0s autopkgtest [09:53:50]: starting date and time: 2024-11-13 09:53:50+0000 0s autopkgtest [09:53:50]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 0s autopkgtest [09:53:50]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.sasqnp8c/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-arm64-51.secgroup --name adt-plucky-arm64-presto-20241113-095349-juju-7f2275-prod-proposed-migration-environment-2-59630117-af7a-45a1-b769-520ec79d9be0 --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 82s autopkgtest [09:55:12]: testbed dpkg architecture: arm64 83s autopkgtest [09:55:13]: testbed apt version: 2.9.8 83s autopkgtest [09:55:13]: @@@@@@@@@@@@@@@@@@@@ test bed setup 84s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 84s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 84s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 84s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 84s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 84s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [104 kB] 84s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 Packages [50.3 kB] 84s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [601 kB] 84s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [17.1 kB] 84s Fetched 1794 kB in 1s (2023 kB/s) 85s Reading package lists... 88s Reading package lists... 88s Building dependency tree... 88s Reading state information... 90s Calculating upgrade... 91s The following NEW packages will be installed: 91s python3.13-gdbm 91s The following packages will be upgraded: 91s libpython3-stdlib python3 python3-gdbm python3-minimal 91s 4 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 91s Need to get 101 kB of archives. 91s After this operation, 141 kB of additional disk space will be used. 91s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-minimal arm64 3.12.7-1 [27.4 kB] 91s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3 arm64 3.12.7-1 [24.0 kB] 91s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libpython3-stdlib arm64 3.12.7-1 [10.0 kB] 91s Get:4 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13-gdbm arm64 3.13.0-2 [30.7 kB] 91s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-gdbm arm64 3.12.7-1 [8642 B] 92s Fetched 101 kB in 0s (238 kB/s) 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 93s Preparing to unpack .../python3-minimal_3.12.7-1_arm64.deb ... 93s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 93s Setting up python3-minimal (3.12.7-1) ... 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 93s Preparing to unpack .../python3_3.12.7-1_arm64.deb ... 93s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 93s Preparing to unpack .../libpython3-stdlib_3.12.7-1_arm64.deb ... 93s Unpacking libpython3-stdlib:arm64 (3.12.7-1) over (3.12.6-0ubuntu1) ... 93s Selecting previously unselected package python3.13-gdbm. 93s Preparing to unpack .../python3.13-gdbm_3.13.0-2_arm64.deb ... 93s Unpacking python3.13-gdbm (3.13.0-2) ... 93s Preparing to unpack .../python3-gdbm_3.12.7-1_arm64.deb ... 93s Unpacking python3-gdbm:arm64 (3.12.7-1) over (3.12.6-1ubuntu1) ... 93s Setting up python3.13-gdbm (3.13.0-2) ... 93s Setting up libpython3-stdlib:arm64 (3.12.7-1) ... 93s Setting up python3 (3.12.7-1) ... 94s Setting up python3-gdbm:arm64 (3.12.7-1) ... 94s Processing triggers for man-db (2.12.1-3) ... 95s Reading package lists... 96s Building dependency tree... 96s Reading state information... 97s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 97s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 97s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 97s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 97s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 98s Reading package lists... 98s Reading package lists... 99s Building dependency tree... 99s Reading state information... 99s Calculating upgrade... 100s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 100s Reading package lists... 100s Building dependency tree... 100s Reading state information... 101s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 104s autopkgtest [09:55:34]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP PREEMPT_DYNAMIC Mon Sep 16 14:19:41 UTC 2024 105s autopkgtest [09:55:35]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 107s Get:1 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (dsc) [2233 B] 107s Get:2 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (tar) [362 kB] 107s Get:3 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (diff) [20.8 kB] 107s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC 107s gpgv: using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7 107s gpgv: Can't check signature: No public key 107s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found 107s autopkgtest [09:55:37]: testing package presto version 0.7.2-1 109s autopkgtest [09:55:39]: build not needed 109s autopkgtest [09:55:39]: test pybuild-autopkgtest: preparing testbed 111s Reading package lists... 111s Building dependency tree... 111s Reading state information... 112s Starting pkgProblemResolver with broken count: 0 112s Starting 2 pkgProblemResolver with broken count: 0 112s Done 112s The following additional packages will be installed: 112s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-14 112s cpp-14-aarch64-linux-gnu cpp-aarch64-linux-gnu debhelper debugedit 112s dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config 112s fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ g++-14 112s g++-14-aarch64-linux-gnu g++-aarch64-linux-gnu gcc gcc-14 112s gcc-14-aarch64-linux-gnu gcc-aarch64-linux-gnu gettext intltool-debian 112s libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 libdebhelper-perl 112s libdeflate0 libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 112s libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b libhwasan0 112s libimagequant0 libisl23 libitm1 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 112s liblbfgsb0 liblcms2-2 liblerc4 liblsan0 libmbedcrypto7t64 libmbedtls14t64 112s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal 112s libpython3.13-stdlib libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool 112s libtsan2 libubsan1 libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 112s libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data po-debconf presto 112s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 112s python3-dateutil python3-decorator python3-freetype python3-numpy 112s python3-packaging python3-pandas python3-pandas-lib python3-pil 112s python3-presto python3-reportlab python3-rlpycairo python3-scipy python3-six 112s python3-tz python3.13 python3.13-minimal sgml-base vsearch w3c-sgml-lib 112s x11-common xfonts-encodings xfonts-utils xml-core 112s Suggested packages: 112s autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-14-locales 112s cpp-14-doc dh-make flit python3-build python3-installer python3-wheel 112s fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre gcc-14-doc 112s gcc-multilib manpages-dev flex bison gdb gcc-doc gdb-aarch64-linux-gnu 112s gettext-doc libasprintf-dev libgettextpo-dev liblcms2-utils libstdc++-14-doc 112s libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc libmail-box-perl 112s python3-tk bwa clustalo clustalw dialign dssp emboss fasttree mafft muscle3 112s phylip phyml prank probcons python3-mysqldb python3-matplotlib python3-mmtf 112s python3-rdflib python3-psycopg2 raxml samtools t-coffee wise gfortran 112s python-numpy-doc python3-dev python3-pytest python-pandas-doc 112s python3-statsmodels python-pil-doc pdf-viewer python3-egenix-mxtexttools 112s python-reportlab-doc rl-accel rl-renderpm python-scipy-doc python3.13-venv 112s python3.13-doc binfmt-support sgml-base-doc 112s Recommended packages: 112s libarchive-cpio-perl libltdl-dev libmail-sendmail-perl python-biopython-doc 112s python3-matplotlib python3-bottleneck python3-numexpr python3-odf 112s python3-openpyxl python3-bs4 python3-html5lib python3-lxml python3-tables 112s python3-olefile fonts-dejavu-extra 112s The following NEW packages will be installed: 112s autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential 112s cd-hit cpp cpp-14 cpp-14-aarch64-linux-gnu cpp-aarch64-linux-gnu debhelper 112s debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz 112s fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ 112s g++-14 g++-14-aarch64-linux-gnu g++-aarch64-linux-gnu gcc gcc-14 112s gcc-14-aarch64-linux-gnu gcc-aarch64-linux-gnu gettext intltool-debian 112s libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 libdebhelper-perl 112s libdeflate0 libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 112s libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b libhwasan0 112s libimagequant0 libisl23 libitm1 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 112s liblbfgsb0 liblcms2-2 liblerc4 liblsan0 libmbedcrypto7t64 libmbedtls14t64 112s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal 112s libpython3.13-stdlib libraqm0 libsharpyuv0 libstdc++-14-dev libtiff6 libtool 112s libtsan2 libubsan1 libwebp7 libwebpdemux2 libwebpmux3 libxcb-render0 112s libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data po-debconf presto 112s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 112s python3-dateutil python3-decorator python3-freetype python3-numpy 112s python3-packaging python3-pandas python3-pandas-lib python3-pil 112s python3-presto python3-reportlab python3-rlpycairo python3-scipy python3-six 112s python3-tz python3.13 python3.13-minimal sgml-base vsearch w3c-sgml-lib 112s x11-common xfonts-encodings xfonts-utils xml-core 112s 0 upgraded, 111 newly installed, 0 to remove and 0 not upgraded. 