-ubuntu-text (24.004.60-2ubuntu5) ... 196s Processing triggers for ca-certificates (20241223) ... 196s Updating certificates in /etc/ssl/certs... 196s 0 added, 0 removed; done. 196s Running hooks in /etc/ca-certificates/update.d... 196s done. 196s Processing triggers for initramfs-tools (0.145ubuntu2) ... 199s Reading package lists... 200s Building dependency tree... 200s Reading state information... 200s Starting pkgProblemResolver with broken count: 0 200s Starting 2 pkgProblemResolver with broken count: 0 200s Done 200s Solving dependencies... 201s The following packages will be REMOVED: 201s libapt-pkg6.0t64* libassuan0* libicu74* libnsl2* libpython3.12-minimal* 201s libpython3.12-stdlib* libunwind8* linux-headers-6.11.0-8* 201s linux-headers-6.11.0-8-generic* python3.12* python3.12-minimal* 201s 0 upgraded, 0 newly installed, 11 to remove and 0 not upgraded. 201s After this operation, 154 MB disk space will be freed. 201s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 92815 files and directories currently installed.) 201s Removing libapt-pkg6.0t64:armhf (2.9.29) ... 201s Removing libassuan0:armhf (2.5.6-1build1) ... 201s Removing libicu74:armhf (74.2-1ubuntu6) ... 201s Removing python3.12 (3.12.9-1) ... 201s Removing libpython3.12-stdlib:armhf (3.12.9-1) ... 202s Removing libnsl2:armhf (1.3.0-3build3) ... 202s Removing python3.12-minimal (3.12.9-1) ... 202s /usr/bin/py3clean:125: DeprecationWarning: glob.glob1 is deprecated and will be removed in Python 3.15. Use glob.glob and pass a directory to its root_dir argument instead. 202s for fn in glob1(directory, "%s.%s.py[co]" % (fname, magic_tag)): 203s Removing libpython3.12-minimal:armhf (3.12.9-1) ... 204s Removing libunwind8:armhf (1.6.2-3.1) ... 204s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 204s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 204s Processing triggers for systemd (257.2-3ubuntu1) ... 204s Processing triggers for man-db (2.13.0-1) ... 204s Processing triggers for libc-bin (2.40-4ubuntu1) ... 204s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60309 files and directories currently installed.) 204s Purging configuration files for python3.12-minimal (3.12.9-1) ... 204s Purging configuration files for libpython3.12-minimal:armhf (3.12.9-1) ... 207s autopkgtest [06:39:33]: rebooting testbed after setup commands that affected boot 251s autopkgtest [06:40:17]: testbed running kernel: Linux 6.8.0-52-generic #53~22.04.1-Ubuntu SMP PREEMPT_DYNAMIC Wed Jan 15 18:10:51 UTC 2 283s autopkgtest [06:40:49]: @@@@@@@@@@@@@@@@@@@@ apt-source emboss 322s Get:1 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (dsc) [2655 B] 322s Get:2 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (tar) [77.4 MB] 322s Get:3 http://ftpmaster.internal/ubuntu plucky/universe emboss 6.6.0+dfsg-12ubuntu2 (diff) [251 kB] 322s gpgv: Signature made Mon Apr 22 14:47:56 2024 UTC 322s gpgv: using RSA key 4FB588A84C2DDE79A74C77876FA458DD1DB03F71 322s gpgv: issuer "juliank@ubuntu.com" 322s gpgv: Can't check signature: No public key 322s dpkg-source: warning: cannot verify inline signature for ./emboss_6.6.0+dfsg-12ubuntu2.dsc: no acceptable signature found 329s dpkg-source: warning: diff 'src/debian/patches/no_makejar.patch' patches file src/jemboss/runJemboss.sh.in more than once 330s autopkgtest [06:41:36]: testing package emboss version 6.6.0+dfsg-12ubuntu2 333s autopkgtest [06:41:39]: build not needed 353s autopkgtest [06:41:59]: test run-unit-test: preparing testbed 355s Reading package lists... 355s Building dependency tree... 355s Reading state information... 356s Starting pkgProblemResolver with broken count: 0 356s Starting 2 pkgProblemResolver with broken count: 0 356s Done 357s The following NEW packages will be installed: 357s adwaita-icon-theme at-spi2-common ca-certificates-java 357s dconf-gsettings-backend dconf-service default-jre default-jre-headless 357s emboss emboss-data emboss-doc emboss-lib emboss-test fontconfig 357s fontconfig-config fonts-dejavu-core fonts-dejavu-mono gtk-update-icon-cache 357s hicolor-icon-theme java-common jemboss libaom3 libasound2-data libasound2t64 357s libatk-bridge2.0-0t64 libatk1.0-0t64 libatspi2.0-0t64 libavahi-client3 357s libavahi-common-data libavahi-common3 libcairo-gobject2 libcairo2 libcolord2 357s libcups2t64 libdatrie1 libdconf1 libde265-0 libdeflate0 libdrm-radeon1 357s libepoxy0 libfontconfig1 libfreetype6 libgbm1 libgd3 libgdk-pixbuf-2.0-0 357s libgdk-pixbuf2.0-common libgif7 libgl1 libgl1-mesa-dri libglapi-mesa 357s libglvnd0 libglx-mesa0 libglx0 libgomp1 libgraphite2-3 libgtk-3-0t64 357s libgtk-3-common libharfbuzz0b libheif-plugin-aomdec libheif-plugin-libde265 357s libheif1 libhpdf-2.3.0 libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 357s liblcms2-2 liblerc4 libllvm19 libmysqlclient21 libpango-1.0-0 357s libpangocairo-1.0-0 libpangoft2-1.0-0 libpcsclite1 libpixman-1-0 libpq5 357s libraqm0 libsharpyuv0 libthai-data libthai0 libtiff6 libvulkan1 357s libwayland-client0 libwayland-cursor0 libwayland-egl1 libwayland-server0 357s libwebp7 libx11-xcb1 libxcb-dri3-0 libxcb-glx0 libxcb-present0 libxcb-randr0 357s libxcb-render0 libxcb-shm0 libxcb-sync1 libxcb-xfixes0 libxcomposite1 357s libxcursor1 libxdamage1 libxfixes3 libxi6 libxinerama1 libxpm4 libxrandr2 357s libxrender1 libxshmfence1 libxtst6 libxxf86vm1 mesa-libgallium mysql-common 357s openjdk-21-jre openjdk-21-jre-headless x11-common 357s 0 upgraded, 112 newly installed, 0 to remove and 0 not upgraded. 357s Need to get 167 MB of archives. 357s After this operation, 908 MB of additional disk space will be used. 357s Get:1 http://ftpmaster.internal/ubuntu plucky/main armhf libgdk-pixbuf2.0-common all 2.42.12+dfsg-2 [8004 B] 357s Get:2 http://ftpmaster.internal/ubuntu plucky/main armhf libjpeg-turbo8 armhf 2.1.5-3ubuntu2 [127 kB] 357s Get:3 http://ftpmaster.internal/ubuntu plucky/main armhf libjpeg8 armhf 8c-2ubuntu11 [2148 B] 357s Get:4 http://ftpmaster.internal/ubuntu plucky/main armhf libdeflate0 armhf 1.23-1 [38.5 kB] 357s Get:5 http://ftpmaster.internal/ubuntu plucky/main armhf libjbig0 armhf 2.1-6.1ubuntu2 [24.9 kB] 357s Get:6 http://ftpmaster.internal/ubuntu plucky/main armhf liblerc4 armhf 4.0.0+ds-5ubuntu1 [160 kB] 357s Get:7 http://ftpmaster.internal/ubuntu plucky/main armhf libsharpyuv0 armhf 1.5.0-0.1 [16.4 kB] 357s Get:8 http://ftpmaster.internal/ubuntu plucky/main armhf libwebp7 armhf 1.5.0-0.1 [188 kB] 357s Get:9 http://ftpmaster.internal/ubuntu plucky/main armhf libtiff6 armhf 4.5.1+git230720-4ubuntu4 [179 kB] 357s Get:10 http://ftpmaster.internal/ubuntu plucky/main armhf libgdk-pixbuf-2.0-0 armhf 2.42.12+dfsg-2 [136 kB] 357s Get:11 http://ftpmaster.internal/ubuntu plucky/main armhf gtk-update-icon-cache armhf 4.17.4+ds-4 [51.5 kB] 357s Get:12 http://ftpmaster.internal/ubuntu plucky/main armhf hicolor-icon-theme all 0.18-2 [13.3 kB] 357s Get:13 