0s autopkgtest [16:41:39]: starting date and time: 2025-03-15 16:41:39+0000 0s autopkgtest [16:41:39]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [16:41:39]: host juju-7f2275-prod-proposed-migration-environment-20; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.34itp4ev/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-20@bos03-arm64-23.secgroup --name adt-plucky-arm64-seqkit-20250315-164139-juju-7f2275-prod-proposed-migration-environment-20-ed1bdc53-0809-4577-9f69-c6cb0623b1df --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-20 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 187s autopkgtest [16:44:46]: testbed dpkg architecture: arm64 187s autopkgtest [16:44:46]: testbed apt version: 2.9.33 188s autopkgtest [16:44:47]: @@@@@@@@@@@@@@@@@@@@ test bed setup 188s autopkgtest [16:44:47]: testbed release detected to be: None 189s autopkgtest [16:44:48]: updating testbed package index (apt update) 189s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 189s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 189s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 189s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 189s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [99.7 kB] 190s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 190s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [379 kB] 190s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [111 kB] 190s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 c-n-f Metadata [1856 B] 190s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 c-n-f Metadata [116 B] 190s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [324 kB] 190s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 c-n-f Metadata [14.7 kB] 190s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [4948 B] 190s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 c-n-f Metadata [268 B] 191s Fetched 1078 kB in 2s (614 kB/s) 192s Reading package lists... 192s Reading package lists... 193s Building dependency tree... 193s Reading state information... 193s Calculating upgrade... 193s Calculating upgrade... 194s The following packages will be upgraded: 194s pinentry-curses python3-jinja2 strace 194s 3 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 194s Need to get 647 kB of archives. 194s After this operation, 11.3 kB of additional disk space will be used. 194s Get:1 http://ftpmaster.internal/ubuntu plucky/main arm64 strace arm64 6.13+ds-1ubuntu1 [499 kB] 195s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 pinentry-curses arm64 1.3.1-2ubuntu3 [39.2 kB] 195s Get:3 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 196s Fetched 647 kB in 1s (498 kB/s) 196s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 196s Preparing to unpack .../strace_6.13+ds-1ubuntu1_arm64.deb ... 196s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 196s Preparing to unpack .../pinentry-curses_1.3.1-2ubuntu3_arm64.deb ... 196s Unpacking pinentry-curses (1.3.1-2ubuntu3) over (1.3.1-2ubuntu2) ... 196s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 197s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 197s Setting up pinentry-curses (1.3.1-2ubuntu3) ... 197s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 197s Setting up strace (6.13+ds-1ubuntu1) ... 197s Processing triggers for man-db (2.13.0-1) ... 198s Reading package lists... 198s Building dependency tree... 198s Reading state information... 198s Solving dependencies... 199s The following packages will be REMOVED: 199s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 199s libunwind8* linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 199s linux-image-6.11.0-8-generic* linux-modules-6.11.0-8-generic* 199s linux-tools-6.11.0-8* linux-tools-6.11.0-8-generic* 199s 0 upgraded, 0 newly installed, 11 to remove and 5 not upgraded. 199s After this operation, 267 MB disk space will be freed. 199s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 199s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 199s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 199s Removing libpython3.12t64:arm64 (3.12.9-1) ... 199s Removing libpython3.12-stdlib:arm64 (3.12.9-1) ... 199s Removing libnsl2:arm64 (1.3.0-3build3) ... 199s Removing libpython3.12-minimal:arm64 (3.12.9-1) ... 199s Removing libunwind8:arm64 (1.6.2-3.1) ... 199s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 200s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 201s Removing linux-image-6.11.0-8-generic (6.11.0-8.8) ... 202s I: /boot/vmlinuz.old is now a symlink to vmlinuz-6.14.0-10-generic 202s I: /boot/initrd.img.old is now a symlink to initrd.img-6.14.0-10-generic 202s /etc/kernel/postrm.d/initramfs-tools: 202s update-initramfs: Deleting /boot/initrd.img-6.11.0-8-generic 202s /etc/kernel/postrm.d/zz-flash-kernel: 202s flash-kernel: Kernel 6.11.0-8-generic has been removed. 202s flash-kernel: A higher version (6.14.0-10-generic) is still installed, no reflashing required. 202s /etc/kernel/postrm.d/zz-update-grub: 202s Sourcing file `/etc/default/grub' 202s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 202s Generating grub configuration file ... 