0s autopkgtest [16:46:17]: starting date and time: 2025-03-15 16:46:17+0000 0s autopkgtest [16:46:17]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [16:46:17]: host juju-7f2275-prod-proposed-migration-environment-15; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.1oq_q3wv/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade skewer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-15@bos03-arm64-2.secgroup --name adt-plucky-arm64-skewer-20250315-164616-juju-7f2275-prod-proposed-migration-environment-15-f82e4c16-c962-455d-a4e6-37efc20d1834 --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-15 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 162s autopkgtest [16:48:59]: testbed dpkg architecture: arm64 162s autopkgtest [16:48:59]: testbed apt version: 2.9.33 162s autopkgtest [16:48:59]: @@@@@@@@@@@@@@@@@@@@ test bed setup 163s autopkgtest [16:49:00]: testbed release detected to be: None 163s autopkgtest [16:49:00]: updating testbed package index (apt update) 164s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 164s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 164s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 164s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 164s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 164s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [99.7 kB] 165s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [379 kB] 165s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [111 kB] 165s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 c-n-f Metadata [1856 B] 165s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 c-n-f Metadata [116 B] 165s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [324 kB] 166s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 c-n-f Metadata [14.7 kB] 166s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [4948 B] 166s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 c-n-f Metadata [268 B] 166s Fetched 1078 kB in 2s (542 kB/s) 167s Reading package lists... 168s + lsb_release --codename --short 168s + RELEASE=plucky 168s + cat 168s + [ plucky != trusty ] 168s + DEBIAN_FRONTEND=noninteractive eatmydata apt-get -y --allow-downgrades -o Dpkg::Options::=--force-confnew dist-upgrade 168s Reading package lists... 168s Building dependency tree... 168s Reading state information... 168s Calculating upgrade... 169s Calculating upgrade... 169s The following packages will be upgraded: 169s pinentry-curses python3-jinja2 strace 169s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 169s Need to get 647 kB of archives. 169s After this operation, 11.3 kB of additional disk space will be used. 169s Get:1 http://ftpmaster.internal/ubuntu plucky/main arm64 strace arm64 6.13+ds-1ubuntu1 [499 kB] 170s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 pinentry-curses arm64 1.3.1-2ubuntu3 [39.2 kB] 170s Get:3 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 171s Fetched 647 kB in 1s (599 kB/s) 171s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 171s Preparing to unpack .../strace_6.13+ds-1ubuntu1_arm64.deb ... 171s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 171s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_arm64.deb ... 171s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 171s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 171s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 171s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 171s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 171s Setting up strace (6.13+ds-1ubuntu1) ... 171s Processing triggers for man-db (2.13.0-1) ... 172s + rm /etc/apt/preferences.d/force-downgrade-to-release.pref 172s + /usr/lib/apt/apt-helper analyze-pattern ?true 172s + uname+ sed s/\./\\./g 172s -r 172s + running_kernel_pattern=^linux-.*6\.14\.0-10-generic.* 172s + apt list ?obsolete 172s + tail -n+2 172s + grep -v ^linux-.*6\.14\.0-10-generic.