http://ftpmaster.internal/ubuntu plucky/main armhf adwaita-icon-theme all 48~beta-3 [578 kB] 357s Get:14 http://ftpmaster.internal/ubuntu plucky/main armhf at-spi2-common all 2.55.2-1 [8916 B] 357s Get:15 http://ftpmaster.internal/ubuntu plucky/main armhf ca-certificates-java all 20240118 [11.6 kB] 357s Get:16 http://ftpmaster.internal/ubuntu plucky/main armhf libdconf1 armhf 0.40.0-5 [38.4 kB] 357s Get:17 http://ftpmaster.internal/ubuntu plucky/main armhf dconf-service armhf 0.40.0-5 [27.6 kB] 357s Get:18 http://ftpmaster.internal/ubuntu plucky/main armhf dconf-gsettings-backend armhf 0.40.0-5 [23.8 kB] 358s Get:19 http://ftpmaster.internal/ubuntu plucky/main armhf java-common all 0.76 [6852 B] 358s Get:20 http://ftpmaster.internal/ubuntu plucky/main armhf liblcms2-2 armhf 2.16-2 [137 kB] 358s Get:21 http://ftpmaster.internal/ubuntu plucky/main armhf libpcsclite1 armhf 2.3.1-1 [24.9 kB] 358s Get:22 http://ftpmaster.internal/ubuntu plucky/main armhf openjdk-21-jre-headless armhf 21.0.6+7-1 [39.7 MB] 359s Get:23 http://ftpmaster.internal/ubuntu plucky/main armhf default-jre-headless armhf 2:1.21-76 [3182 B] 359s Get:24 http://ftpmaster.internal/ubuntu plucky/main armhf libatk1.0-0t64 armhf 2.55.2-1 [48.1 kB] 359s Get:25 http://ftpmaster.internal/ubuntu plucky/main armhf libxi6 armhf 2:1.8.2-1 [26.5 kB] 359s Get:26 http://ftpmaster.internal/ubuntu plucky/main armhf libatspi2.0-0t64 armhf 2.55.2-1 [71.8 kB] 359s Get:27 http://ftpmaster.internal/ubuntu plucky/main armhf libatk-bridge2.0-0t64 armhf 2.55.2-1 [59.8 kB] 359s Get:28 http://ftpmaster.internal/ubuntu plucky/main armhf libfreetype6 armhf 2.13.3+dfsg-1 [330 kB] 359s Get:29 http://ftpmaster.internal/ubuntu plucky/main armhf fonts-dejavu-mono all 2.37-8 [502 kB] 359s Get:30 http://ftpmaster.internal/ubuntu plucky/main armhf fonts-dejavu-core all 2.37-8 [835 kB] 359s Get:31 http://ftpmaster.internal/ubuntu plucky/main armhf fontconfig-config armhf 2.15.0-2ubuntu1 [37.5 kB] 359s Get:32 http://ftpmaster.internal/ubuntu plucky/main armhf libfontconfig1 armhf 2.15.0-2ubuntu1 [114 kB] 359s Get:33 http://ftpmaster.internal/ubuntu plucky/main armhf libpixman-1-0 armhf 0.44.0-3 [183 kB] 359s Get:34 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-render0 armhf 1.17.0-2 [15.3 kB] 359s Get:35 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-shm0 armhf 1.17.0-2 [5774 B] 359s Get:36 http://ftpmaster.internal/ubuntu plucky/main armhf libxrender1 armhf 1:0.9.10-1.1build1 [16.0 kB] 359s Get:37 http://ftpmaster.internal/ubuntu plucky/main armhf libcairo2 armhf 1.18.2-2 [484 kB] 359s Get:38 http://ftpmaster.internal/ubuntu plucky/main armhf libcairo-gobject2 armhf 1.18.2-2 [126 kB] 359s Get:39 http://ftpmaster.internal/ubuntu plucky/main armhf libcolord2 armhf 1.4.7-1build2 [133 kB] 359s Get:40 http://ftpmaster.internal/ubuntu plucky/main armhf libavahi-common-data armhf 0.8-14ubuntu1 [30.5 kB] 359s Get:41 http://ftpmaster.internal/ubuntu plucky/main armhf libavahi-common3 armhf 0.8-14ubuntu1 [19.5 kB] 359s Get:42 http://ftpmaster.internal/ubuntu plucky/main armhf libavahi-client3 armhf 0.8-14ubuntu1 [23.6 kB] 359s Get:43 http://ftpmaster.internal/ubuntu plucky/main armhf libcups2t64 armhf 2.4.11-0ubuntu2 [243 kB] 359s Get:44 http://ftpmaster.internal/ubuntu plucky/main armhf libepoxy0 armhf 1.5.10-2 [192 kB] 359s Get:45 http://ftpmaster.internal/ubuntu plucky/main armhf libgraphite2-3 armhf 1.3.14-2ubuntu1 [64.8 kB] 359s Get:46 http://ftpmaster.internal/ubuntu plucky/main armhf libharfbuzz0b armhf 10.2.0-1 [464 kB] 359s Get:47 http://ftpmaster.internal/ubuntu plucky/main armhf fontconfig armhf 2.15.0-2ubuntu1 [190 kB] 359s Get:48 http://ftpmaster.internal/ubuntu plucky/main armhf libthai-data all 0.1.29-2build1 [158 kB] 359s Get:49 http://ftpmaster.internal/ubuntu plucky/main armhf libdatrie1 armhf 0.2.13-3build1 [15.7 kB] 359s Get:50 http://ftpmaster.internal/ubuntu plucky/main armhf libthai0 armhf 0.1.29-2build1 [15.2 kB] 359s Get:51 http://ftpmaster.internal/ubuntu plucky/main armhf libpango-1.0-0 armhf 1.56.1-1 [216 kB] 359s Get:52 http://ftpmaster.internal/ubuntu plucky/main armhf libpangoft2-1.0-0 armhf 1.56.1-1 [43.5 kB] 359s Get:53 http://ftpmaster.internal/ubuntu plucky/main armhf libpangocairo-1.0-0 armhf 1.56.1-1 [25.1 kB] 359s Get:54 http://ftpmaster.internal/ubuntu plucky/main armhf libwayland-client0 armhf 1.23.1-3 [23.3 kB] 359s Get:55 http://ftpmaster.internal/ubuntu plucky/main armhf libwayland-cursor0 armhf 1.23.1-3 [9648 B] 359s Get:56 http://ftpmaster.internal/ubuntu plucky/main armhf libwayland-egl1 armhf 1.23.1-3 [5874 B] 359s Get:57 http://ftpmaster.internal/ubuntu plucky/main armhf libxcomposite1 armhf 1:0.4.6-1 [6060 B] 359s Get:58 http://ftpmaster.internal/ubuntu plucky/main armhf libxfixes3 armhf 1:6.0.0-2build1 [9038 B] 359s Get:59 http://ftpmaster.internal/ubuntu plucky/main armhf libxcursor1 armhf 1:1.2.3-1 [18.0 kB] 359s Get:60 http://ftpmaster.internal/ubuntu plucky/main armhf libxdamage1 armhf 1:1.1.6-1build1 [5462 B] 359s Get:61 http://ftpmaster.internal/ubuntu plucky/main armhf libxinerama1 armhf 2:1.1.4-3build1 [5866 B] 359s Get:62 http://ftpmaster.internal/ubuntu plucky/main armhf libxrandr2 armhf 2:1.5.4-1 [15.8 kB] 359s Get:63 http://ftpmaster.internal/ubuntu plucky/main armhf libgtk-3-common all 3.24.48-3ubuntu1 [1424 kB] 359s Get:64 http://ftpmaster.internal/ubuntu plucky/main armhf libgtk-3-0t64 armhf 3.24.48-3ubuntu1 [2621 kB] 359s Get:65 http://ftpmaster.internal/ubuntu plucky/main armhf libglvnd0 armhf 1.7.0-1build1 [83.7 kB] 359s Get:66 http://ftpmaster.internal/ubuntu plucky/main armhf libglapi-mesa armhf 24.3.4-3ubuntu1 [50.1 kB] 359s Get:67 http://ftpmaster.internal/ubuntu plucky/main armhf libx11-xcb1 armhf 2:1.8.10-2 [7902 B] 359s Get:68 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-dri3-0 armhf 1.17.0-2 [7120 B] 359s Get:69 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-glx0 armhf 1.17.0-2 [22.6 kB] 359s Get:70 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-present0 armhf 1.17.0-2 [5940 B] 359s Get:71 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-xfixes0 armhf 1.17.0-2 [10.0 kB] 359s Get:72 http://ftpmaster.internal/ubuntu plucky/main armhf libxxf86vm1 armhf 1:1.1.4-1build4 [8068 B] 359s Get:73 http://ftpmaster.internal/ubuntu plucky/main armhf libdrm-radeon1 armhf 2.4.123-1 [18.1 kB] 359s Get:74 http://ftpmaster.internal/ubuntu plucky/main armhf libllvm19 armhf 1:19.1.7-1ubuntu2 [27.8 MB] 360s Get:75 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-randr0 armhf 1.17.0-2 [17.0 kB] 360s Get:76 http://ftpmaster.internal/ubuntu plucky/main armhf libxcb-sync1 armhf 1.17.0-2 [8732 B] 360s Get:77 http://ftpmaster.internal/ubuntu plucky/main armhf libxshmfence1 armhf 1.3-1build5 [4464 B] 360s Get:78 http://ftpmaster.internal/ubuntu plucky/main armhf mesa-libgallium armhf 24.3.4-3ubuntu1 [8155 kB] 360s Get:79 http://ftpmaster.internal/ubuntu