202s Found linux image: /boot/vmlinuz-6.14.0-10-generic 202s Found initrd image: /boot/initrd.img-6.14.0-10-generic 203s Warning: os-prober will not be executed to detect other bootable partitions. 203s Systems on them will not be added to the GRUB boot configuration. 203s Check GRUB_DISABLE_OS_PROBER documentation entry. 203s Adding boot menu entry for UEFI Firmware Settings ... 203s done 203s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 203s Processing triggers for libc-bin (2.41-1ubuntu1) ... 203s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81650 files and directories currently installed.) 203s Purging configuration files for linux-image-6.11.0-8-generic (6.11.0-8.8) ... 203s Purging configuration files for libpython3.12-minimal:arm64 (3.12.9-1) ... 203s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 203s autopkgtest [16:45:02]: upgrading testbed (apt dist-upgrade and autopurge) 204s Reading package lists... 204s Building dependency tree... 204s Reading state information... 205s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 205s Starting 2 pkgProblemResolver with broken count: 0 205s Done 205s Entering ResolveByKeep 206s 206s Calculating upgrade... 206s The following packages will be upgraded: 206s libc-bin libc-dev-bin libc6 libc6-dev locales 208s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 208s Need to get 9530 kB of archives. 208s After this operation, 0 B of additional disk space will be used. 208s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6-dev arm64 2.41-1ubuntu2 [1750 kB] 208s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-dev-bin arm64 2.41-1ubuntu2 [24.0 kB] 208s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6 arm64 2.41-1ubuntu2 [2910 kB] 212s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-bin arm64 2.41-1ubuntu2 [600 kB] 212s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 locales all 2.41-1ubuntu2 [4246 kB] 218s Preconfiguring packages ... 218s Fetched 9530 kB in 11s (857 kB/s) 218s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 218s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_arm64.deb ... 218s Unpacking libc6-dev:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 218s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_arm64.deb ... 218s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 218s Preparing to unpack .../libc6_2.41-1ubuntu2_arm64.deb ... 218s Unpacking libc6:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 219s Setting up libc6:arm64 (2.41-1ubuntu2) ... 219s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 219s Preparing to unpack .../libc-bin_2.41-1ubuntu2_arm64.deb ... 219s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 219s Setting up libc-bin (2.41-1ubuntu2) ... 219s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 219s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 219s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 219s Setting up locales (2.41-1ubuntu2) ... 220s Generating locales (this might take a while)... 222s en_US.UTF-8... done 222s Generation complete. 222s Setting up libc-dev-bin (2.41-1ubuntu2) ... 222s Setting up libc6-dev:arm64 (2.41-1ubuntu2) ... 222s Processing triggers for man-db (2.13.0-1) ... 223s Processing triggers for systemd (257.3-1ubuntu3) ... 225s Reading package lists... 225s Building dependency tree... 225s Reading state information... 225s Starting pkgProblemResolver with broken count: 0 225s Starting 2 pkgProblemResolver with broken count: 0 225s Done 225s Solving dependencies... 226s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 226s autopkgtest [16:45:25]: rebooting testbed after setup commands that affected boot 249s autopkgtest [16:45:48]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP PREEMPT_DYNAMIC Wed Mar 12 15:45:31 UTC 2025 251s autopkgtest [16:45:50]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 284s Get:1 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (dsc) [3288 B] 284s Get:2 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (tar) [16.6 MB] 284s Get:3 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.9.0+ds-1 (diff) [10.8 MB] 284s gpgv: Signature made Thu Jan 9 12:18:12 2025 UTC 284s gpgv: using RSA key 4A5FD1CD115087CC03DC35C1D597897206C5F07F 284s gpgv: issuer "maytha8thedev@gmail.com" 284s gpgv: Can't check signature: No public key 284s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.9.0+ds-1.dsc: no acceptable signature found 286s autopkgtest [16:46:25]: testing package seqkit version 2.9.0+ds-1 289s autopkgtest [16:46:28]: build not needed 293s autopkgtest [16:46:32]: test run-unit-test: preparing testbed 293s Reading package lists... 294s Building dependency tree... 294s Reading state information... 294s Starting pkgProblemResolver with broken count: 0 295s Starting 2 pkgProblemResolver with broken count: 0 295s Done 297s The following NEW packages will be installed: 297s seqkit seqkit-examples ssshtest 297s 0 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. 297s Need to get 46.5 MB of archives. 