* 172s + cut -d/ -f1 172s + obsolete_pkgs=linux-headers-6.11.0-8-generic 172s linux-headers-6.11.0-8 172s linux-image-6.11.0-8-generic 172s linux-modules-6.11.0-8-generic 172s linux-tools-6.11.0-8-generic 172s linux-tools-6.11.0-8 172s + DEBIAN_FRONTEND=noninteractive eatmydata apt-get -y purge --autoremove linux-headers-6.11.0-8-generic linux-headers-6.11.0-8 linux-image-6.11.0-8-generic linux-modules-6.11.0-8-generic linux-tools-6.11.0-8-generic linux-tools-6.11.0-8 172s Reading package lists... 173s Building dependency tree... 173s Reading state information... 173s Solving dependencies... 173s The following packages will be REMOVED: 173s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 173s libunwind8* linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 173s linux-image-6.11.0-8-generic* linux-modules-6.11.0-8-generic* 173s linux-tools-6.11.0-8* linux-tools-6.11.0-8-generic* 174s 0 upgraded, 0 newly installed, 11 to remove and 5 not upgraded. 174s After this operation, 267 MB disk space will be freed. 174s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 174s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 174s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 174s Removing libpython3.12t64:arm64 (3.12.9-1) ... 174s Removing libpython3.12-stdlib:arm64 (3.12.9-1) ... 174s Removing libnsl2:arm64 (1.3.0-3build3) ... 174s Removing libpython3.12-minimal:arm64 (3.12.9-1) ... 174s Removing libunwind8:arm64 (1.6.2-3.1) ... 174s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 175s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 176s Removing linux-image-6.11.0-8-generic (6.11.0-8.8) ... 176s I: /boot/vmlinuz.old is now a symlink to vmlinuz-6.14.0-10-generic 176s I: /boot/initrd.img.old is now a symlink to initrd.img-6.14.0-10-generic 176s /etc/kernel/postrm.d/initramfs-tools: 176s update-initramfs: Deleting /boot/initrd.img-6.11.0-8-generic 176s /etc/kernel/postrm.d/zz-flash-kernel: 176s flash-kernel: Kernel 6.11.0-8-generic has been removed. 176s flash-kernel: A higher version (6.14.0-10-generic) is still installed, no reflashing required. 177s /etc/kernel/postrm.d/zz-update-grub: 177s Sourcing file `/etc/default/grub' 177s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 177s Generating grub configuration file ... 177s Found linux image: /boot/vmlinuz-6.14.0-10-generic 177s Found initrd image: /boot/initrd.img-6.14.0-10-generic 177s Warning: os-prober will not be executed to detect other bootable partitions. 177s Systems on them will not be added to the GRUB boot configuration. 177s Check GRUB_DISABLE_OS_PROBER documentation entry. 177s Adding boot menu entry for UEFI Firmware Settings ... 177s done 177s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 177s Processing triggers for libc-bin (2.41-1ubuntu1) ... 178s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81650 files and directories currently installed.) 178s Purging configuration files for linux-image-6.11.0-8-generic (6.11.0-8.8) ... 178s Purging configuration files for libpython3.12-minimal:arm64 (3.12.9-1) ... 178s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 178s + grep -q trusty /etc/lsb-release 178s + [ ! -d /usr/share/doc/unattended-upgrades ] 178s + [ ! -d /usr/share/doc/lxd ] 178s + [ ! -d /usr/share/doc/lxd-client ] 178s + [ ! -d /usr/share/doc/snapd ] 178s + type iptables 178s + cat 178s + chmod 755 /etc/rc.local 178s + . /etc/rc.local 178s + iptables -w -t mangle -A FORWARD -p tcp --tcp-flags SYN,RST SYN -j TCPMSS --clamp-mss-to-pmtu 178s + iptables -A OUTPUT -d 10.255.255.1/32 -p tcp -j DROP 178s + iptables -A OUTPUT -d 10.255.255.2/32 -p tcp -j DROP 178s + uname -m 178s + [ aarch64 = ppc64le ] 178s + [ -d /run/systemd/system ] 178s + systemd-detect-virt --quiet --vm 178s + mkdir -p /etc/systemd/system/systemd-random-seed.service.d/ 178s + cat 178s + grep -q lz4 /etc/initramfs-tools/initramfs.conf 178s + echo COMPRESS=lz4 178s autopkgtest [16:49:15]: upgrading testbed (apt dist-upgrade and autopurge) 178s Reading package lists... 178s Building dependency tree... 178s Reading state information... 179s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 179s Starting 2 pkgProblemResolver with broken count: 0 179s Done 180s Entering ResolveByKeep 180s 180s Calculating upgrade... 