plucky/main armhf libwayland-server0 armhf 1.23.1-3 [30.3 kB] 360s Get:80 http://ftpmaster.internal/ubuntu plucky/main armhf libgbm1 armhf 24.3.4-3ubuntu1 [29.0 kB] 360s Get:81 http://ftpmaster.internal/ubuntu plucky/main armhf libvulkan1 armhf 1.4.304.0-1 [127 kB] 360s Get:82 http://ftpmaster.internal/ubuntu plucky/main armhf libgl1-mesa-dri armhf 24.3.4-3ubuntu1 [31.8 kB] 360s Get:83 http://ftpmaster.internal/ubuntu plucky/main armhf libglx-mesa0 armhf 24.3.4-3ubuntu1 [121 kB] 360s Get:84 http://ftpmaster.internal/ubuntu plucky/main armhf libglx0 armhf 1.7.0-1build1 [39.3 kB] 360s Get:85 http://ftpmaster.internal/ubuntu plucky/main armhf libgl1 armhf 1.7.0-1build1 [105 kB] 360s Get:86 http://ftpmaster.internal/ubuntu plucky/main armhf libasound2-data all 1.2.13-1build1 [21.1 kB] 360s Get:87 http://ftpmaster.internal/ubuntu plucky/main armhf libasound2t64 armhf 1.2.13-1build1 [347 kB] 360s Get:88 http://ftpmaster.internal/ubuntu plucky/main armhf libgif7 armhf 5.2.2-1ubuntu2 [32.5 kB] 360s Get:89 http://ftpmaster.internal/ubuntu plucky/main armhf x11-common all 1:7.7+23ubuntu3 [21.7 kB] 360s Get:90 http://ftpmaster.internal/ubuntu plucky/main armhf libxtst6 armhf 2:1.2.5-1 [11.0 kB] 360s Get:91 http://ftpmaster.internal/ubuntu plucky/main armhf openjdk-21-jre armhf 21.0.6+7-1 [198 kB] 360s Get:92 http://ftpmaster.internal/ubuntu plucky/main armhf default-jre armhf 2:1.21-76 [918 B] 360s Get:93 http://ftpmaster.internal/ubuntu plucky/main armhf libaom3 armhf 3.12.0-1 [1235 kB] 360s Get:94 http://ftpmaster.internal/ubuntu plucky/main armhf libheif-plugin-aomdec armhf 1.19.5-1build1 [11.0 kB] 360s Get:95 http://ftpmaster.internal/ubuntu plucky/main armhf libde265-0 armhf 1.0.15-1build4 [157 kB] 360s Get:96 http://ftpmaster.internal/ubuntu plucky/main armhf libheif-plugin-libde265 armhf 1.19.5-1build1 [11.7 kB] 360s Get:97 http://ftpmaster.internal/ubuntu plucky/main armhf libheif1 armhf 1.19.5-1build1 [476 kB] 360s Get:98 http://ftpmaster.internal/ubuntu plucky/main armhf libgomp1 armhf 15-20250213-1ubuntu1 [128 kB] 360s Get:99 http://ftpmaster.internal/ubuntu plucky/main armhf libimagequant0 armhf 2.18.0-1build1 [31.1 kB] 360s Get:100 http://ftpmaster.internal/ubuntu plucky/main armhf libraqm0 armhf 0.10.2-1 [12.4 kB] 360s Get:101 http://ftpmaster.internal/ubuntu plucky/main armhf libxpm4 armhf 1:3.5.17-1build2 [30.1 kB] 360s Get:102 http://ftpmaster.internal/ubuntu plucky/main armhf libgd3 armhf 2.3.3-12ubuntu3 [108 kB] 361s Get:103 http://ftpmaster.internal/ubuntu plucky/universe armhf libhpdf-2.3.0 armhf 2.3.0+dfsg-1build3 [414 kB] 361s Get:104 http://ftpmaster.internal/ubuntu plucky/main armhf mysql-common all 5.8+1.1.1 [6800 B] 361s Get:105 http://ftpmaster.internal/ubuntu plucky/main armhf libmysqlclient21 armhf 8.0.40-1 [1234 kB] 361s Get:106 http://ftpmaster.internal/ubuntu plucky-proposed/main armhf libpq5 armhf 17.4-1 [125 kB] 361s Get:107 http://ftpmaster.internal/ubuntu plucky/universe armhf emboss-lib armhf 6.6.0+dfsg-12ubuntu2 [2408 kB] 361s Get:108 http://ftpmaster.internal/ubuntu plucky/universe armhf emboss-data all 6.6.0+dfsg-12ubuntu2 [61.0 MB] 363s Get:109 http://ftpmaster.internal/ubuntu plucky/universe armhf emboss armhf 6.6.0+dfsg-12ubuntu2 [933 kB] 363s Get:110 http://ftpmaster.internal/ubuntu plucky/universe armhf emboss-doc all 6.6.0+dfsg-12ubuntu2 [2782 kB] 364s Get:111 http://ftpmaster.internal/ubuntu plucky/universe armhf emboss-test all 6.6.0+dfsg-12ubuntu2 [4801 kB] 364s Get:112 http://ftpmaster.internal/ubuntu plucky/universe armhf jemboss all 6.6.0+dfsg-12ubuntu2 [3751 kB] 364s Fetched 167 MB in 7s (23.6 MB/s) 364s Selecting previously unselected package libgdk-pixbuf2.0-common. 364s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 60307 files and directories currently installed.) 364s Preparing to unpack .../000-libgdk-pixbuf2.0-common_2.42.12+dfsg-2_all.deb ... 364s Unpacking libgdk-pixbuf2.0-common (2.42.12+dfsg-2) ... 364s Selecting previously unselected package libjpeg-turbo8:armhf. 365s Preparing to unpack .../001-libjpeg-turbo8_2.1.5-3ubuntu2_armhf.deb ... 365s Unpacking libjpeg-turbo8:armhf (2.1.5-3ubuntu2) ... 365s Selecting previously unselected package libjpeg8:armhf. 365s Preparing to unpack .../002-libjpeg8_8c-2ubuntu11_armhf.deb ... 365s Unpacking libjpeg8:armhf (8c-2ubuntu11) ... 365s Selecting previously unselected package libdeflate0:armhf. 365s Preparing to unpack .../003-libdeflate0_1.23-1_armhf.deb ... 365s Unpacking libdeflate0:armhf (1.23-1) ... 365s Selecting previously unselected package libjbig0:armhf. 365s Preparing to unpack .../004-libjbig0_2.1-6.1ubuntu2_armhf.deb ... 365s Unpacking libjbig0:armhf (2.1-6.1ubuntu2) ... 365s Selecting previously unselected package liblerc4:armhf. 365s Preparing to unpack .../005-liblerc4_4.0.0+ds-5ubuntu1_armhf.deb ... 365s Unpacking liblerc4:armhf (4.0.0+ds-5ubuntu1) ... 365s Selecting previously unselected package libsharpyuv0:armhf. 365s Preparing to unpack .../006-libsharpyuv0_1.5.0-0.1_armhf.deb ... 365s Unpacking libsharpyuv0:armhf (1.5.0-0.1) ... 365s Selecting previously unselected package libwebp7:armhf. 365s Preparing to unpack .../007-libwebp7_1.5.0-0.1_armhf.deb ... 365s Unpacking libwebp7:armhf (1.5.0-0.1) ... 365s Selecting previously unselected package libtiff6:armhf. 365s Preparing to unpack .../008-libtiff6_4.5.1+git230720-4ubuntu4_armhf.deb ... 365s Unpacking libtiff6:armhf (4.5.1+git230720-4ubuntu4) ... 365s Selecting previously unselected package libgdk-pixbuf-2.0-0:armhf. 365s Preparing to unpack .../009-libgdk-pixbuf-2.0-0_2.42.12+dfsg-2_armhf.deb ... 365s Unpacking libgdk-pixbuf-2.0-0:armhf (2.42.12+dfsg-2) ... 365s Selecting previously unselected package gtk-update-icon-cache. 365s Preparing to unpack .../010-gtk-update-icon-cache_4.17.4+ds-4_armhf.deb ... 365s No diversion 'diversion of /usr/sbin/update-icon-caches to /usr/sbin/update-icon-caches.gtk2 by libgtk-3-bin', none removed. 365s No diversion 'diversion of /usr/share/man/man8/update-icon-caches.8.gz to /usr/share/man/man8/update-icon-caches.gtk2.8.gz by libgtk-3-bin', none removed. 365s Unpacking gtk-update-icon-cache (4.17.4+ds-4) ... 365s Selecting previously unselected package hicolor-icon-theme. 365s Preparing to unpack .../011-hicolor-icon-theme_0.18-2_all.deb ... 365s Unpacking hicolor-icon-theme (0.18-2) ... 365s Selecting previously unselected package adwaita-icon-theme. 365s Preparing to unpack .../012-adwaita-icon-theme_48~beta-3_all.deb ... 365s Unpacking adwaita-icon-theme (48~beta-3) ... 365s Selecting previously unselected package at-spi2-common. 365s Preparing to unpack .../013-at-spi2-common_2.55.2-1_all.deb ... 365s Unpacking at-spi2-common (2.55.2-1) ... 365s Selecting previously unselected package ca-certificates-java. 365s Preparing to unpack .../014-ca-certificates-java_20240118_all.deb ... 365s Unpacking ca-certificates-java (20240118) ... 