297s After this operation, 57.3 MB of additional disk space will be used. 297s Get:1 http://ftpmaster.internal/ubuntu plucky/universe arm64 seqkit arm64 2.9.0+ds-1 [6957 kB] 305s Get:2 http://ftpmaster.internal/ubuntu plucky/universe arm64 seqkit-examples all 2.9.0+ds-1 [39.6 MB] 351s Get:3 http://ftpmaster.internal/ubuntu plucky/universe arm64 ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 351s Fetched 46.5 MB in 54s (865 kB/s) 351s Selecting previously unselected package seqkit. 351s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 351s Preparing to unpack .../seqkit_2.9.0+ds-1_arm64.deb ... 351s Unpacking seqkit (2.9.0+ds-1) ... 352s Selecting previously unselected package seqkit-examples. 352s Preparing to unpack .../seqkit-examples_2.9.0+ds-1_all.deb ... 352s Unpacking seqkit-examples (2.9.0+ds-1) ... 352s Selecting previously unselected package ssshtest. 352s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 352s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 352s Setting up seqkit (2.9.0+ds-1) ... 352s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 352s Setting up seqkit-examples (2.9.0+ds-1) ... 352s Processing triggers for man-db (2.13.0-1) ... 354s autopkgtest [16:47:33]: test run-unit-test: [----------------------- 355s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 356s 356s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 356s PASS "28645" == "28645" (LINE 28) 356s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 356s 356s seq_type ran in 0 sec with 2/92423 lines to STDERR/OUT 356s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 356s 356s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 356s PASS STDOUT CONTAINS "Protein" (LINE 42) 356s 356s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 356s PASS STDOUT CONTAINS "RNA" (LINE 48) 356s 356s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 356s PASS STDOUT CONTAINS "DNA" (LINE 54) 356s 356s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 356s PASS STDOUT CONTAINS "DNA" (LINE 60) 356s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 356s 356s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 356s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 357s 357s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 357s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 357s 357s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 357s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 357s 357s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 357s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 357s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 357s 357s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 357s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 357s 357s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 357s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 357s 357s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 357s PASS "a" == "a" (LINE 117) 357s 357s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 357s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 357s 357s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 357s PASS "gtn" == "gtn" (LINE 129) 357s 357s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 357s PASS "ACG" == "ACG" (LINE 135) 357s 357s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 357s PASS "N" == "N" (LINE 141) 357s 357s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 357s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 357s 357s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 357s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 358s 358s subseq_gtf ran in 1 sec with 2/2 lines to STDERR/OUT 358s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 358s 358s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 358s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 358s 358s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 358s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 358s 358s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 358s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 358s 358s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 359s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 359s [ERRO] xopen: no content 359s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 359s 359s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 359s Length correlation: 359s PASS "1" == "1" (LINE 220) 359s Length correlation: 359s PASS "1" == "1" (LINE 224) 359s Qual correlation: 359s PASS "1" == "1" (LINE 228) 359s 359s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 359s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 359s 359s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 359s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 360s 360s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT 360s PASS "100" == "100" (LINE 249) 360s 360s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 360s PASS "3074" == "3074" (LINE 254) 360s 360s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 360s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 360s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 360s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 