112s Need to get 141 MB/141 MB of archives. 112s After this operation, 529 MB of additional disk space will be used. 112s Get:1 /tmp/autopkgtest.Bxl9ws/1-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [824 B] 113s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 libpython3.13-minimal arm64 3.13.0-2 [877 kB] 113s Get:3 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13-minimal arm64 3.13.0-2 [2100 kB] 113s Get:4 http://ftpmaster.internal/ubuntu plucky/main arm64 sgml-base all 1.31 [11.4 kB] 113s Get:5 http://ftpmaster.internal/ubuntu plucky/main arm64 m4 arm64 1.4.19-4build1 [240 kB] 113s Get:6 http://ftpmaster.internal/ubuntu plucky/main arm64 autoconf all 2.72-3 [382 kB] 113s Get:7 http://ftpmaster.internal/ubuntu plucky/main arm64 autotools-dev all 20220109.1 [44.9 kB] 113s Get:8 http://ftpmaster.internal/ubuntu plucky/main arm64 automake all 1:1.16.5-1.3ubuntu1 [558 kB] 113s Get:9 http://ftpmaster.internal/ubuntu plucky/main arm64 autopoint all 0.22.5-2 [616 kB] 113s Get:10 http://ftpmaster.internal/ubuntu plucky/main arm64 libisl23 arm64 0.27-1 [676 kB] 113s Get:11 http://ftpmaster.internal/ubuntu plucky/main arm64 libmpc3 arm64 1.3.1-1build2 [56.8 kB] 113s Get:12 http://ftpmaster.internal/ubuntu plucky/main arm64 cpp-14-aarch64-linux-gnu arm64 14.2.0-8ubuntu1 [10.6 MB] 114s Get:13 http://ftpmaster.internal/ubuntu plucky/main arm64 cpp-14 arm64 14.2.0-8ubuntu1 [1028 B] 114s Get:14 http://ftpmaster.internal/ubuntu plucky/main arm64 cpp-aarch64-linux-gnu arm64 4:14.1.0-2ubuntu1 [5452 B] 114s Get:15 http://ftpmaster.internal/ubuntu plucky/main arm64 cpp arm64 4:14.1.0-2ubuntu1 [22.5 kB] 114s Get:16 http://ftpmaster.internal/ubuntu plucky/main arm64 libcc1-0 arm64 14.2.0-8ubuntu1 [49.7 kB] 114s Get:17 http://ftpmaster.internal/ubuntu plucky/main arm64 libgomp1 arm64 14.2.0-8ubuntu1 [145 kB] 114s Get:18 http://ftpmaster.internal/ubuntu plucky/main arm64 libitm1 arm64 14.2.0-8ubuntu1 [27.8 kB] 114s Get:19 http://ftpmaster.internal/ubuntu plucky/main arm64 libasan8 arm64 14.2.0-8ubuntu1 [2893 kB] 114s Get:20 http://ftpmaster.internal/ubuntu plucky/main arm64 liblsan0 arm64 14.2.0-8ubuntu1 [1283 kB] 114s Get:21 http://ftpmaster.internal/ubuntu plucky/main arm64 libtsan2 arm64 14.2.0-8ubuntu1 [2686 kB] 114s Get:22 http://ftpmaster.internal/ubuntu plucky/main arm64 libubsan1 arm64 14.2.0-8ubuntu1 [1151 kB] 114s Get:23 http://ftpmaster.internal/ubuntu plucky/main arm64 libhwasan0 arm64 14.2.0-8ubuntu1 [1598 kB] 114s Get:24 http://ftpmaster.internal/ubuntu plucky/main arm64 libgcc-14-dev arm64 14.2.0-8ubuntu1 [2594 kB] 114s Get:25 http://ftpmaster.internal/ubuntu plucky/main arm64 gcc-14-aarch64-linux-gnu arm64 14.2.0-8ubuntu1 [20.9 MB] 115s Get:26 http://ftpmaster.internal/ubuntu plucky/main arm64 gcc-14 arm64 14.2.0-8ubuntu1 [518 kB] 115s Get:27 http://ftpmaster.internal/ubuntu plucky/main arm64 gcc-aarch64-linux-gnu arm64 4:14.1.0-2ubuntu1 [1200 B] 115s Get:28 http://ftpmaster.internal/ubuntu plucky/main arm64 gcc arm64 4:14.1.0-2ubuntu1 [4994 B] 115s Get:29 http://ftpmaster.internal/ubuntu plucky/main arm64 libstdc++-14-dev arm64 14.2.0-8ubuntu1 [2476 kB] 115s Get:30 http://ftpmaster.internal/ubuntu plucky/main arm64 g++-14-aarch64-linux-gnu arm64 14.2.0-8ubuntu1 [12.1 MB] 115s Get:31 http://ftpmaster.internal/ubuntu plucky/main arm64 g++-14 arm64 14.2.0-8ubuntu1 [19.9 kB] 115s Get:32 http://ftpmaster.internal/ubuntu plucky/main arm64 g++-aarch64-linux-gnu arm64 4:14.1.0-2ubuntu1 [958 B] 115s Get:33 http://ftpmaster.internal/ubuntu plucky/main arm64 g++ arm64 4:14.1.0-2ubuntu1 [1080 B] 115s Get:34 http://ftpmaster.internal/ubuntu plucky/main arm64 build-essential arm64 12.10ubuntu1 [4932 B] 115s Get:35 http://ftpmaster.internal/ubuntu plucky/universe arm64 cd-hit arm64 4.8.1-4 [522 kB] 115s Get:36 http://ftpmaster.internal/ubuntu plucky/main arm64 libdebhelper-perl all 13.20ubuntu1 [94.2 kB] 115s Get:37 http://ftpmaster.internal/ubuntu plucky/main arm64 libtool all 2.4.7-7build1 [166 kB] 115s Get:38 http://ftpmaster.internal/ubuntu plucky/main arm64 dh-autoreconf all 20 [16.1 kB] 115s Get:39 http://ftpmaster.internal/ubuntu plucky/main arm64 libarchive-zip-perl all 1.68-1 [90.2 kB] 115s Get:40 http://ftpmaster.internal/ubuntu plucky/main arm64 libfile-stripnondeterminism-perl all 1.14.0-1 [20.1 kB] 115s Get:41 http://ftpmaster.internal/ubuntu plucky/main arm64 dh-strip-nondeterminism all 1.14.0-1 [5058 B] 115s Get:42 http://ftpmaster.internal/ubuntu plucky/main arm64 debugedit arm64 1:5.1-1 [45.9 kB] 115s Get:43 http://ftpmaster.internal/ubuntu plucky/main arm64 dwz arm64 0.15-1build6 [113 kB] 115s Get:44 http://ftpmaster.internal/ubuntu plucky/main arm64 gettext arm64 0.22.5-2 [930 kB] 115s Get:45 http://ftpmaster.internal/ubuntu plucky/main arm64 intltool-debian all 0.35.0+20060710.6 [23.2 kB] 115s Get:46 http://ftpmaster.internal/ubuntu plucky/main arm64 po-debconf all 1.0.21+nmu1 [233 kB] 115s Get:47 http://ftpmaster.internal/ubuntu plucky/main arm64 debhelper all 13.20ubuntu1 [893 kB] 115s Get:48 http://ftpmaster.internal/ubuntu plucky/universe arm64 dh-python all 6.20241024 [112 kB] 115s Get:49 http://ftpmaster.internal/ubuntu plucky/main arm64 fonts-dejavu-mono all 2.37-8 [502 kB] 116s Get:50 http://ftpmaster.internal/ubuntu plucky/main arm64 fonts-dejavu-core all 2.37-8 [835 kB] 116s Get:51 http://ftpmaster.internal/ubuntu plucky/main arm64 libfontenc1 arm64 1:1.1.8-1build1 [13.9 kB] 116s Get:52 http://ftpmaster.internal/ubuntu plucky/main arm64 x11-common all 1:7.7+23ubuntu3 [21.7 kB] 116s Get:53 http://ftpmaster.internal/ubuntu plucky/main arm64 xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 116s Get:54 http://ftpmaster.internal/ubuntu plucky/main arm64 xfonts-utils arm64 1:7.7+7 [95.6 kB] 116s Get:55 http://ftpmaster.internal/ubuntu plucky/main arm64 fonts-urw-base35 all 20200910-8 [11.0 MB] 116s Get:56 http://ftpmaster.internal/ubuntu plucky/main arm64 fontconfig-config arm64 2.15.0-1.1ubuntu2 [37.4 kB] 116s Get:57 http://ftpmaster.internal/ubuntu plucky/main arm64 libblas3 arm64 3.12.0-3build2 [152 kB] 116s Get:58 http://ftpmaster.internal/ubuntu plucky/main arm64 libfontconfig1 arm64 2.15.0-1.1ubuntu2 [142 kB] 116s Get:59 http://ftpmaster.internal/ubuntu plucky/main arm64 libpixman-1-0 arm64 0.44.0-3 [197 kB] 116s Get:60 http://ftpmaster.internal/ubuntu plucky/main arm64 libxcb-render0 arm64 1.17.0-2 [16.6 kB] 116s Get:61 http://ftpmaster.internal/ubuntu plucky/main arm64 libxcb-shm0 arm64 1.17.0-2 [5884 B] 116s Get:62 http://ftpmaster.internal/ubuntu plucky/main arm64 libxrender1 arm64 1:0.9.10-1.1build1 [18.8 kB] 116s Get:63 http://ftpmaster.internal/ubuntu plucky/main arm64 libcairo2 arm64 1.18.2-2 [560 kB] 116s Get:64 http://ftpmaster.internal/ubuntu plucky/main arm64 libdeflate0 arm64 1.22-1 [46.2 kB] 116s Get:65 http://ftpmaster.internal/ubuntu plucky/main arm64 libgfortran5 arm64 14.2.0-8ubuntu1 [438 kB] 116s Get:66 http://ftpmaster.internal/ubuntu plucky/main arm64 libgraphite2-3 arm64 1.3.14-2ubuntu1 [70.6 kB] 116s Get:67 http://ftpmaster.internal/ubuntu plucky/main arm64 libharfbuzz0b arm64 10.0.1-1 [487 kB] 116s Get:68 http://ftpmaster.internal/ubuntu plucky/main arm64 libimagequant0 arm64 2.18.0-1build1 [37.1 kB] 116s Get:69 http://ftpmaster.internal/ubuntu plucky/main arm64 libjpeg-turbo8 arm64 2.1.5-2ubuntu2 [163 kB] 116s Get:70 http://ftpmaster.internal/ubuntu plucky/main arm64 libjpeg8 arm64 8c-2ubuntu11 [2148 B] 116s Get:71 http://ftpmaster.internal/ubuntu plucky/main arm64 liblapack3 arm64 3.12.0-3build2 [2293 kB] 116s Get:72 http://ftpmaster.internal/ubuntu plucky/universe arm64 liblbfgsb0 arm64 3.0+dfsg.4-1build1 [27.7 kB] 116s Get:73 http://ftpmaster.internal/ubuntu plucky/main arm64 liblcms2-2 arm64 2.16-2 [170 kB] 116s Get:74 http://ftpmaster.internal/ubuntu plucky/main arm64 liblerc4 arm64 4.0.0+ds-4ubuntu2 [154 kB] 116s Get:75 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedcrypto7t64 arm64 2.28.8-1 [209 kB] 116s Get:76 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedx509-1t64 arm64 2.28.8-1 [47.2 kB] 116s Get:77 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedtls14t64 arm64 2.28.8-1 [82.2 kB] 116s Get:78 http://ftpmaster.internal/ubuntu plucky/main arm64 libpython3.13-stdlib arm64 3.13.0-2 [2073 kB] 116s Get:79 http://ftpmaster.internal/ubuntu plucky/main arm64 libraqm0 arm64 0.10.1-1build1 [14.7 kB] 116s Get:80 http://ftpmaster.internal/ubuntu plucky/main arm64 libsharpyuv0 arm64 1.4.0-0.1 [16.3 kB] 116s Get:81 http://ftpmaster.internal/ubuntu plucky/main arm64 libjbig0 arm64 2.1-6.1ubuntu2 [29.3 kB] 116s Get:82 http://ftpmaster.internal/ubuntu plucky/main arm64 libwebp7 arm64 1.4.0-0.1 [192 kB] 116s Get:83 http://ftpmaster.internal/ubuntu plucky/main arm64 libtiff6 arm64 4.5.1+git230720-4ubuntu4 [193 kB] 116s Get:84 http://ftpmaster.internal/ubuntu plucky/main arm64 libwebpdemux2 arm64 1.4.0-0.1 [12.3 kB] 116s Get:85 http://ftpmaster.internal/ubuntu plucky/main arm64 libwebpmux3 arm64 1.4.0-0.1 [25.1 kB] 116s Get:86 http://ftpmaster.internal/ubuntu plucky/universe arm64 ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 116s Get:87 