365s Selecting previously unselected package libdconf1:armhf. 365s Preparing to unpack .../015-libdconf1_0.40.0-5_armhf.deb ... 365s Unpacking libdconf1:armhf (0.40.0-5) ... 365s Selecting previously unselected package dconf-service. 365s Preparing to unpack .../016-dconf-service_0.40.0-5_armhf.deb ... 365s Unpacking dconf-service (0.40.0-5) ... 365s Selecting previously unselected package dconf-gsettings-backend:armhf. 365s Preparing to unpack .../017-dconf-gsettings-backend_0.40.0-5_armhf.deb ... 365s Unpacking dconf-gsettings-backend:armhf (0.40.0-5) ... 365s Selecting previously unselected package java-common. 365s Preparing to unpack .../018-java-common_0.76_all.deb ... 365s Unpacking java-common (0.76) ... 365s Selecting previously unselected package liblcms2-2:armhf. 365s Preparing to unpack .../019-liblcms2-2_2.16-2_armhf.deb ... 365s Unpacking liblcms2-2:armhf (2.16-2) ... 365s Selecting previously unselected package libpcsclite1:armhf. 365s Preparing to unpack .../020-libpcsclite1_2.3.1-1_armhf.deb ... 365s Unpacking libpcsclite1:armhf (2.3.1-1) ... 365s Selecting previously unselected package openjdk-21-jre-headless:armhf. 365s Preparing to unpack .../021-openjdk-21-jre-headless_21.0.6+7-1_armhf.deb ... 365s Unpacking openjdk-21-jre-headless:armhf (21.0.6+7-1) ... 367s Selecting previously unselected package default-jre-headless. 367s Preparing to unpack .../022-default-jre-headless_2%3a1.21-76_armhf.deb ... 367s Unpacking default-jre-headless (2:1.21-76) ... 367s Selecting previously unselected package libatk1.0-0t64:armhf. 367s Preparing to unpack .../023-libatk1.0-0t64_2.55.2-1_armhf.deb ... 367s Unpacking libatk1.0-0t64:armhf (2.55.2-1) ... 367s Selecting previously unselected package libxi6:armhf. 367s Preparing to unpack .../024-libxi6_2%3a1.8.2-1_armhf.deb ... 367s Unpacking libxi6:armhf (2:1.8.2-1) ... 367s Selecting previously unselected package libatspi2.0-0t64:armhf. 367s Preparing to unpack .../025-libatspi2.0-0t64_2.55.2-1_armhf.deb ... 367s Unpacking libatspi2.0-0t64:armhf (2.55.2-1) ... 367s Selecting previously unselected package libatk-bridge2.0-0t64:armhf. 367s Preparing to unpack .../026-libatk-bridge2.0-0t64_2.55.2-1_armhf.deb ... 367s Unpacking libatk-bridge2.0-0t64:armhf (2.55.2-1) ... 367s Selecting previously unselected package libfreetype6:armhf. 367s Preparing to unpack .../027-libfreetype6_2.13.3+dfsg-1_armhf.deb ... 367s Unpacking libfreetype6:armhf (2.13.3+dfsg-1) ... 367s Selecting previously unselected package fonts-dejavu-mono. 367s Preparing to unpack .../028-fonts-dejavu-mono_2.37-8_all.deb ... 367s Unpacking fonts-dejavu-mono (2.37-8) ... 367s Selecting previously unselected package fonts-dejavu-core. 367s Preparing to unpack .../029-fonts-dejavu-core_2.37-8_all.deb ... 367s Unpacking fonts-dejavu-core (2.37-8) ... 367s Selecting previously unselected package fontconfig-config. 367s Preparing to unpack .../030-fontconfig-config_2.15.0-2ubuntu1_armhf.deb ... 367s Unpacking fontconfig-config (2.15.0-2ubuntu1) ... 367s Selecting previously unselected package libfontconfig1:armhf. 367s Preparing to unpack .../031-libfontconfig1_2.15.0-2ubuntu1_armhf.deb ... 367s Unpacking libfontconfig1:armhf (2.15.0-2ubuntu1) ... 367s Selecting previously unselected package libpixman-1-0:armhf. 367s Preparing to unpack .../032-libpixman-1-0_0.44.0-3_armhf.deb ... 367s Unpacking libpixman-1-0:armhf (0.44.0-3) ... 367s Selecting previously unselected package libxcb-render0:armhf. 367s Preparing to unpack .../033-libxcb-render0_1.17.0-2_armhf.deb ... 367s Unpacking libxcb-render0:armhf (1.17.0-2) ... 367s Selecting previously unselected package libxcb-shm0:armhf. 367s Preparing to unpack .../034-libxcb-shm0_1.17.0-2_armhf.deb ... 367s Unpacking libxcb-shm0:armhf (1.17.0-2) ... 367s Selecting previously unselected package libxrender1:armhf. 367s Preparing to unpack .../035-libxrender1_1%3a0.9.10-1.1build1_armhf.deb ... 367s Unpacking libxrender1:armhf (1:0.9.10-1.1build1) ... 367s Selecting previously unselected package libcairo2:armhf. 367s Preparing to unpack .../036-libcairo2_1.18.2-2_armhf.deb ... 367s Unpacking libcairo2:armhf (1.18.2-2) ... 367s Selecting previously unselected package libcairo-gobject2:armhf. 367s Preparing to unpack .../037-libcairo-gobject2_1.18.2-2_armhf.deb ... 367s Unpacking libcairo-gobject2:armhf (1.18.2-2) ... 367s Selecting previously unselected package libcolord2:armhf. 367s Preparing to unpack .../038-libcolord2_1.4.7-1build2_armhf.deb ... 367s Unpacking libcolord2:armhf (1.4.7-1build2) ... 367s Selecting previously unselected package libavahi-common-data:armhf. 367s Preparing to unpack .../039-libavahi-common-data_0.8-14ubuntu1_armhf.deb ... 367s Unpacking libavahi-common-data:armhf (0.8-14ubuntu1) ... 367s Selecting previously unselected package libavahi-common3:armhf. 367s Preparing to unpack .../040-libavahi-common3_0.8-14ubuntu1_armhf.deb ... 367s Unpacking libavahi-common3:armhf (0.8-14ubuntu1) ... 367s Selecting previously unselected package libavahi-client3:armhf. 367s Preparing to unpack .../041-libavahi-client3_0.8-14ubuntu1_armhf.deb ... 367s Unpacking libavahi-client3:armhf (0.8-14ubuntu1) ... 367s Selecting previously unselected package libcups2t64:armhf. 367s Preparing to unpack .../042-libcups2t64_2.4.11-0ubuntu2_armhf.deb ... 367s Unpacking libcups2t64:armhf (2.4.11-0ubuntu2) ... 367s Selecting previously unselected package libepoxy0:armhf. 367s Preparing to unpack .../043-libepoxy0_1.5.10-2_armhf.deb ... 367s Unpacking libepoxy0:armhf (1.5.10-2) ... 368s Selecting previously unselected package libgraphite2-3:armhf. 368s Preparing to unpack .../044-libgraphite2-3_1.3.14-2ubuntu1_armhf.deb ... 368s Unpacking libgraphite2-3:armhf (1.3.14-2ubuntu1) ... 368s Selecting previously unselected package libharfbuzz0b:armhf. 368s Preparing to unpack .../045-libharfbuzz0b_10.2.0-1_armhf.deb ... 368s Unpacking libharfbuzz0b:armhf (10.2.0-1) ... 368s Selecting previously unselected package fontconfig. 368s Preparing to unpack .../046-fontconfig_2.15.0-2ubuntu1_armhf.deb ... 368s Unpacking fontconfig (2.15.0-2ubuntu1) ... 368s Selecting previously unselected package libthai-data. 368s Preparing to unpack .../047-libthai-data_0.1.29-2build1_all.deb ... 368s Unpacking libthai-data (0.1.29-2build1) ... 368s Selecting previously unselected package libdatrie1:armhf. 368s Preparing to unpack .../048-libdatrie1_0.2.13-3build1_armhf.deb ... 368s Unpacking libdatrie1:armhf (0.2.13-3build1) ... 368s Selecting previously unselected package libthai0:armhf. 368s Preparing to unpack .../049-libthai0_0.1.29-2build1_armhf.deb ... 368s Unpacking libthai0:armhf (0.1.29-2build1) ... 368s Selecting previously unselected package libpango-1.0-0:armhf. 368s Preparing to unpack .../050-libpango-1.0-0_1.56.1-1_armhf.deb ... 368s Unpacking libpango-1.0-0:armhf (1.56.1-1) ... 368s Selecting previously unselected package libpangoft2-1.0-0:armhf. 