181s The following packages will be upgraded: 181s libc-bin libc-dev-bin libc6 libc6-dev locales 181s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 181s Need to get 9530 kB of archives. 181s After this operation, 0 B of additional disk space will be used. 181s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6-dev arm64 2.41-1ubuntu2 [1750 kB] 183s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-dev-bin arm64 2.41-1ubuntu2 [24.0 kB] 183s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6 arm64 2.41-1ubuntu2 [2910 kB] 187s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-bin arm64 2.41-1ubuntu2 [600 kB] 187s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 locales all 2.41-1ubuntu2 [4246 kB] 192s Preconfiguring packages ... 193s Fetched 9530 kB in 12s (827 kB/s) 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 193s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_arm64.deb ... 193s Unpacking libc6-dev:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 193s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_arm64.deb ... 193s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 193s Preparing to unpack .../libc6_2.41-1ubuntu2_arm64.deb ... 193s Unpacking libc6:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 193s Setting up libc6:arm64 (2.41-1ubuntu2) ... 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 193s Preparing to unpack .../libc-bin_2.41-1ubuntu2_arm64.deb ... 193s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 193s Setting up libc-bin (2.41-1ubuntu2) ... 194s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 194s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 194s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 194s Setting up locales (2.41-1ubuntu2) ... 195s Generating locales (this might take a while)... 196s en_US.UTF-8... done 196s Generation complete. 196s Setting up libc-dev-bin (2.41-1ubuntu2) ... 196s Setting up libc6-dev:arm64 (2.41-1ubuntu2) ... 196s Processing triggers for man-db (2.13.0-1) ... 197s Processing triggers for systemd (257.3-1ubuntu3) ... 198s Reading package lists... 199s Building dependency tree... 199s Reading state information... 199s Starting pkgProblemResolver with broken count: 0 199s Starting 2 pkgProblemResolver with broken count: 0 199s Done 199s Solving dependencies... 200s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 200s autopkgtest [16:49:37]: rebooting testbed after setup commands that affected boot 227s autopkgtest [16:50:04]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP PREEMPT_DYNAMIC Wed Mar 12 15:45:31 UTC 2025 239s autopkgtest [16:50:16]: @@@@@@@@@@@@@@@@@@@@ apt-source skewer 242s Get:1 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (dsc) [1941 B] 242s Get:2 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (tar) [36.4 kB] 242s Get:3 http://ftpmaster.internal/ubuntu plucky/universe skewer 0.2.2-6 (diff) [21.8 kB] 242s gpgv: Signature made Sun Oct 31 14:43:32 2021 UTC 242s gpgv: using RSA key 3E99A526F5DCC0CBBF1CEEA600BAE74B343369F1 242s gpgv: issuer "nilesh@debian.org" 242s gpgv: Can't check signature: No public key 242s dpkg-source: warning: cannot verify inline signature for ./skewer_0.2.2-6.dsc: no acceptable signature found 242s autopkgtest [16:50:19]: testing package skewer version 0.2.2-6 243s autopkgtest [16:50:20]: build not needed 243s autopkgtest [16:50:20]: test run-unit-test: preparing testbed 243s Reading package lists... 244s Building dependency tree... 244s Reading state information... 244s Starting pkgProblemResolver with broken count: 0 244s Starting 2 pkgProblemResolver with broken count: 0 244s Done 245s The following NEW packages will be installed: 245s skewer 245s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 245s Need to get 82.7 kB of archives. 245s After this operation, 169 kB of additional disk space will be used. 245s Get:1 http://ftpmaster.internal/ubuntu plucky/universe arm64 skewer arm64 0.2.2-6 [82.7 kB] 245s Fetched 82.7 kB in 0s (236 kB/s) 246s Selecting previously unselected package skewer. 