http://ftpmaster.internal/ubuntu plucky/universe arm64 ncbi-blast+ arm64 2.16.0+ds-6 [14.7 MB] 117s Get:88 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-numpy arm64 1:1.26.4+ds-11build1 [3654 kB] 117s Get:89 http://ftpmaster.internal/ubuntu plucky/main arm64 libopenjp2-7 arm64 2.5.0-2ubuntu1 [182 kB] 117s Get:90 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-pil arm64 10.4.0-1ubuntu1 [456 kB] 117s Get:91 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-cairo arm64 1.26.1-2 [121 kB] 117s Get:92 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-freetype all 2.5.1-1 [92.3 kB] 117s Get:93 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-rlpycairo all 0.3.0-3 [9130 B] 117s Get:94 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-reportlab all 4.2.5-1 [1107 kB] 117s Get:95 http://ftpmaster.internal/ubuntu plucky/main arm64 xml-core all 0.19 [20.3 kB] 117s Get:96 http://ftpmaster.internal/ubuntu plucky/universe arm64 w3c-sgml-lib all 1.3-3 [280 kB] 117s Get:97 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-biopython arm64 1.84+dfsg-4 [1689 kB] 117s Get:98 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-six all 1.16.0-7 [13.1 kB] 117s Get:99 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-dateutil all 2.9.0-2 [80.3 kB] 117s Get:100 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-tz all 2024.1-2 [31.4 kB] 117s Get:101 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-pandas-lib arm64 2.2.3+dfsg-5 [4422 kB] 117s Get:102 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-pandas all 2.2.3+dfsg-5 [3112 kB] 117s Get:103 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-decorator all 5.1.1-5 [10.1 kB] 117s Get:104 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-scipy arm64 1.13.1-5 [16.3 MB] 118s Get:105 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-packaging all 24.1-1 [41.4 kB] 118s Get:106 http://ftpmaster.internal/ubuntu plucky/universe arm64 vsearch arm64 2.29.1-1 [430 kB] 118s Get:107 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-presto arm64 0.7.2-1 [80.7 kB] 118s Get:108 http://ftpmaster.internal/ubuntu plucky/universe arm64 presto all 0.7.2-1 [240 kB] 118s Get:109 http://ftpmaster.internal/ubuntu plucky/universe arm64 pybuild-plugin-autopkgtest all 6.20241024 [1746 B] 118s Get:110 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13 arm64 3.13.0-2 [719 kB] 118s Get:111 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-all arm64 3.12.7-1 [890 B] 119s Fetched 141 MB in 6s (23.6 MB/s) 119s Selecting previously unselected package libpython3.13-minimal:arm64. 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79931 files and directories currently installed.) 119s Preparing to unpack .../000-libpython3.13-minimal_3.13.0-2_arm64.deb ... 119s Unpacking libpython3.13-minimal:arm64 (3.13.0-2) ... 119s Selecting previously unselected package python3.13-minimal. 119s Preparing to unpack .../001-python3.13-minimal_3.13.0-2_arm64.deb ... 119s Unpacking python3.13-minimal (3.13.0-2) ... 119s Selecting previously unselected package sgml-base. 119s Preparing to unpack .../002-sgml-base_1.31_all.deb ... 119s Unpacking sgml-base (1.31) ... 119s Selecting previously unselected package m4. 119s Preparing to unpack .../003-m4_1.4.19-4build1_arm64.deb ... 119s Unpacking m4 (1.4.19-4build1) ... 119s Selecting previously unselected package autoconf. 119s Preparing to unpack .../004-autoconf_2.72-3_all.deb ... 119s Unpacking autoconf (2.72-3) ... 119s Selecting previously unselected package autotools-dev. 119s Preparing to unpack .../005-autotools-dev_20220109.1_all.deb ... 119s Unpacking autotools-dev (20220109.1) ... 119s Selecting previously unselected package automake. 119s Preparing to unpack .../006-automake_1%3a1.16.5-1.3ubuntu1_all.deb ... 119s Unpacking automake (1:1.16.5-1.3ubuntu1) ... 119s Selecting previously unselected package autopoint. 119s Preparing to unpack .../007-autopoint_0.22.5-2_all.deb ... 119s Unpacking autopoint (0.22.5-2) ... 119s Selecting previously unselected package libisl23:arm64. 119s Preparing to unpack .../008-libisl23_0.27-1_arm64.deb ... 119s Unpacking libisl23:arm64 (0.27-1) ... 120s Selecting previously unselected package libmpc3:arm64. 120s Preparing to unpack .../009-libmpc3_1.3.1-1build2_arm64.deb ... 120s Unpacking libmpc3:arm64 (1.3.1-1build2) ... 120s Selecting previously unselected package cpp-14-aarch64-linux-gnu. 120s Preparing to unpack .../010-cpp-14-aarch64-linux-gnu_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking cpp-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package cpp-14. 120s Preparing to unpack .../011-cpp-14_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking cpp-14 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package cpp-aarch64-linux-gnu. 120s Preparing to unpack .../012-cpp-aarch64-linux-gnu_4%3a14.1.0-2ubuntu1_arm64.deb ... 120s Unpacking cpp-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 120s Selecting previously unselected package cpp. 120s Preparing to unpack .../013-cpp_4%3a14.1.0-2ubuntu1_arm64.deb ... 120s Unpacking cpp (4:14.1.0-2ubuntu1) ... 120s Selecting previously unselected package libcc1-0:arm64. 120s Preparing to unpack .../014-libcc1-0_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libcc1-0:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libgomp1:arm64. 120s Preparing to unpack .../015-libgomp1_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libgomp1:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libitm1:arm64. 120s Preparing to unpack .../016-libitm1_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libitm1:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libasan8:arm64. 120s Preparing to unpack .../017-libasan8_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libasan8:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package liblsan0:arm64. 120s Preparing to unpack .../018-liblsan0_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking liblsan0:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libtsan2:arm64. 120s Preparing to unpack .../019-libtsan2_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libtsan2:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libubsan1:arm64. 120s Preparing to unpack .../020-libubsan1_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libubsan1:arm64 (14.2.0-8ubuntu1) ... 120s Selecting previously unselected package libhwasan0:arm64. 120s Preparing to unpack .../021-libhwasan0_14.2.0-8ubuntu1_arm64.deb ... 120s Unpacking libhwasan0:arm64 (14.2.0-8ubuntu1) ... 121s Selecting previously unselected package libgcc-14-dev:arm64. 121s Preparing to unpack .../022-libgcc-14-dev_14.2.0-8ubuntu1_arm64.deb ... 121s Unpacking libgcc-14-dev:arm64 (14.2.0-8ubuntu1) ... 121s Selecting previously unselected package gcc-14-aarch64-linux-gnu. 121s Preparing to unpack .../023-gcc-14-aarch64-linux-gnu_14.2.0-8ubuntu1_arm64.deb ... 121s Unpacking gcc-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 121s Selecting previously unselected package gcc-14. 121s Preparing to unpack .../024-gcc-14_14.2.0-8ubuntu1_arm64.deb ... 121s Unpacking gcc-14 (14.2.0-8ubuntu1) ... 121s Selecting previously unselected package gcc-aarch64-linux-gnu. 121s Preparing to unpack .../025-gcc-aarch64-linux-gnu_4%3a14.1.0-2ubuntu1_arm64.deb ... 121s Unpacking gcc-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 121s Selecting previously unselected package gcc. 121s Preparing to unpack .../026-gcc_4%3a14.1.0-2ubuntu1_arm64.deb ... 121s Unpacking gcc (4:14.1.0-2ubuntu1) ... 121s Selecting previously unselected package libstdc++-14-dev:arm64. 121s Preparing to unpack .../027-libstdc++-14-dev_14.2.0-8ubuntu1_arm64.deb ... 121s Unpacking libstdc++-14-dev:arm64 (14.2.0-8ubuntu1) ... 121s Selecting previously unselected package g++-14-aarch64-linux-gnu. 121s Preparing to unpack .../028-g++-14-aarch64-linux-gnu_14.2.0-8ubuntu1_arm64.deb ... 121s Unpacking g++-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 122s Selecting previously unselected package g++-14. 122s Preparing to unpack .../029-g++-14_14.2.0-8ubuntu1_arm64.deb ... 122s Unpacking g++-14 (14.2.0-8ubuntu1) ... 122s Selecting previously unselected package g++-aarch64-linux-gnu. 122s Preparing to unpack .../030-g++-aarch64-linux-gnu_4%3a14.1.0-2ubuntu1_arm64.deb ... 122s Unpacking g++-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 122s Selecting previously unselected package g++. 122s Preparing to unpack .../031-g++_4%3a14.1.0-2ubuntu1_arm64.deb ... 122s Unpacking g++ (4:14.1.0-2ubuntu1) ... 122s Selecting previously unselected package build-essential. 122s Preparing to unpack .../032-build-essential_12.10ubuntu1_arm64.deb ... 122s Unpacking build-essential (12.10ubuntu1) ... 122s Selecting previously unselected package cd-hit. 122s Preparing to unpack .../033-cd-hit_4.8.1-4_arm64.deb ... 122s Unpacking cd-hit (4.8.1-4) ... 122s Selecting previously unselected package libdebhelper-perl. 122s Preparing to unpack .../034-libdebhelper-perl_13.20ubuntu1_all.deb ... 122s Unpacking libdebhelper-perl (13.20ubuntu1) ... 122s Selecting previously unselected package libtool. 122s Preparing to unpack .../035-libtool_2.4.7-7build1_all.deb ... 122s Unpacking libtool (2.4.7-7build1) ... 122s Selecting previously unselected package dh-autoreconf. 122s Preparing to unpack .../036-dh-autoreconf_20_all.deb ... 122s Unpacking dh-autoreconf (20) ... 