368s Preparing to unpack .../051-libpangoft2-1.0-0_1.56.1-1_armhf.deb ... 368s Unpacking libpangoft2-1.0-0:armhf (1.56.1-1) ... 368s Selecting previously unselected package libpangocairo-1.0-0:armhf. 368s Preparing to unpack .../052-libpangocairo-1.0-0_1.56.1-1_armhf.deb ... 368s Unpacking libpangocairo-1.0-0:armhf (1.56.1-1) ... 368s Selecting previously unselected package libwayland-client0:armhf. 368s Preparing to unpack .../053-libwayland-client0_1.23.1-3_armhf.deb ... 368s Unpacking libwayland-client0:armhf (1.23.1-3) ... 368s Selecting previously unselected package libwayland-cursor0:armhf. 368s Preparing to unpack .../054-libwayland-cursor0_1.23.1-3_armhf.deb ... 368s Unpacking libwayland-cursor0:armhf (1.23.1-3) ... 368s Selecting previously unselected package libwayland-egl1:armhf. 368s Preparing to unpack .../055-libwayland-egl1_1.23.1-3_armhf.deb ... 368s Unpacking libwayland-egl1:armhf (1.23.1-3) ... 368s Selecting previously unselected package libxcomposite1:armhf. 368s Preparing to unpack .../056-libxcomposite1_1%3a0.4.6-1_armhf.deb ... 368s Unpacking libxcomposite1:armhf (1:0.4.6-1) ... 368s Selecting previously unselected package libxfixes3:armhf. 368s Preparing to unpack .../057-libxfixes3_1%3a6.0.0-2build1_armhf.deb ... 368s Unpacking libxfixes3:armhf (1:6.0.0-2build1) ... 368s Selecting previously unselected package libxcursor1:armhf. 368s Preparing to unpack .../058-libxcursor1_1%3a1.2.3-1_armhf.deb ... 368s Unpacking libxcursor1:armhf (1:1.2.3-1) ... 368s Selecting previously unselected package libxdamage1:armhf. 368s Preparing to unpack .../059-libxdamage1_1%3a1.1.6-1build1_armhf.deb ... 368s Unpacking libxdamage1:armhf (1:1.1.6-1build1) ... 368s Selecting previously unselected package libxinerama1:armhf. 368s Preparing to unpack .../060-libxinerama1_2%3a1.1.4-3build1_armhf.deb ... 368s Unpacking libxinerama1:armhf (2:1.1.4-3build1) ... 368s Selecting previously unselected package libxrandr2:armhf. 368s Preparing to unpack .../061-libxrandr2_2%3a1.5.4-1_armhf.deb ... 368s Unpacking libxrandr2:armhf (2:1.5.4-1) ... 368s Selecting previously unselected package libgtk-3-common. 368s Preparing to unpack .../062-libgtk-3-common_3.24.48-3ubuntu1_all.deb ... 368s Unpacking libgtk-3-common (3.24.48-3ubuntu1) ... 368s Selecting previously unselected package libgtk-3-0t64:armhf. 368s Preparing to unpack .../063-libgtk-3-0t64_3.24.48-3ubuntu1_armhf.deb ... 368s Unpacking libgtk-3-0t64:armhf (3.24.48-3ubuntu1) ... 368s Selecting previously unselected package libglvnd0:armhf. 368s Preparing to unpack .../064-libglvnd0_1.7.0-1build1_armhf.deb ... 368s Unpacking libglvnd0:armhf (1.7.0-1build1) ... 368s Selecting previously unselected package libglapi-mesa:armhf. 368s Preparing to unpack .../065-libglapi-mesa_24.3.4-3ubuntu1_armhf.deb ... 368s Unpacking libglapi-mesa:armhf (24.3.4-3ubuntu1) ... 368s Selecting previously unselected package libx11-xcb1:armhf. 368s Preparing to unpack .../066-libx11-xcb1_2%3a1.8.10-2_armhf.deb ... 368s Unpacking libx11-xcb1:armhf (2:1.8.10-2) ... 368s Selecting previously unselected package libxcb-dri3-0:armhf. 368s Preparing to unpack .../067-libxcb-dri3-0_1.17.0-2_armhf.deb ... 368s Unpacking libxcb-dri3-0:armhf (1.17.0-2) ... 368s Selecting previously unselected package libxcb-glx0:armhf. 368s Preparing to unpack .../068-libxcb-glx0_1.17.0-2_armhf.deb ... 368s Unpacking libxcb-glx0:armhf (1.17.0-2) ... 368s Selecting previously unselected package libxcb-present0:armhf. 368s Preparing to unpack .../069-libxcb-present0_1.17.0-2_armhf.deb ... 368s Unpacking libxcb-present0:armhf (1.17.0-2) ... 369s Selecting previously unselected package libxcb-xfixes0:armhf. 369s Preparing to unpack .../070-libxcb-xfixes0_1.17.0-2_armhf.deb ... 369s Unpacking libxcb-xfixes0:armhf (1.17.0-2) ... 369s Selecting previously unselected package libxxf86vm1:armhf. 369s Preparing to unpack .../071-libxxf86vm1_1%3a1.1.4-1build4_armhf.deb ... 369s Unpacking libxxf86vm1:armhf (1:1.1.4-1build4) ... 369s Selecting previously unselected package libdrm-radeon1:armhf. 369s Preparing to unpack .../072-libdrm-radeon1_2.4.123-1_armhf.deb ... 369s Unpacking libdrm-radeon1:armhf (2.4.123-1) ... 369s Selecting previously unselected package libllvm19:armhf. 369s Preparing to unpack .../073-libllvm19_1%3a19.1.7-1ubuntu2_armhf.deb ... 369s Unpacking libllvm19:armhf (1:19.1.7-1ubuntu2) ... 369s Selecting previously unselected package libxcb-randr0:armhf. 369s Preparing to unpack .../074-libxcb-randr0_1.17.0-2_armhf.deb ... 369s Unpacking libxcb-randr0:armhf (1.17.0-2) ... 369s Selecting previously unselected package libxcb-sync1:armhf. 370s Preparing to unpack .../075-libxcb-sync1_1.17.0-2_armhf.deb ... 370s Unpacking libxcb-sync1:armhf (1.17.0-2) ... 370s Selecting previously unselected package libxshmfence1:armhf. 370s Preparing to unpack .../076-libxshmfence1_1.3-1build5_armhf.deb ... 370s Unpacking libxshmfence1:armhf (1.3-1build5) ... 370s Selecting previously unselected package mesa-libgallium:armhf. 370s Preparing to unpack .../077-mesa-libgallium_24.3.4-3ubuntu1_armhf.deb ... 370s Unpacking mesa-libgallium:armhf (24.3.4-3ubuntu1) ... 370s Selecting previously unselected package libwayland-server0:armhf. 370s Preparing to unpack .../078-libwayland-server0_1.23.1-3_armhf.deb ... 370s Unpacking libwayland-server0:armhf (1.23.1-3) ... 370s Selecting previously unselected package libgbm1:armhf. 370s Preparing to unpack .../079-libgbm1_24.3.4-3ubuntu1_armhf.deb ... 370s Unpacking libgbm1:armhf (24.3.4-3ubuntu1) ... 370s Selecting previously unselected package libvulkan1:armhf. 370s Preparing to unpack .../080-libvulkan1_1.4.304.0-1_armhf.deb ... 370s Unpacking libvulkan1:armhf (1.4.304.0-1) ... 370s Selecting previously unselected package libgl1-mesa-dri:armhf. 370s Preparing to unpack .../081-libgl1-mesa-dri_24.3.4-3ubuntu1_armhf.deb ... 370s Unpacking libgl1-mesa-dri:armhf (24.3.4-3ubuntu1) ... 370s Selecting previously unselected package libglx-mesa0:armhf. 370s Preparing to unpack .../082-libglx-mesa0_24.3.4-3ubuntu1_armhf.deb ... 370s Unpacking libglx-mesa0:armhf (24.3.4-3ubuntu1) ... 370s Selecting previously unselected package libglx0:armhf. 370s Preparing to unpack .../083-libglx0_1.7.0-1build1_armhf.deb ... 370s Unpacking libglx0:armhf (1.7.0-1build1) ... 370s Selecting previously unselected package libgl1:armhf. 370s Preparing to unpack .../084-libgl1_1.7.0-1build1_armhf.deb ... 370s Unpacking libgl1:armhf (1.7.0-1build1) ... 370s Selecting previously unselected package libasound2-data. 370s Preparing to unpack .../085-libasound2-data_1.2.13-1build1_all.deb ... 370s Unpacking libasound2-data (1.2.13-1build1) ... 370s Selecting previously unselected package libasound2t64:armhf. 370s Preparing to unpack .../086-libasound2t64_1.2.13-1build1_armhf.deb ... 370s Unpacking libasound2t64:armhf (1.2.13-1build1) ... 370s Selecting previously unselected package libgif7:armhf. 