246s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 246s Preparing to unpack .../skewer_0.2.2-6_arm64.deb ... 246s Unpacking skewer (0.2.2-6) ... 246s Setting up skewer (0.2.2-6) ... 248s autopkgtest [16:50:25]: test run-unit-test: [----------------------- 248s |==> | (7.73%) |======> | (15.79%) |==========> | (23.94%) |==============> | (31.73%) |==================> | (39.85%) |======================> | (47.86%) |===========================> | (56.12%) |===============================> | (64.20%) |===================================> | (72.21%) |=======================================> | (80.23%) |===========================================> | (88.12%) |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 248s |================================================> | (99.99%).--. .-. 248s : .--': :.-. 248s `. `. : `'.' .--. .-..-..-. .--. .--. 248s _`, :: . `.' '_.': `; `; :' '_.': ..' 248s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 248s skewer v0.2.2 [April 4, 2016] 248s Parameters used: 248s -- 3' end adapter sequence (-x): TCGTATGCCGTCTTCTGCTTGT 248s -- maximum error ratio allowed (-r): 0.100 248s -- maximum indel error ratio allowed (-d): 0.000 248s -- minimum read length allowed after trimming (-l): 16 248s -- maximum read length for output (-L): 30 248s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 248s -- minimum overlap length for adapter detection (-k): 3 248s Sat Mar 15 16:50:26 2025 >> started 248s 248s Sat Mar 15 16:50:26 2025 >> done (0.003s) 248s 24 reads processed; of these: 248s 0 ( 0.00%) short reads filtered out after trimming by size control 248s 0 ( 0.00%) empty reads filtered out after trimming by size control 248s 24 (100.00%) long reads filtered out after trimming by size control 248s 0 ( 0.00%) reads available. 248s log has been saved to "output-trimmed.log". 248s |======> | (15.79%).--. .-. 248s : .--': :.-. 248s `. `. : `'.' .--. .-..-..-. .--. .--. 248s _`, :: . `.' '_.': `; `; :' '_.': ..' 248s `.__.':_;:_;`.__.'`.__.__.'`.__.':_; 248s skewer v0.2.2 [April 4, 2016] 248s Parameters used: 248s -- 3' end adapter sequences in file (-x): adapters.fa 248s A: ATGCGATCGACTCGACTAC 248s -- maximum error ratio allowed (-r): 0.100 248s -- maximum indel error ratio allowed (-d): 0.030 248s -- mean quality threshold (-Q): 9 248s -- minimum read length allowed after trimming (-l): 18 248s -- file format (-f): Solexa/Illumina 1.3+/Illumina 1.5+ FASTQ (auto detected) 248s -- minimum overlap length for adapter detection (-k): 3 248s -- number of concurrent threads (-t): 2 248s Sat Mar 15 16:50:26 2025 >> started 248s 248s Sat Mar 15 16:50:26 2025 >> done (0.004s) 248s 24 reads processed; of these: 248s 0 ( 0.00%) short reads filtered out after trimming by size control 248s 0 ( 0.00%) empty reads filtered out after trimming by size control 248s 24 (100.00%) reads available; of these: 248s 24 (100.00%) untrimmed reads available after processing 248s log has been saved to "trimmed-trimmed.log". 248s output-trimmed.log 248s trimmed-trimmed.log 248s PASS 248s |==============> | (31.73%) |======================> | (47.86%) |===============================> | (64.20%) |=======================================> | (80.23%) |===============================================> | (96.16%)Malformed fastq record 26: no '@' for id 248s |================================================> | (99.99%)autopkgtest [16:50:25]: test run-unit-test: -----------------------] 249s run-unit-test PASS 249s autopkgtest [16:50:26]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 250s autopkgtest [16:50:27]: @@@@@@@@@@@@@@@@@@@@ summary 250s run-unit-test PASS 266s nova [W] Using flock in prodstack6-arm64 266s flock: timeout while waiting to get lock 266s Creating nova instance adt-plucky-arm64-skewer-20250315-164616-juju-7f2275-prod-proposed-migration-environment-15-f82e4c16-c962-455d-a4e6-37efc20d1834 from image adt/ubuntu-plucky-arm64-server-20250315.img (UUID bd6e766c-b51f-4b53-86d6-23aa4d18f524)... 266s nova [W] Timed out waiting for f7a03139-dc8f-410a-89e8-e8ab5dce0b06 to get deleted.