122s Selecting previously unselected package libarchive-zip-perl. 122s Preparing to unpack .../037-libarchive-zip-perl_1.68-1_all.deb ... 122s Unpacking libarchive-zip-perl (1.68-1) ... 122s Selecting previously unselected package libfile-stripnondeterminism-perl. 122s Preparing to unpack .../038-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... 122s Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... 122s Selecting previously unselected package dh-strip-nondeterminism. 122s Preparing to unpack .../039-dh-strip-nondeterminism_1.14.0-1_all.deb ... 122s Unpacking dh-strip-nondeterminism (1.14.0-1) ... 122s Selecting previously unselected package debugedit. 122s Preparing to unpack .../040-debugedit_1%3a5.1-1_arm64.deb ... 122s Unpacking debugedit (1:5.1-1) ... 122s Selecting previously unselected package dwz. 122s Preparing to unpack .../041-dwz_0.15-1build6_arm64.deb ... 122s Unpacking dwz (0.15-1build6) ... 122s Selecting previously unselected package gettext. 122s Preparing to unpack .../042-gettext_0.22.5-2_arm64.deb ... 122s Unpacking gettext (0.22.5-2) ... 122s Selecting previously unselected package intltool-debian. 122s Preparing to unpack .../043-intltool-debian_0.35.0+20060710.6_all.deb ... 122s Unpacking intltool-debian (0.35.0+20060710.6) ... 122s Selecting previously unselected package po-debconf. 122s Preparing to unpack .../044-po-debconf_1.0.21+nmu1_all.deb ... 122s Unpacking po-debconf (1.0.21+nmu1) ... 123s Selecting previously unselected package debhelper. 123s Preparing to unpack .../045-debhelper_13.20ubuntu1_all.deb ... 123s Unpacking debhelper (13.20ubuntu1) ... 123s Selecting previously unselected package dh-python. 123s Preparing to unpack .../046-dh-python_6.20241024_all.deb ... 123s Unpacking dh-python (6.20241024) ... 123s Selecting previously unselected package fonts-dejavu-mono. 123s Preparing to unpack .../047-fonts-dejavu-mono_2.37-8_all.deb ... 123s Unpacking fonts-dejavu-mono (2.37-8) ... 123s Selecting previously unselected package fonts-dejavu-core. 123s Preparing to unpack .../048-fonts-dejavu-core_2.37-8_all.deb ... 123s Unpacking fonts-dejavu-core (2.37-8) ... 123s Selecting previously unselected package libfontenc1:arm64. 123s Preparing to unpack .../049-libfontenc1_1%3a1.1.8-1build1_arm64.deb ... 123s Unpacking libfontenc1:arm64 (1:1.1.8-1build1) ... 123s Selecting previously unselected package x11-common. 123s Preparing to unpack .../050-x11-common_1%3a7.7+23ubuntu3_all.deb ... 123s Unpacking x11-common (1:7.7+23ubuntu3) ... 123s Selecting previously unselected package xfonts-encodings. 123s Preparing to unpack .../051-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 123s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 123s Selecting previously unselected package xfonts-utils. 123s Preparing to unpack .../052-xfonts-utils_1%3a7.7+7_arm64.deb ... 123s Unpacking xfonts-utils (1:7.7+7) ... 123s Selecting previously unselected package fonts-urw-base35. 123s Preparing to unpack .../053-fonts-urw-base35_20200910-8_all.deb ... 123s Unpacking fonts-urw-base35 (20200910-8) ... 123s Selecting previously unselected package fontconfig-config. 123s Preparing to unpack .../054-fontconfig-config_2.15.0-1.1ubuntu2_arm64.deb ... 124s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 124s Selecting previously unselected package libblas3:arm64. 124s Preparing to unpack .../055-libblas3_3.12.0-3build2_arm64.deb ... 124s Unpacking libblas3:arm64 (3.12.0-3build2) ... 124s Selecting previously unselected package libfontconfig1:arm64. 124s Preparing to unpack .../056-libfontconfig1_2.15.0-1.1ubuntu2_arm64.deb ... 124s Unpacking libfontconfig1:arm64 (2.15.0-1.1ubuntu2) ... 124s Selecting previously unselected package libpixman-1-0:arm64. 124s Preparing to unpack .../057-libpixman-1-0_0.44.0-3_arm64.deb ... 124s Unpacking libpixman-1-0:arm64 (0.44.0-3) ... 124s Selecting previously unselected package libxcb-render0:arm64. 124s Preparing to unpack .../058-libxcb-render0_1.17.0-2_arm64.deb ... 124s Unpacking libxcb-render0:arm64 (1.17.0-2) ... 124s Selecting previously unselected package libxcb-shm0:arm64. 124s Preparing to unpack .../059-libxcb-shm0_1.17.0-2_arm64.deb ... 124s Unpacking libxcb-shm0:arm64 (1.17.0-2) ... 124s Selecting previously unselected package libxrender1:arm64. 124s Preparing to unpack .../060-libxrender1_1%3a0.9.10-1.1build1_arm64.deb ... 124s Unpacking libxrender1:arm64 (1:0.9.10-1.1build1) ... 124s Selecting previously unselected package libcairo2:arm64. 124s Preparing to unpack .../061-libcairo2_1.18.2-2_arm64.deb ... 124s Unpacking libcairo2:arm64 (1.18.2-2) ... 124s Selecting previously unselected package libdeflate0:arm64. 124s Preparing to unpack .../062-libdeflate0_1.22-1_arm64.deb ... 124s Unpacking libdeflate0:arm64 (1.22-1) ... 124s Selecting previously unselected package libgfortran5:arm64. 124s Preparing to unpack .../063-libgfortran5_14.2.0-8ubuntu1_arm64.deb ... 124s Unpacking libgfortran5:arm64 (14.2.0-8ubuntu1) ... 124s Selecting previously unselected package libgraphite2-3:arm64. 124s Preparing to unpack .../064-libgraphite2-3_1.3.14-2ubuntu1_arm64.deb ... 124s Unpacking libgraphite2-3:arm64 (1.3.14-2ubuntu1) ... 124s Selecting previously unselected package libharfbuzz0b:arm64. 124s Preparing to unpack .../065-libharfbuzz0b_10.0.1-1_arm64.deb ... 124s Unpacking libharfbuzz0b:arm64 (10.0.1-1) ... 124s Selecting previously unselected package libimagequant0:arm64. 124s Preparing to unpack .../066-libimagequant0_2.18.0-1build1_arm64.deb ... 124s Unpacking libimagequant0:arm64 (2.18.0-1build1) ... 124s Selecting previously unselected package libjpeg-turbo8:arm64. 124s Preparing to unpack .../067-libjpeg-turbo8_2.1.5-2ubuntu2_arm64.deb ... 124s Unpacking libjpeg-turbo8:arm64 (2.1.5-2ubuntu2) ... 124s Selecting previously unselected package libjpeg8:arm64. 124s Preparing to unpack .../068-libjpeg8_8c-2ubuntu11_arm64.deb ... 124s Unpacking libjpeg8:arm64 (8c-2ubuntu11) ... 124s Selecting previously unselected package liblapack3:arm64. 124s Preparing to unpack .../069-liblapack3_3.12.0-3build2_arm64.deb ... 124s Unpacking liblapack3:arm64 (3.12.0-3build2) ... 124s Selecting previously unselected package liblbfgsb0:arm64. 124s Preparing to unpack .../070-liblbfgsb0_3.0+dfsg.4-1build1_arm64.deb ... 124s Unpacking liblbfgsb0:arm64 (3.0+dfsg.4-1build1) ... 124s Selecting previously unselected package liblcms2-2:arm64. 124s Preparing to unpack .../071-liblcms2-2_2.16-2_arm64.deb ... 124s Unpacking liblcms2-2:arm64 (2.16-2) ... 124s Selecting previously unselected package liblerc4:arm64. 124s Preparing to unpack .../072-liblerc4_4.0.0+ds-4ubuntu2_arm64.deb ... 124s Unpacking liblerc4:arm64 (4.0.0+ds-4ubuntu2) ... 124s Selecting previously unselected package libmbedcrypto7t64:arm64. 124s Preparing to unpack .../073-libmbedcrypto7t64_2.28.8-1_arm64.deb ... 124s Unpacking libmbedcrypto7t64:arm64 (2.28.8-1) ... 124s Selecting previously unselected package libmbedx509-1t64:arm64. 124s Preparing to unpack .../074-libmbedx509-1t64_2.28.8-1_arm64.deb ... 124s Unpacking libmbedx509-1t64:arm64 (2.28.8-1) ... 124s Selecting previously unselected package libmbedtls14t64:arm64. 124s Preparing to unpack .../075-libmbedtls14t64_2.28.8-1_arm64.deb ... 124s Unpacking libmbedtls14t64:arm64 (2.28.8-1) ... 124s Selecting previously unselected package libpython3.13-stdlib:arm64. 124s Preparing to unpack .../076-libpython3.13-stdlib_3.13.0-2_arm64.deb ... 124s Unpacking libpython3.13-stdlib:arm64 (3.13.0-2) ... 125s Selecting previously unselected package libraqm0:arm64. 125s Preparing to unpack .../077-libraqm0_0.10.1-1build1_arm64.deb ... 125s Unpacking libraqm0:arm64 (0.10.1-1build1) ... 125s Selecting previously unselected package libsharpyuv0:arm64. 125s Preparing to unpack .../078-libsharpyuv0_1.4.0-0.1_arm64.deb ... 125s Unpacking libsharpyuv0:arm64 (1.4.0-0.1) ... 125s Selecting previously unselected package libjbig0:arm64. 125s Preparing to unpack .../079-libjbig0_2.1-6.1ubuntu2_arm64.deb ... 125s Unpacking libjbig0:arm64 (2.1-6.1ubuntu2) ... 125s Selecting previously unselected package libwebp7:arm64. 125s Preparing to unpack .../080-libwebp7_1.4.0-0.1_arm64.deb ... 125s Unpacking libwebp7:arm64 (1.4.0-0.1) ... 125s Selecting previously unselected package libtiff6:arm64. 125s Preparing to unpack .../081-libtiff6_4.5.1+git230720-4ubuntu4_arm64.deb ... 125s Unpacking libtiff6:arm64 (4.5.1+git230720-4ubuntu4) ... 125s Selecting previously unselected package libwebpdemux2:arm64. 125s Preparing to unpack .../082-libwebpdemux2_1.4.0-0.1_arm64.deb ... 125s Unpacking libwebpdemux2:arm64 (1.4.0-0.1) ... 125s Selecting previously unselected package libwebpmux3:arm64. 125s Preparing to unpack .../083-libwebpmux3_1.4.0-0.1_arm64.deb ... 125s Unpacking libwebpmux3:arm64 (1.4.0-0.1) ... 125s Selecting previously unselected package ncbi-data. 125s Preparing to unpack .../084-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 125s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 125s Selecting previously unselected package ncbi-blast+. 125s Preparing to unpack .../085-ncbi-blast+_2.16.0+ds-6_arm64.deb ... 125s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 125s Selecting previously unselected package python3-numpy. 125s Preparing to unpack .../086-python3-numpy_1%3a1.26.4+ds-11build1_arm64.deb ... 125s Unpacking python3-numpy (1:1.26.4+ds-11build1) ... 