370s Preparing to unpack .../087-libgif7_5.2.2-1ubuntu2_armhf.deb ... 370s Unpacking libgif7:armhf (5.2.2-1ubuntu2) ... 370s Selecting previously unselected package x11-common. 370s Preparing to unpack .../088-x11-common_1%3a7.7+23ubuntu3_all.deb ... 370s Unpacking x11-common (1:7.7+23ubuntu3) ... 370s Selecting previously unselected package libxtst6:armhf. 370s Preparing to unpack .../089-libxtst6_2%3a1.2.5-1_armhf.deb ... 370s Unpacking libxtst6:armhf (2:1.2.5-1) ... 370s Selecting previously unselected package openjdk-21-jre:armhf. 370s Preparing to unpack .../090-openjdk-21-jre_21.0.6+7-1_armhf.deb ... 370s Unpacking openjdk-21-jre:armhf (21.0.6+7-1) ... 370s Selecting previously unselected package default-jre. 370s Preparing to unpack .../091-default-jre_2%3a1.21-76_armhf.deb ... 370s Unpacking default-jre (2:1.21-76) ... 370s Selecting previously unselected package libaom3:armhf. 370s Preparing to unpack .../092-libaom3_3.12.0-1_armhf.deb ... 370s Unpacking libaom3:armhf (3.12.0-1) ... 370s Selecting previously unselected package libheif-plugin-aomdec:armhf. 370s Preparing to unpack .../093-libheif-plugin-aomdec_1.19.5-1build1_armhf.deb ... 370s Unpacking libheif-plugin-aomdec:armhf (1.19.5-1build1) ... 370s Selecting previously unselected package libde265-0:armhf. 370s Preparing to unpack .../094-libde265-0_1.0.15-1build4_armhf.deb ... 370s Unpacking libde265-0:armhf (1.0.15-1build4) ... 370s Selecting previously unselected package libheif-plugin-libde265:armhf. 370s Preparing to unpack .../095-libheif-plugin-libde265_1.19.5-1build1_armhf.deb ... 370s Unpacking libheif-plugin-libde265:armhf (1.19.5-1build1) ... 370s Selecting previously unselected package libheif1:armhf. 370s Preparing to unpack .../096-libheif1_1.19.5-1build1_armhf.deb ... 370s Unpacking libheif1:armhf (1.19.5-1build1) ... 370s Selecting previously unselected package libgomp1:armhf. 370s Preparing to unpack .../097-libgomp1_15-20250213-1ubuntu1_armhf.deb ... 370s Unpacking libgomp1:armhf (15-20250213-1ubuntu1) ... 371s Selecting previously unselected package libimagequant0:armhf. 371s Preparing to unpack .../098-libimagequant0_2.18.0-1build1_armhf.deb ... 371s Unpacking libimagequant0:armhf (2.18.0-1build1) ... 371s Selecting previously unselected package libraqm0:armhf. 371s Preparing to unpack .../099-libraqm0_0.10.2-1_armhf.deb ... 371s Unpacking libraqm0:armhf (0.10.2-1) ... 371s Selecting previously unselected package libxpm4:armhf. 371s Preparing to unpack .../100-libxpm4_1%3a3.5.17-1build2_armhf.deb ... 371s Unpacking libxpm4:armhf (1:3.5.17-1build2) ... 371s Selecting previously unselected package libgd3:armhf. 371s Preparing to unpack .../101-libgd3_2.3.3-12ubuntu3_armhf.deb ... 371s Unpacking libgd3:armhf (2.3.3-12ubuntu3) ... 371s Selecting previously unselected package libhpdf-2.3.0:armhf. 371s Preparing to unpack .../102-libhpdf-2.3.0_2.3.0+dfsg-1build3_armhf.deb ... 371s Unpacking libhpdf-2.3.0:armhf (2.3.0+dfsg-1build3) ... 371s Selecting previously unselected package mysql-common. 371s Preparing to unpack .../103-mysql-common_5.8+1.1.1_all.deb ... 371s Unpacking mysql-common (5.8+1.1.1) ... 371s Selecting previously unselected package libmysqlclient21:armhf. 371s Preparing to unpack .../104-libmysqlclient21_8.0.40-1_armhf.deb ... 371s Unpacking libmysqlclient21:armhf (8.0.40-1) ... 371s Selecting previously unselected package libpq5:armhf. 371s Preparing to unpack .../105-libpq5_17.4-1_armhf.deb ... 371s Unpacking libpq5:armhf (17.4-1) ... 371s Selecting previously unselected package emboss-lib. 371s Preparing to unpack .../106-emboss-lib_6.6.0+dfsg-12ubuntu2_armhf.deb ... 371s Unpacking emboss-lib (6.6.0+dfsg-12ubuntu2) ... 371s Selecting previously unselected package emboss-data. 371s Preparing to unpack .../107-emboss-data_6.6.0+dfsg-12ubuntu2_all.deb ... 371s Unpacking emboss-data (6.6.0+dfsg-12ubuntu2) ... 373s Selecting previously unselected package emboss. 373s Preparing to unpack .../108-emboss_6.6.0+dfsg-12ubuntu2_armhf.deb ... 373s Unpacking emboss (6.6.0+dfsg-12ubuntu2) ... 373s Selecting previously unselected package emboss-doc. 373s Preparing to unpack .../109-emboss-doc_6.6.0+dfsg-12ubuntu2_all.deb ... 373s Unpacking emboss-doc (6.6.0+dfsg-12ubuntu2) ... 373s Selecting previously unselected package emboss-test. 373s Preparing to unpack .../110-emboss-test_6.6.0+dfsg-12ubuntu2_all.deb ... 373s Unpacking emboss-test (6.6.0+dfsg-12ubuntu2) ... 374s Selecting previously unselected package jemboss. 374s Preparing to unpack .../111-jemboss_6.6.0+dfsg-12ubuntu2_all.deb ... 374s Unpacking jemboss (6.6.0+dfsg-12ubuntu2) ... 374s Setting up libgraphite2-3:armhf (1.3.14-2ubuntu1) ... 374s Setting up libxcb-dri3-0:armhf (1.17.0-2) ... 374s Setting up liblcms2-2:armhf (2.16-2) ... 374s Setting up libpixman-1-0:armhf (0.44.0-3) ... 374s Setting up libllvm19:armhf (1:19.1.7-1ubuntu2) ... 374s Setting up libsharpyuv0:armhf (1.5.0-0.1) ... 374s Setting up libwayland-server0:armhf (1.23.1-3) ... 374s Setting up libaom3:armhf (3.12.0-1) ... 374s Setting up libx11-xcb1:armhf (2:1.8.10-2) ... 374s Setting up mysql-common (5.8+1.1.1) ... 374s update-alternatives: using /etc/mysql/my.cnf.fallback to provide /etc/mysql/my.cnf (my.cnf) in auto mode 374s Setting up libmysqlclient21:armhf (8.0.40-1) ... 374s Setting up libhpdf-2.3.0:armhf (2.3.0+dfsg-1build3) ... 374s Setting up libxdamage1:armhf (1:1.1.6-1build1) ... 374s Setting up libxcb-xfixes0:armhf (1.17.0-2) ... 374s Setting up liblerc4:armhf (4.0.0+ds-5ubuntu1) ... 374s Setting up libxpm4:armhf (1:3.5.17-1build2) ... 374s Setting up hicolor-icon-theme (0.18-2) ... 374s Setting up libxi6:armhf (2:1.8.2-1) ... 374s Setting up java-common (0.76) ... 374s Setting up libxrender1:armhf (1:0.9.10-1.1build1) ... 374s Setting up libdatrie1:armhf (0.2.13-3build1) ... 374s Setting up libxcb-render0:armhf (1.17.0-2) ... 374s Setting up libdrm-radeon1:armhf (2.4.123-1) ... 374s Setting up libglvnd0:armhf (1.7.0-1build1) ... 374s Setting up libxcb-glx0:armhf (1.17.0-2) ... 374s Setting up libgdk-pixbuf2.0-common (2.42.12+dfsg-2) ... 374s Setting up x11-common (1:7.7+23ubuntu3) ... 374s Setting up libpq5:armhf (17.4-1) ... 374s Setting up libdeflate0:armhf (1.23-1) ... 374s Setting up libxcb-shm0:armhf (1.17.0-2) ... 374s Setting up libgomp1:armhf (15-20250213-1ubuntu1) ... 374s Setting up emboss-data (6.6.0+dfsg-12ubuntu2) ... 374s Setting up libjbig0:armhf (2.1-6.1ubuntu2) ... 374s Setting up libcolord2:armhf (1.4.7-1build2) ... 374s Setting up libxxf86vm1:armhf (1:1.1.4-1build4) ... 374s Setting up emboss-doc (6.6.0+dfsg-12ubuntu2) ... 374s Setting up libxcb-present0:armhf (1.17.0-2) ... 374s Setting up libdconf1:armhf (0.40.0-5) ... 374s Setting up libasound2-data (1.2.13-1build1) ... 374s Setting up libasound2t64:armhf (1.2.13-1build1) ... 374s Setting up libfreetype6:armhf (2.13.3+dfsg-1) ... 