360s 360s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 360s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 360s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 360s [INFO] 0 duplicated records removed 360s [INFO] sample by proportion 360s [INFO] 2814 sequences outputted 360s 360s common ran in 0 sec with 5/0 lines to STDERR/OUT 360s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 299) 360s 360s split ran in 0 sec with 104/0 lines to STDERR/OUT 360s [INFO] 0 duplicated records removed 360s PASS "100" == "100" (LINE 316) 360s [INFO] 0 duplicated records removed 361s PASS "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" == "b24f330decab556831d350ed8ea42ad7a793d9c9942cf959b000f99af4c8baef" (LINE 317) 361s [INFO] sample by proportion 361s [INFO] 2814 sequences outputted 361s [INFO] sample by proportion 361s [INFO] 2814 sequences outputted 361s PASS "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" == "e7004f1d75b051b87e3bb0dd36d0ce200143b3d13733cdcdf3c5ea2fa0cd9a79" (LINE 324) 361s 361s head ran in 0 sec with 0/30 lines to STDERR/OUT 361s PASS "10" == "10" (LINE 332) 361s PASS "snq" == "snq" (LINE 341) 361s PASS "seq_2" == "seq_2" (LINE 350) 361s 361s restart ran in 0 sec with 0/2 lines to STDERR/OUT 361s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 361s 361s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 361s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 362s 362s shuffle ran in 1 sec with 20/0 lines to STDERR/OUT 362s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 389) 362s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 362s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 393) 362s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 394) 362s PASS "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" == "04db2937f5d56977a5065ab0f67dee50c927af6d7baac0780dc93b1bbd5edfda" (LINE 395) 362s 362s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 362s Correlation: 362s PASS "1" == "1" (LINE 422) 363s 363s bam_mean_qual ran in 1 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 432) 363s 363s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 442) 363s 363s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 452) 363s 363s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 462) 363s 363s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 475) 363s 363s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 363s Correlation: 363s PASS "1" == "1" (LINE 488) 364s 364s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 498) 364s 364s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 364s PASS EXIT CODE (LINE 516) 364s 364s sana_fastq_sep_id ran in 0 sec with 9/0 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 529) 364s 364s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 539) 364s 364s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 550) 364s 364s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 558) 364s 364s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 364s PASS "0" == "0" (LINE 566) 368s 368s scat_fasta ran in 4 sec with 261/0 lines to STDERR/OUT 368s PASS "0" == "0" (LINE 615) 368s PASS "0" == "0" (LINE 617) 371s 371s scat_fastq ran in 3 sec with 531/0 lines to STDERR/OUT 371s PASS "0" == "0" (LINE 661) 371s PASS "0" == "0" (LINE 663) 371s [INFO] sample by number 371s [INFO] loading all sequences into memory... 371s [INFO] 9 sequences outputted 371s 371s faidx_id ran in 0 sec with 3/0 lines to STDERR/OUT 371s [INFO] read sequences ... 371s [INFO] 9 patterns loaded from file 371s [INFO] 9 sequences loaded 371s [INFO] sorting ... 371s [INFO] output ... 371s [INFO] read sequences ... 371s [INFO] 9 sequences loaded 371s [INFO] sorting ... 371s [INFO] output ... 371s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 679) 371s 371s faidx_full_head ran in 0 sec with 3/0 lines to STDERR/OUT 371s [INFO] read sequences ... 371s [INFO] 9 patterns loaded from file 371s [INFO] 9 sequences loaded 371s [INFO] sorting ... 371s [INFO] output ... 371s [INFO] read sequences ... 371s [INFO] 9 sequences loaded 371s [INFO] sorting ... 371s [INFO] output ... 371s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 686) 372s 372s faidx_region ran in 0 sec with 3/0 lines to STDERR/OUT 372s PASS "GACAGGAGAAGGGGGUGAGAGACUCCCUCCUGAACUCUCAGCCUUUAUCUCC" == "GACAGGAGAAGGGGGUGAGAGACUCCCUCCUGAACUCUCAGCCUUUAUCUCC" (LINE 695) 372s 372s sshtest v0.1.5 372s 372s 72 Tests 372s 0 Failures 372s 72 Successes 372s autopkgtest [16:47:51]: test run-unit-test: -----------------------] 372s autopkgtest [16:47:51]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 372s run-unit-test PASS 373s autopkgtest [16:47:52]: @@@@@@@@@@@@@@@@@@@@ summary 373s run-unit-test PASS 391s nova [W] Using flock in prodstack6-arm64 391s Creating nova instance adt-plucky-arm64-seqkit-20250315-164139-juju-7f2275-prod-proposed-migration-environment-20-ed1bdc53-0809-4577-9f69-c6cb0623b1df from image adt/ubuntu-plucky-arm64-server-20250315.img (UUID bd6e766c-b51f-4b53-86d6-23aa4d18f524)... 391s nova [W] Timed out waiting for 16ce84bd-60c9-4869-bc4a-295145110bc8 to get deleted.