126s Selecting previously unselected package libopenjp2-7:arm64. 126s Preparing to unpack .../087-libopenjp2-7_2.5.0-2ubuntu1_arm64.deb ... 126s Unpacking libopenjp2-7:arm64 (2.5.0-2ubuntu1) ... 126s Selecting previously unselected package python3-pil:arm64. 126s Preparing to unpack .../088-python3-pil_10.4.0-1ubuntu1_arm64.deb ... 126s Unpacking python3-pil:arm64 (10.4.0-1ubuntu1) ... 126s Selecting previously unselected package python3-cairo. 126s Preparing to unpack .../089-python3-cairo_1.26.1-2_arm64.deb ... 126s Unpacking python3-cairo (1.26.1-2) ... 126s Selecting previously unselected package python3-freetype. 126s Preparing to unpack .../090-python3-freetype_2.5.1-1_all.deb ... 126s Unpacking python3-freetype (2.5.1-1) ... 126s Selecting previously unselected package python3-rlpycairo. 126s Preparing to unpack .../091-python3-rlpycairo_0.3.0-3_all.deb ... 126s Unpacking python3-rlpycairo (0.3.0-3) ... 126s Selecting previously unselected package python3-reportlab. 126s Preparing to unpack .../092-python3-reportlab_4.2.5-1_all.deb ... 126s Unpacking python3-reportlab (4.2.5-1) ... 126s Selecting previously unselected package xml-core. 126s Preparing to unpack .../093-xml-core_0.19_all.deb ... 126s Unpacking xml-core (0.19) ... 126s Selecting previously unselected package w3c-sgml-lib. 126s Preparing to unpack .../094-w3c-sgml-lib_1.3-3_all.deb ... 126s Unpacking w3c-sgml-lib (1.3-3) ... 126s Selecting previously unselected package python3-biopython. 126s Preparing to unpack .../095-python3-biopython_1.84+dfsg-4_arm64.deb ... 126s Unpacking python3-biopython (1.84+dfsg-4) ... 126s Selecting previously unselected package python3-six. 126s Preparing to unpack .../096-python3-six_1.16.0-7_all.deb ... 126s Unpacking python3-six (1.16.0-7) ... 126s Selecting previously unselected package python3-dateutil. 126s Preparing to unpack .../097-python3-dateutil_2.9.0-2_all.deb ... 126s Unpacking python3-dateutil (2.9.0-2) ... 126s Selecting previously unselected package python3-tz. 126s Preparing to unpack .../098-python3-tz_2024.1-2_all.deb ... 126s Unpacking python3-tz (2024.1-2) ... 126s Selecting previously unselected package python3-pandas-lib:arm64. 126s Preparing to unpack .../099-python3-pandas-lib_2.2.3+dfsg-5_arm64.deb ... 126s Unpacking python3-pandas-lib:arm64 (2.2.3+dfsg-5) ... 127s Selecting previously unselected package python3-pandas. 127s Preparing to unpack .../100-python3-pandas_2.2.3+dfsg-5_all.deb ... 127s Unpacking python3-pandas (2.2.3+dfsg-5) ... 127s Selecting previously unselected package python3-decorator. 127s Preparing to unpack .../101-python3-decorator_5.1.1-5_all.deb ... 127s Unpacking python3-decorator (5.1.1-5) ... 127s Selecting previously unselected package python3-scipy. 127s Preparing to unpack .../102-python3-scipy_1.13.1-5_arm64.deb ... 127s Unpacking python3-scipy (1.13.1-5) ... 127s Selecting previously unselected package python3-packaging. 127s Preparing to unpack .../103-python3-packaging_24.1-1_all.deb ... 127s Unpacking python3-packaging (24.1-1) ... 127s Selecting previously unselected package vsearch. 127s Preparing to unpack .../104-vsearch_2.29.1-1_arm64.deb ... 127s Unpacking vsearch (2.29.1-1) ... 127s Selecting previously unselected package python3-presto. 127s Preparing to unpack .../105-python3-presto_0.7.2-1_arm64.deb ... 127s Unpacking python3-presto (0.7.2-1) ... 128s Selecting previously unselected package presto. 128s Preparing to unpack .../106-presto_0.7.2-1_all.deb ... 128s Unpacking presto (0.7.2-1) ... 128s Selecting previously unselected package pybuild-plugin-autopkgtest. 128s Preparing to unpack .../107-pybuild-plugin-autopkgtest_6.20241024_all.deb ... 128s Unpacking pybuild-plugin-autopkgtest (6.20241024) ... 128s Selecting previously unselected package python3.13. 128s Preparing to unpack .../108-python3.13_3.13.0-2_arm64.deb ... 128s Unpacking python3.13 (3.13.0-2) ... 128s Selecting previously unselected package python3-all. 128s Preparing to unpack .../109-python3-all_3.12.7-1_arm64.deb ... 128s Unpacking python3-all (3.12.7-1) ... 128s Selecting previously unselected package autopkgtest-satdep. 128s Preparing to unpack .../110-1-autopkgtest-satdep.deb ... 128s Unpacking autopkgtest-satdep (0) ... 128s Setting up dh-python (6.20241024) ... 128s Setting up libgraphite2-3:arm64 (1.3.14-2ubuntu1) ... 128s Setting up liblcms2-2:arm64 (2.16-2) ... 128s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 128s Setting up libpixman-1-0:arm64 (0.44.0-3) ... 128s Setting up libsharpyuv0:arm64 (1.4.0-0.1) ... 128s Setting up liblerc4:arm64 (4.0.0+ds-4ubuntu2) ... 128s Setting up libmbedcrypto7t64:arm64 (2.28.8-1) ... 128s Setting up libxrender1:arm64 (1:0.9.10-1.1build1) ... 128s Setting up libxcb-render0:arm64 (1.17.0-2) ... 128s Setting up libarchive-zip-perl (1.68-1) ... 128s Setting up vsearch (2.29.1-1) ... 128s Setting up libdebhelper-perl (13.20ubuntu1) ... 128s Setting up x11-common (1:7.7+23ubuntu3) ... 128s Setting up libdeflate0:arm64 (1.22-1) ... 128s Setting up m4 (1.4.19-4build1) ... 128s Setting up libxcb-shm0:arm64 (1.17.0-2) ... 128s Setting up libgomp1:arm64 (14.2.0-8ubuntu1) ... 128s Setting up python3-freetype (2.5.1-1) ... 129s Setting up libjbig0:arm64 (2.1-6.1ubuntu2) ... 129s Setting up python3-tz (2024.1-2) ... 129s Setting up python3-six (1.16.0-7) ... 129s Setting up libpython3.13-minimal:arm64 (3.13.0-2) ... 129s Setting up python3-decorator (5.1.1-5) ... 129s Setting up libfontenc1:arm64 (1:1.1.8-1build1) ... 129s Setting up autotools-dev (20220109.1) ... 129s Setting up libblas3:arm64 (3.12.0-3build2) ... 129s update-alternatives: using /usr/lib/aarch64-linux-gnu/blas/libblas.so.3 to provide /usr/lib/aarch64-linux-gnu/libblas.so.3 (libblas.so.3-aarch64-linux-gnu) in auto mode 129s Setting up python3-packaging (24.1-1) ... 130s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 130s Setting up libimagequant0:arm64 (2.18.0-1build1) ... 130s Setting up fonts-dejavu-mono (2.37-8) ... 130s Setting up libmpc3:arm64 (1.3.1-1build2) ... 130s Setting up autopoint (0.22.5-2) ... 130s Setting up fonts-dejavu-core (2.37-8) ... 130s Setting up libjpeg-turbo8:arm64 (2.1.5-2ubuntu2) ... 130s Setting up libgfortran5:arm64 (14.2.0-8ubuntu1) ... 130s Setting up autoconf (2.72-3) ... 130s Setting up libwebp7:arm64 (1.4.0-0.1) ... 130s Setting up libubsan1:arm64 (14.2.0-8ubuntu1) ... 130s Setting up dwz (0.15-1build6) ... 130s Setting up libhwasan0:arm64 (14.2.0-8ubuntu1) ... 130s Setting up libasan8:arm64 (14.2.0-8ubuntu1) ... 130s Setting up debugedit (1:5.1-1) ... 130s Setting up libopenjp2-7:arm64 (2.5.0-2ubuntu1) ... 130s Setting up python3.13-minimal (3.13.0-2) ... 131s Setting up libharfbuzz0b:arm64 (10.0.1-1) ... 131s Setting up python3-dateutil (2.9.0-2) ... 131s Setting up sgml-base (1.31) ... 131s Setting up libtsan2:arm64 (14.2.0-8ubuntu1) ... 131s Setting up libisl23:arm64 (0.27-1) ... 131s Setting up libwebpmux3:arm64 (1.4.0-0.1) ... 131s Setting up libpython3.13-stdlib:arm64 (3.13.0-2) ... 131s Setting up libcc1-0:arm64 (14.2.0-8ubuntu1) ... 131s Setting up liblsan0:arm64 (14.2.0-8ubuntu1) ... 131s Setting up libitm1:arm64 (14.2.0-8ubuntu1) ... 131s Setting up cd-hit (4.8.1-4) ... 131s Setting up libjpeg8:arm64 (8c-2ubuntu11) ... 131s Setting up automake (1:1.16.5-1.3ubuntu1) ... 131s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode 131s Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... 131s Setting up liblapack3:arm64 (3.12.0-3build2) ... 131s update-alternatives: using /usr/lib/aarch64-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/aarch64-linux-gnu/liblapack.so.3 (liblapack.so.3-aarch64-linux-gnu) in auto mode 131s Setting up gettext (0.22.5-2) ... 131s Setting up libmbedx509-1t64:arm64 (2.28.8-1) ... 131s Setting up python3.13 (3.13.0-2) ... 132s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 133s Setting up libwebpdemux2:arm64 (1.4.0-0.1) ... 133s Setting up python3-all (3.12.7-1) ... 133s Setting up xfonts-utils (1:7.7+7) ... 133s Setting up intltool-debian (0.35.0+20060710.6) ... 133s Setting up libraqm0:arm64 (0.10.1-1build1) ... 133s Setting up python3-numpy (1:1.26.4+ds-11build1) ... 137s Setting up dh-strip-nondeterminism (1.14.0-1) ... 137s Setting up cpp-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 137s Setting up libmbedtls14t64:arm64 (2.28.8-1) ... 137s Setting up libtiff6:arm64 (4.5.1+git230720-4ubuntu4) ... 137s Setting up xml-core (0.19) ... 137s Setting up libfontconfig1:arm64 (2.15.0-1.1ubuntu2) ... 137s Setting up libgcc-14-dev:arm64 (14.2.0-8ubuntu1) ... 137s Setting up libstdc++-14-dev:arm64 (14.2.0-8ubuntu1) ... 137s Setting up liblbfgsb0:arm64 (3.0+dfsg.4-1build1) ... 137s Setting up python3-scipy (1.13.1-5) ... 145s Setting up po-debconf (1.0.21+nmu1) ... 145s Setting up python3-pandas-lib:arm64 (2.2.3+dfsg-5) ... 145s Setting up fonts-urw-base35 (20200910-8) ... 145s Setting up libcairo2:arm64 (1.18.2-2) ... 145s Setting up ncbi-blast+ (2.16.0+ds-6) ... 145s Setting up python3-pil:arm64 (10.4.0-1ubuntu1) ... 146s Setting up cpp-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 146s Setting up python3-pandas (2.2.3+dfsg-5) ... 157s Setting up cpp-14 (14.2.0-8ubuntu1) ... 157s Setting up cpp (4:14.1.0-2ubuntu1) ... 157s Setting up gcc-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 157s Setting up gcc-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 157s Setting up g++-14-aarch64-linux-gnu (14.2.0-8ubuntu1) ... 