374s Setting up libepoxy0:armhf (1.5.10-2) ... 374s Setting up libxfixes3:armhf (1:6.0.0-2build1) ... 374s Setting up libxcb-sync1:armhf (1.17.0-2) ... 374s Setting up libavahi-common-data:armhf (0.8-14ubuntu1) ... 374s Setting up libatspi2.0-0t64:armhf (2.55.2-1) ... 374s Setting up libxinerama1:armhf (2:1.1.4-3build1) ... 374s Setting up libimagequant0:armhf (2.18.0-1build1) ... 374s Setting up fonts-dejavu-mono (2.37-8) ... 374s Setting up libxrandr2:armhf (2:1.5.4-1) ... 374s Setting up fonts-dejavu-core (2.37-8) ... 374s Setting up libpcsclite1:armhf (2.3.1-1) ... 374s Setting up emboss-test (6.6.0+dfsg-12ubuntu2) ... 374s Setting up libjpeg-turbo8:armhf (2.1.5-3ubuntu2) ... 374s Setting up libglapi-mesa:armhf (24.3.4-3ubuntu1) ... 374s Setting up libvulkan1:armhf (1.4.304.0-1) ... 374s Setting up libwebp7:armhf (1.5.0-0.1) ... 374s Setting up libgif7:armhf (5.2.2-1ubuntu2) ... 374s Setting up libxshmfence1:armhf (1.3-1build5) ... 374s Setting up at-spi2-common (2.55.2-1) ... 374s Setting up libxcb-randr0:armhf (1.17.0-2) ... 374s Setting up libharfbuzz0b:armhf (10.2.0-1) ... 374s Setting up libthai-data (0.1.29-2build1) ... 374s Setting up libwayland-egl1:armhf (1.23.1-3) ... 374s Setting up ca-certificates-java (20240118) ... 374s No JRE found. Skipping Java certificates setup. 374s Setting up libde265-0:armhf (1.0.15-1build4) ... 374s Setting up libxcomposite1:armhf (1:0.4.6-1) ... 374s Setting up libwayland-client0:armhf (1.23.1-3) ... 374s Setting up libjpeg8:armhf (8c-2ubuntu11) ... 374s Setting up mesa-libgallium:armhf (24.3.4-3ubuntu1) ... 374s Setting up libatk1.0-0t64:armhf (2.55.2-1) ... 374s Setting up openjdk-21-jre-headless:armhf (21.0.6+7-1) ... 374s update-alternatives: using /usr/lib/jvm/java-21-openjdk-armhf/bin/java to provide /usr/bin/java (java) in auto mode 374s update-alternatives: using /usr/lib/jvm/java-21-openjdk-armhf/bin/jpackage to provide /usr/bin/jpackage (jpackage) in auto mode 374s update-alternatives: using /usr/lib/jvm/java-21-openjdk-armhf/bin/keytool to provide /usr/bin/keytool (keytool) in auto mode 374s update-alternatives: using /usr/lib/jvm/java-21-openjdk-armhf/bin/rmiregistry to provide /usr/bin/rmiregistry (rmiregistry) in auto mode 374s update-alternatives: using /usr/lib/jvm/java-21-openjdk-armhf/lib/jexec to provide /usr/bin/jexec (jexec) in auto mode 374s Setting up libgbm1:armhf (24.3.4-3ubuntu1) ... 374s Setting up fontconfig-config (2.15.0-2ubuntu1) ... 375s Setting up libxtst6:armhf (2:1.2.5-1) ... 375s Setting up libxcursor1:armhf (1:1.2.3-1) ... 375s Setting up libgl1-mesa-dri:armhf (24.3.4-3ubuntu1) ... 375s Setting up libavahi-common3:armhf (0.8-14ubuntu1) ... 375s Setting up dconf-service (0.40.0-5) ... 375s Setting up libthai0:armhf (0.1.29-2build1) ... 375s Setting up libraqm0:armhf (0.10.2-1) ... 375s Setting up libtiff6:armhf (4.5.1+git230720-4ubuntu4) ... 375s Setting up libwayland-cursor0:armhf (1.23.1-3) ... 375s Setting up libgdk-pixbuf-2.0-0:armhf (2.42.12+dfsg-2) ... 375s Setting up libavahi-client3:armhf (0.8-14ubuntu1) ... 375s Setting up libatk-bridge2.0-0t64:armhf (2.55.2-1) ... 375s Setting up gtk-update-icon-cache (4.17.4+ds-4) ... 375s Setting up libglx-mesa0:armhf (24.3.4-3ubuntu1) ... 375s Setting up libglx0:armhf (1.7.0-1build1) ... 375s Setting up dconf-gsettings-backend:armhf (0.40.0-5) ... 375s Setting up libgl1:armhf (1.7.0-1build1) ... 375s Setting up adwaita-icon-theme (48~beta-3) ... 375s update-alternatives: using /usr/share/icons/Adwaita/cursor.theme to provide /usr/share/icons/default/index.theme (x-cursor-theme) in auto mode 375s Setting up libcups2t64:armhf (2.4.11-0ubuntu2) ... 375s Setting up libgtk-3-common (3.24.48-3ubuntu1) ... 375s Setting up libheif1:armhf (1.19.5-1build1) ... 375s Setting up libheif-plugin-aomdec:armhf (1.19.5-1build1) ... 375s Setting up libheif-plugin-libde265:armhf (1.19.5-1build1) ... 375s Processing triggers for libc-bin (2.40-4ubuntu1) ... 375s Processing triggers for man-db (2.13.0-1) ... 375s Processing triggers for libglib2.0-0t64:armhf (2.83.3-2) ... 375s Processing triggers for shared-mime-info (2.4-5) ... 375s Warning: program compiled against libxml 212 using older 209 376s Processing triggers for sgml-base (1.31) ... 376s Setting up libfontconfig1:armhf (2.15.0-2ubuntu1) ... 376s Setting up fontconfig (2.15.0-2ubuntu1) ... 378s Regenerating fonts cache... done. 378s Setting up libpango-1.0-0:armhf (1.56.1-1) ... 378s Setting up libcairo2:armhf (1.18.2-2) ... 378s Setting up libgd3:armhf (2.3.3-12ubuntu3) ... 378s Setting up emboss-lib (6.6.0+dfsg-12ubuntu2) ... 378s Setting up libcairo-gobject2:armhf (1.18.2-2) ... 378s Setting up libpangoft2-1.0-0:armhf (1.56.1-1) ... 378s Setting up libpangocairo-1.0-0:armhf (1.56.1-1) ... 378s Setting up emboss (6.6.0+dfsg-12ubuntu2) ... 378s Setting up libgtk-3-0t64:armhf (3.24.48-3ubuntu1) ... 378s Processing triggers for ca-certificates-java (20240118) ... 378s Adding debian:ACCVRAIZ1.pem 378s Adding debian:AC_RAIZ_FNMT-RCM.pem 378s Adding debian:AC_RAIZ_FNMT-RCM_SERVIDORES_SEGUROS.pem 378s Adding debian:ANF_Secure_Server_Root_CA.pem 378s Adding debian:Actalis_Authentication_Root_CA.pem 378s Adding debian:AffirmTrust_Commercial.pem 378s Adding debian:AffirmTrust_Networking.pem 378s Adding debian:AffirmTrust_Premium.pem 378s Adding debian:AffirmTrust_Premium_ECC.pem 378s Adding debian:Amazon_Root_CA_1.pem 378s Adding debian:Amazon_Root_CA_2.pem 378s Adding debian:Amazon_Root_CA_3.pem 378s Adding debian:Amazon_Root_CA_4.pem 378s Adding debian:Atos_TrustedRoot_2011.pem 378s Adding debian:Atos_TrustedRoot_Root_CA_ECC_TLS_2021.pem 378s Adding debian:Atos_TrustedRoot_Root_CA_RSA_TLS_2021.pem 378s Adding debian:Autoridad_de_Certificacion_Firmaprofesional_CIF_A62634068.pem 378s Adding debian:BJCA_Global_Root_CA1.pem 378s Adding debian:BJCA_Global_Root_CA2.pem 378s Adding debian:Baltimore_CyberTrust_Root.pem 378s Adding debian:Buypass_Class_2_Root_CA.pem 378s Adding debian:Buypass_Class_3_Root_CA.pem 378s Adding debian:CA_Disig_Root_R2.pem 378s Adding debian:CFCA_EV_ROOT.pem 378s Adding debian:COMODO_Certification_Authority.pem 378s Adding debian:COMODO_ECC_Certification_Authority.pem 378s Adding debian:COMODO_RSA_Certification_Authority.pem 378s Adding debian:Certainly_Root_E1.pem 378s Adding debian:Certainly_Root_R1.pem 378s Adding debian:Certigna.pem 378s Adding debian:Certigna_Root_CA.pem 378s Adding debian:Certum_EC-384_CA.pem 378s Adding debian:Certum_Trusted_Network_CA.pem 378s Adding debian:Certum_Trusted_Network_CA_2.pem 378s Adding debian:Certum_Trusted_Root_CA.pem 378s Adding debian:CommScope_Public_Trust_ECC_Root-01.pem 378s Adding debian:CommScope_Public_Trust_ECC_Root-02.pem 378s Adding debian:CommScope_Public_Trust_RSA_Root-01.pem 378s Adding debian:CommScope_Public_Trust_RSA_Root-02.pem 378s Adding debian:Comodo_AAA_Services_root.pem 378s Adding debian:D-TRUST_BR_Root_CA_1_2020.pem 378s Adding