157s Setting up python3-cairo (1.26.1-2) ... 157s Setting up gcc-14 (14.2.0-8ubuntu1) ... 157s Setting up python3-rlpycairo (0.3.0-3) ... 158s Setting up python3-reportlab (4.2.5-1) ... 159s Setting up g++-aarch64-linux-gnu (4:14.1.0-2ubuntu1) ... 159s Setting up g++-14 (14.2.0-8ubuntu1) ... 159s Setting up libtool (2.4.7-7build1) ... 159s Setting up gcc (4:14.1.0-2ubuntu1) ... 159s Setting up dh-autoreconf (20) ... 159s Setting up g++ (4:14.1.0-2ubuntu1) ... 159s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 159s Setting up build-essential (12.10ubuntu1) ... 159s Setting up debhelper (13.20ubuntu1) ... 159s Setting up pybuild-plugin-autopkgtest (6.20241024) ... 159s Processing triggers for libc-bin (2.40-1ubuntu3) ... 159s Processing triggers for systemd (256.5-2ubuntu4) ... 159s Processing triggers for man-db (2.12.1-3) ... 161s Processing triggers for install-info (7.1.1-1) ... 161s Processing triggers for sgml-base (1.31) ... 161s Setting up w3c-sgml-lib (1.3-3) ... 189s Setting up python3-biopython (1.84+dfsg-4) ... 191s Setting up python3-presto (0.7.2-1) ... 191s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 191s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 191s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 191s header['SPECIES'] = re.sub('\s', '_', fields[2]) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 191s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 191s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 191s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 191s version = re.sub('\.linux.*$','',version) 191s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 191s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 191s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 191s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 191s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 191s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 191s header['SPECIES'] = re.sub('\s', '_', fields[2]) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 191s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 191s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 191s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 191s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 191s version = re.sub('\.linux.*$','',version) 191s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 191s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 191s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 191s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 192s Setting up presto (0.7.2-1) ... 192s Setting up autopkgtest-satdep (0) ... 197s (Reading database ... 89906 files and directories currently installed.) 197s Removing autopkgtest-satdep (0) ... 198s autopkgtest [09:57:08]: test pybuild-autopkgtest: pybuild-autopkgtest 198s autopkgtest [09:57:08]: test pybuild-autopkgtest: [----------------------- 198s pybuild-autopkgtest 199s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Bxl9ws/build.RYw/src/bin /tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build; rm /tmp/autopkgtest.Bxl9ws/build.RYw/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 199s I: pybuild base:311: cd /tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build; python3.13 -m unittest discover -v 199s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 199s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 199s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 199s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 199s tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) ... ERROR 199s tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) ... ERROR 199s tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) ... ERROR 199s tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) ... ERROR 199s tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) ... ERROR 199s tests.test_IO (unittest.loader._FailedTest.tests.test_IO) ... ERROR 199s tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) ... ERROR 199s tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) ... ERROR 199s tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) ... ERROR 199s 199s ====================================================================== 199s ERROR: tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_AssemblePairs 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_AssemblePairs.py", line 12, in 199s import pandas as pd 199s File "/usr/lib/python3/dist-packages/pandas/__init__.py", line 19, in 199s raise ImportError( 199s "Unable to import required dependencies:\n" + "\n".join(_missing_dependencies) 199s ) 199s ImportError: Unable to import required dependencies: 199s numpy: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s ERROR: tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_BuildConsensus 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 199s from . import multiarray 199s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 199s from . import overrides 199s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 199s from numpy.core._multiarray_umath import ( 199s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 199s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 199s 199s During handling of the above exception, another exception occurred: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 199s from numpy.__config__ import show as show_config 199s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 199s from numpy.core._multiarray_umath import ( 199s ...<3 lines>... 199s ) 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 199s raise ImportError(msg) 199s ImportError: 199s 199s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 199s 199s Importing the numpy C-extensions failed. This error can happen for 199s many reasons, often due to issues with your setup or how NumPy was 199s installed. 199s 199s We have compiled some common reasons and troubleshooting tips at: 199s 199s https://numpy.org/devdocs/user/troubleshooting-importerror.html 199s 199s Please note and check the following: 199s 199s * The Python version is: Python3.13 from "/usr/bin/python3.13" 199s * The NumPy version is: "1.26.4" 199s 199s and make sure that they are the versions you expect. 199s Please carefully study the documentation linked above for further help. 199s 199s Original error was: No module named 'numpy.core._multiarray_umath' 199s 199s 199s The above exception was the direct cause of the following exception: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_BuildConsensus.py", line 16, in 199s from presto.Sequence import calculateSetError, deleteSeqPositions, findGapPositions, \ 199s frequencyConsensus, qualityConsensus 199s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 199s import numpy as np 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 199s raise ImportError(msg) from e 199s ImportError: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s ERROR: tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_CollapseSeq 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 199s from . import multiarray 199s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 199s from . import overrides 199s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 199s from numpy.core._multiarray_umath import ( 199s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 199s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 199s 199s During handling of the above exception, another exception occurred: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 199s from numpy.__config__ import show as show_config 199s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 199s from numpy.core._multiarray_umath import ( 199s ...<3 lines>... 199s ) 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 199s raise ImportError(msg) 199s ImportError: 199s 199s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 199s 199s Importing the numpy C-extensions failed. This error can happen for 199s many reasons, often due to issues with your setup or how NumPy was 199s installed. 199s 199s We have compiled some common reasons and troubleshooting tips at: 199s 199s https://numpy.org/devdocs/user/troubleshooting-importerror.html 199s 199s Please note and check the following: 199s 199s * The Python version is: Python3.13 from "/usr/bin/python3.13" 199s * The NumPy version is: "1.26.4" 199s 199s and make sure that they are the versions you expect. 199s Please carefully study the documentation linked above for further help. 199s 199s Original error was: No module named 'numpy.core._multiarray_umath' 199s 199s 199s The above exception was the direct cause of the following exception: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_CollapseSeq.py", line 17, in 199s from presto.Sequence import checkSeqEqual 199s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 199s import numpy as np 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 199s raise ImportError(msg) from e 199s ImportError: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s ERROR: tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_ConvertHeaders 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_ConvertHeaders.py", line 18, in 199s import ConvertHeaders 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/../bin/ConvertHeaders.py", line 15, in 199s from Bio import SeqIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 199s from Bio.SeqIO import TwoBitIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 199s raise MissingPythonDependencyError( 199s ...