debian:D-TRUST_EV_Root_CA_1_2020.pem 378s Adding debian:D-TRUST_Root_Class_3_CA_2_2009.pem 378s Adding debian:D-TRUST_Root_Class_3_CA_2_EV_2009.pem 378s Adding debian:DigiCert_Assured_ID_Root_CA.pem 378s Adding debian:DigiCert_Assured_ID_Root_G2.pem 378s Adding debian:DigiCert_Assured_ID_Root_G3.pem 378s Adding debian:DigiCert_Global_Root_CA.pem 378s Adding debian:DigiCert_Global_Root_G2.pem 378s Adding debian:DigiCert_Global_Root_G3.pem 378s Adding debian:DigiCert_High_Assurance_EV_Root_CA.pem 378s Adding debian:DigiCert_TLS_ECC_P384_Root_G5.pem 378s Adding debian:DigiCert_TLS_RSA4096_Root_G5.pem 378s Adding debian:DigiCert_Trusted_Root_G4.pem 378s Adding debian:Entrust.net_Premium_2048_Secure_Server_CA.pem 378s Adding debian:Entrust_Root_Certification_Authority.pem 378s Adding debian:Entrust_Root_Certification_Authority_-_EC1.pem 378s Adding debian:Entrust_Root_Certification_Authority_-_G2.pem 378s Adding debian:Entrust_Root_Certification_Authority_-_G4.pem 378s Adding debian:FIRMAPROFESIONAL_CA_ROOT-A_WEB.pem 378s Adding debian:GDCA_TrustAUTH_R5_ROOT.pem 378s Adding debian:GLOBALTRUST_2020.pem 378s Adding debian:GTS_Root_R1.pem 378s Adding debian:GTS_Root_R2.pem 378s Adding debian:GTS_Root_R3.pem 378s Adding debian:GTS_Root_R4.pem 378s Adding debian:GlobalSign_ECC_Root_CA_-_R4.pem 378s Adding debian:GlobalSign_ECC_Root_CA_-_R5.pem 378s Adding debian:GlobalSign_Root_CA.pem 378s Adding debian:GlobalSign_Root_CA_-_R3.pem 379s Adding debian:GlobalSign_Root_CA_-_R6.pem 379s Adding debian:GlobalSign_Root_E46.pem 379s Adding debian:GlobalSign_Root_R46.pem 379s Adding debian:Go_Daddy_Class_2_CA.pem 379s Adding debian:Go_Daddy_Root_Certificate_Authority_-_G2.pem 379s Adding debian:HARICA_TLS_ECC_Root_CA_2021.pem 379s Adding debian:HARICA_TLS_RSA_Root_CA_2021.pem 379s Adding debian:Hellenic_Academic_and_Research_Institutions_ECC_RootCA_2015.pem 379s Adding debian:Hellenic_Academic_and_Research_Institutions_RootCA_2015.pem 379s Adding debian:HiPKI_Root_CA_-_G1.pem 379s Adding debian:Hongkong_Post_Root_CA_3.pem 379s Adding debian:ISRG_Root_X1.pem 379s Adding debian:ISRG_Root_X2.pem 379s Adding debian:IdenTrust_Commercial_Root_CA_1.pem 379s Adding debian:IdenTrust_Public_Sector_Root_CA_1.pem 379s Adding debian:Izenpe.com.pem 379s Adding debian:Microsec_e-Szigno_Root_CA_2009.pem 379s Adding debian:Microsoft_ECC_Root_Certificate_Authority_2017.pem 379s Adding debian:Microsoft_RSA_Root_Certificate_Authority_2017.pem 379s Adding debian:NAVER_Global_Root_Certification_Authority.pem 379s Adding debian:NetLock_Arany_=Class_Gold=_Főtanúsítvány.pem 379s Adding debian:OISTE_WISeKey_Global_Root_GB_CA.pem 379s Adding debian:OISTE_WISeKey_Global_Root_GC_CA.pem 379s Adding debian:QuoVadis_Root_CA_1_G3.pem 379s Adding debian:QuoVadis_Root_CA_2.pem 379s Adding debian:QuoVadis_Root_CA_2_G3.pem 379s Adding debian:QuoVadis_Root_CA_3.pem 379s Adding debian:QuoVadis_Root_CA_3_G3.pem 379s Adding debian:SSL.com_EV_Root_Certification_Authority_ECC.pem 379s Adding debian:SSL.com_EV_Root_Certification_Authority_RSA_R2.pem 379s Adding debian:SSL.com_Root_Certification_Authority_ECC.pem 379s Adding debian:SSL.com_Root_Certification_Authority_RSA.pem 379s Adding debian:SSL.com_TLS_ECC_Root_CA_2022.pem 379s Adding debian:SSL.com_TLS_RSA_Root_CA_2022.pem 379s Adding debian:SZAFIR_ROOT_CA2.pem 379s Adding debian:Sectigo_Public_Server_Authentication_Root_E46.pem 379s Adding debian:Sectigo_Public_Server_Authentication_Root_R46.pem 379s Adding debian:SecureSign_RootCA11.pem 379s Adding debian:SecureSign_Root_CA12.pem 379s Adding debian:SecureSign_Root_CA14.pem 379s Adding debian:SecureSign_Root_CA15.pem 379s Adding debian:SecureTrust_CA.pem 379s Adding debian:Secure_Global_CA.pem 379s Adding debian:Security_Communication_ECC_RootCA1.pem 379s Adding debian:Security_Communication_RootCA2.pem 379s Adding debian:Security_Communication_RootCA3.pem 379s Adding debian:Starfield_Class_2_CA.pem 379s Adding debian:Starfield_Root_Certificate_Authority_-_G2.pem 379s Adding debian:Starfield_Services_Root_Certificate_Authority_-_G2.pem 379s Adding debian:SwissSign_Gold_CA_-_G2.pem 379s Adding debian:SwissSign_Silver_CA_-_G2.pem 379s Adding debian:T-TeleSec_GlobalRoot_Class_2.pem 379s Adding debian:T-TeleSec_GlobalRoot_Class_3.pem 379s Adding debian:TUBITAK_Kamu_SM_SSL_Kok_Sertifikasi_-_Surum_1.pem 379s Adding debian:TWCA_CYBER_Root_CA.pem 379s Adding debian:TWCA_Global_Root_CA.pem 379s Adding debian:TWCA_Root_Certification_Authority.pem 379s Adding debian:Telekom_Security_TLS_ECC_Root_2020.pem 379s Adding debian:Telekom_Security_TLS_RSA_Root_2023.pem 379s Adding debian:TeliaSonera_Root_CA_v1.pem 379s Adding debian:Telia_Root_CA_v2.pem 379s Adding debian:TrustAsia_Global_Root_CA_G3.pem 379s Adding debian:TrustAsia_Global_Root_CA_G4.pem 379s Adding debian:Trustwave_Global_Certification_Authority.pem 379s Adding debian:Trustwave_Global_ECC_P256_Certification_Authority.pem 379s Adding debian:Trustwave_Global_ECC_P384_Certification_Authority.pem 379s Adding debian:TunTrust_Root_CA.pem 379s Adding debian:UCA_Extended_Validation_Root.pem 379s Adding debian:UCA_Global_G2_Root.pem 379s Adding debian:USERTrust_ECC_Certification_Authority.pem 379s Adding debian:USERTrust_RSA_Certification_Authority.pem 379s Adding debian:XRamp_Global_CA_Root.pem 379s Adding debian:certSIGN_ROOT_CA.pem 379s Adding debian:certSIGN_Root_CA_G2.pem 379s Adding debian:e-Szigno_Root_CA_2017.pem 379s Adding debian:ePKI_Root_Certification_Authority.pem 379s Adding debian:emSign_ECC_Root_CA_-_C3.pem 379s Adding debian:emSign_ECC_Root_CA_-_G3.pem 379s Adding debian:emSign_Root_CA_-_C1.pem 379s Adding debian:emSign_Root_CA_-_G1.pem 379s Adding debian:vTrus_ECC_Root_CA.pem 379s Adding debian:vTrus_Root_CA.pem 379s done. 379s Setting up openjdk-21-jre:armhf (21.0.6+7-1) ... 379s Setting up default-jre-headless (2:1.21-76) ... 379s Setting up default-jre (2:1.21-76) ... 379s Setting up jemboss (6.6.0+dfsg-12ubuntu2) ... 379s Processing triggers for libc-bin (2.40-4ubuntu1) ... 399s autopkgtest [06:42:45]: test run-unit-test: [----------------------- 401s >ACGTseq SI000001 Simple 60-base sequence for testing USAs 401s AAAAACCCCCGGGGTTTTAAACCCGGTTACTGCCAATTTGGGCCCCAAAATTTTTGGGGG 401s >TCGAseq SI000002 Simple 60-base sequence for testing USAs 401s TTTTTCCCCCGGGGAAAATTTCCCGGAATCAGCCTTAAAGGGCCCCTTTTAAAAAGGGGG 401s >TGACseq SI000003 Simple 60-base sequence for testing USAs 401s TTTTTGGGGGAAAACCCCTTTGGGAACCTGCAGGTTCCCAAAGGGGTTTTCCCCCAAAAA 401s >AGTCseq SI000004 Simple 60-base sequence for testing USAs 401s AAAAAGGGGGTTTTCCCCAAAGGGTTCCAGCTGGAACCCTTTGGGGAAAACCCCCTTTTT 401s Read and write (return) sequences 401s PASS 402s autopkgtest [06:42:48]: test run-unit-test: -----------------------] 406s autopkgtest [06:42:52]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 406s run-unit-test PASS 410s autopkgtest [06:42:56]: @@@@@@@@@@@@@@@@@@@@ summary 410s run-unit-test PASS