<2 lines>... 199s ) from None 199s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 199s 199s 199s ====================================================================== 199s ERROR: tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_EstimateError 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 199s from . import multiarray 199s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 199s from . import overrides 199s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 199s from numpy.core._multiarray_umath import ( 199s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 199s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 199s 199s During handling of the above exception, another exception occurred: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 199s from numpy.__config__ import show as show_config 199s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 199s from numpy.core._multiarray_umath import ( 199s ...<3 lines>... 199s ) 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 199s raise ImportError(msg) 199s ImportError: 199s 199s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 199s 199s Importing the numpy C-extensions failed. This error can happen for 199s many reasons, often due to issues with your setup or how NumPy was 199s installed. 199s 199s We have compiled some common reasons and troubleshooting tips at: 199s 199s https://numpy.org/devdocs/user/troubleshooting-importerror.html 199s 199s Please note and check the following: 199s 199s * The Python version is: Python3.13 from "/usr/bin/python3.13" 199s * The NumPy version is: "1.26.4" 199s 199s and make sure that they are the versions you expect. 199s Please carefully study the documentation linked above for further help. 199s 199s Original error was: No module named 'numpy.core._multiarray_umath' 199s 199s 199s The above exception was the direct cause of the following exception: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_EstimateError.py", line 11, in 199s import numpy as np 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 199s raise ImportError(msg) from e 199s ImportError: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s -> test_collapseAnnotation() 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 199s <- test_collapseAnnotation() 0.000 199s -> test_getCoordKey() 199s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 199s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 199s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 199s <- test_getCoordKey() 0.000 199s -> test_mergeAnnotation() 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 199s <- test_mergeAnnotation() 0.000 199s -> test_renameAnnotation() 199s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 199s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 199s <- test_renameAnnotation() 0.000 199s Test file already removed or moved 199s ERROR: tests.test_IO (unittest.loader._FailedTest.tests.test_IO) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_IO 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_IO.py", line 15, in 199s from presto.IO import getFileType, readSeqFile 199s File "/usr/lib/python3/dist-packages/presto/IO.py", line 15, in 199s from Bio import SeqIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 199s from Bio.SeqIO import TwoBitIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 199s raise MissingPythonDependencyError( 199s ...<2 lines>... 199s ) from None 199s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 199s 199s 199s ====================================================================== 199s ERROR: tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_MaskPrimers 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 199s from . import multiarray 199s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 199s from . import overrides 199s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 199s from numpy.core._multiarray_umath import ( 199s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 199s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 199s 199s During handling of the above exception, another exception occurred: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 199s from numpy.__config__ import show as show_config 199s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 199s from numpy.core._multiarray_umath import ( 199s ...<3 lines>... 199s ) 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 199s raise ImportError(msg) 199s ImportError: 199s 199s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 199s 199s Importing the numpy C-extensions failed. This error can happen for 199s many reasons, often due to issues with your setup or how NumPy was 199s installed. 199s 199s We have compiled some common reasons and troubleshooting tips at: 199s 199s https://numpy.org/devdocs/user/troubleshooting-importerror.html 199s 199s Please note and check the following: 199s 199s * The Python version is: Python3.13 from "/usr/bin/python3.13" 199s * The NumPy version is: "1.26.4" 199s 199s and make sure that they are the versions you expect. 199s Please carefully study the documentation linked above for further help. 199s 199s Original error was: No module named 'numpy.core._multiarray_umath' 199s 199s 199s The above exception was the direct cause of the following exception: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_MaskPrimers.py", line 17, in 199s from presto.Sequence import getDNAScoreDict, localAlignment, scoreAlignment, extractAlignment, \ 199s maskSeq, PrimerAlignment 199s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 199s import numpy as np 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 199s raise ImportError(msg) from e 199s ImportError: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s ERROR: tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_Sequence 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 199s from . import multiarray 199s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 199s from . import overrides 199s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 199s from numpy.core._multiarray_umath import ( 199s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 199s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 199s 199s During handling of the above exception, another exception occurred: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 199s from numpy.__config__ import show as show_config 199s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 199s from numpy.core._multiarray_umath import ( 199s ...<3 lines>... 199s ) 199s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 199s raise ImportError(msg) 199s ImportError: 199s 199s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 199s 199s Importing the numpy C-extensions failed. This error can happen for 199s many reasons, often due to issues with your setup or how NumPy was 199s installed. 199s 199s We have compiled some common reasons and troubleshooting tips at: 199s 199s https://numpy.org/devdocs/user/troubleshooting-importerror.html 199s 199s Please note and check the following: 199s 199s * The Python version is: Python3.13 from "/usr/bin/python3.13" 199s * The NumPy version is: "1.26.4" 199s 199s and make sure that they are the versions you expect. 199s Please carefully study the documentation linked above for further help. 199s 199s Original error was: No module named 'numpy.core._multiarray_umath' 199s 199s 199s The above exception was the direct cause of the following exception: 199s 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_Sequence.py", line 18, in 199s from presto.Sequence import getDNAScoreDict, scoreDNA, scoreSeqPair, weightSeq, \ 199s calculateSetError, meanQuality, filterQuality 199s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 199s import numpy as np 199s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 199s raise ImportError(msg) from e 199s ImportError: Error importing numpy: you should not try to import numpy from 199s its source directory; please exit the numpy source tree, and relaunch 199s your python interpreter from there. 199s 199s 199s ====================================================================== 199s ERROR: tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) 199s ---------------------------------------------------------------------- 199s ImportError: Failed to import test module: tests.test_UnifyHeaders 199s Traceback (most recent call last): 199s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 199s module = self._get_module_from_name(name) 199s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 199s __import__(name) 199s ~~~~~~~~~~^^^^^^ 199s File "/tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build/tests/test_UnifyHeaders.py", line 16, in 199s from presto.Multiprocessing import SeqData 199s File "/usr/lib/python3/dist-packages/presto/Multiprocessing.py", line 16, in 199s from Bio import SeqIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 199s from Bio.SeqIO import TwoBitIO 199s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 199s raise MissingPythonDependencyError( 199s ...<2 lines>... 199s ) from None 199s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 199s 199s 199s ---------------------------------------------------------------------- 199s Ran 13 tests in 0.001s 199s 199s FAILED (errors=9) 199s E: pybuild pybuild:389: test: plugin distutils failed with: exit code=1: cd /tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build; python3.13 -m unittest discover -v 199s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Bxl9ws/build.RYw/src/bin /tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build; rm /tmp/autopkgtest.Bxl9ws/build.RYw/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 199s rm: cannot remove '/tmp/autopkgtest.Bxl9ws/build.RYw/src/tests/test_ClusterSets.py': No such file or directory 199s I: pybuild base:311: cd /tmp/autopkgtest.Bxl9ws/autopkgtest_tmp/build; python3.12 -m unittest discover -v 200s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 200s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 200s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 200s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 200s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 200s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 200s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 200s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 200s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 200s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 200s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok 200s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 200s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 200s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 200s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 200s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 200s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok 200s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 200s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 200s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 200s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 200s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 200s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object. 200s warnings.warn( 200s ok 200s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 200s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 200s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 200s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 200s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok 200s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 200s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 200s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 200s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 200s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 200s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 200s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok 200s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok 200s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 200s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 200s 200s ---------------------------------------------------------------------- 200s Ran 38 tests in 0.050s 200s 200s OK (skipped=6) 200s -> test_collapseAnnotation() 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 200s <- test_collapseAnnotation() 0.000 200s -> test_getCoordKey() 200s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 200s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 200s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 200s <- test_getCoordKey() 0.000 200s -> test_mergeAnnotation() 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 200s <- test_mergeAnnotation() 0.000 200s -> test_renameAnnotation() 200s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 200s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 200s <- test_renameAnnotation() 0.000 200s -> test_calculateSetError() 200s Frequency consensus error> 200s REF> CGGCGTAA 200s SEQ1> CGGCGTAA 200s SEQ2> CCNNGTAA 200s SEQ3> CGGC--TA 200s SEQ4> CGNN--TA 200s SEQ5> CGGC--AA 200s ERROR> 0.250000 200s Quality consensus error> 200s REF> CGGCNNAA 200s SEQ1> CGGCGTAA 200s SEQ2> CCNNGTAA 200s SEQ3> CGGC--TA 200s SEQ4> CGNN--TA 200s SEQ5> CGGC--AA 200s ERROR> 0.233333 200s <- test_calculateSetError() 0.000 200s -> test_deleteSeqPositions() 200s MAX_GAP=0.4> CGGCAA 200s MAX_GAP=0.8> CGGCGTAA 200s <- test_deleteSeqPositions() 0.000 200s -> test_findGapPositions() 200s MAX_GAP=0.4> [4, 5] 200s MAX_GAP=0.8> [] 200s <- test_findGapPositions() 0.000 200s -> test_frequencyConsensus() 200s MIN_FREQ=0.2> CGGCGTAA 200s MIN_FREQ=0.8> CGGCGTNA 200s <- test_frequencyConsensus() 0.000 200s -> test_qualityConsensus() 200s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 200s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 200s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 200s <- test_qualityConsensus() 0.000 200s -> test_checkSeqEqual() 200s DNA Equality> 200s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 200s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 200s EQUAL> True 200s 200s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 200s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 200s EQUAL> False 200s 200s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 200s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 200s EQUAL> True 200s 200s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 200s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 200s EQUAL> False 200s 200s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 200s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 200s EQUAL> True 200s 200s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 200s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 200s EQUAL> True 200s 200s <- test_checkSeqEqual() 0.000 200s -> test_convert454Header() 200s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 200s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 200s <- test_convert454Header() 0.000 200s -> test_convertGenbankHeader() 200s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 200s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 200s <- test_convertGenbankHeader() 0.000 200s -> test_convertGenericHeader() 200s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 200s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 200s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 200s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 200s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 200s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 200s <- test_convertGenericHeader() 0.000 200s -> test_convertIMGTHeader() 200s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 200s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 200s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 200s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 200s OrderedDict({'ID': 'IGHV1-18*01'}) 200s OrderedDict({'ID': 'IGHV1-69*07'}) 200s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 200s OrderedDict({'ID': 'TRAV11*01'}) 200s <- test_convertIMGTHeader() 0.000 200s -> test_convertIlluminaHeader() 200s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 200s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 200s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 200s <- test_convertIlluminaHeader() 0.000 200s -> test_convertSRAHeader() 200s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 200s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 200s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 200s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 200s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 200s <- test_convertSRAHeader() 0.000 200s -> test_calculateDistances() 200s <- test_calculateDistances() 0.002 200s -> test_countMismatches() 200s <- test_countMismatches() 0.001 200s -> test_initializeMismatchDictionary() 200s <- test_initializeMismatchDictionary() 0.000 200s -> test_getFileType() 200s <- test_getFileType() 0.000 200s -> test_extractAlignment() 200s SEQ1> 200s SEQ> CCACGTTTTAGTAATTAATA 200s ALN-SEQ> CCACGTTTTAGT 200s ALN-PR> ----GTTTTAGT 200s PRIMER> GTTTTAGT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ2> 200s SEQ> CCNCGTTTTAGTAATTAATA 200s ALN-SEQ> CCNCGTTTTAGT 200s ALN-PR> ----GTTTTAGT 200s PRIMER> GTTTTAGT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ3> 200s SEQ> GGGCGTTTTAGTAATTAATA 200s ALN-SEQ> GGGCGTTTTAGT 200s ALN-PR> ----GTTTTAGT 200s PRIMER> GTTTTAGT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ4> 200s SEQ> GGNNGTTTTACTAATTAATA 200s ALN-SEQ> GGNNGTTTTACT 200s ALN-PR> ----GTTTTACT 200s PRIMER> GTTTTACT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ5> 200s SEQ> NNGCNNNNNACTAATTAATA 200s ALN-SEQ> NNGCNNNNNACT 200s ALN-PR> ----NNNNNACT 200s PRIMER> NNNNNACT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ6> 200s SEQ> GGGATANNNACTAATTAATA 200s ALN-SEQ> GGGATANNNACT 200s ALN-PR> ----TANNNACT 200s PRIMER> TANNNACT 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ7> 200s SEQ> NNNNNNNNNNNNNNNNNNNN 200s ALN-SEQ> NNNNNNNNNNNN 200s ALN-PR> ----NNNNNNNN 200s PRIMER> NNNNNNNN 200s START> 4 200s END> 12 200s GAPS> 0 200s ERROR> 0.000000 200s 200s <- test_extractAlignment() 0.000 200s -> test_localAlignment() 200s TEST Ns> 200s SEQ1> 200s SEQ> CCACGTTTTAGTAATTAATA 200s ALN-SEQ> CCACGTTTTAGTAATTAATA 200s ALN-PR> -CACGTTTT----------- 200s PRIMER> PR1 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ2> 200s SEQ> CCNCGTTTTAGTAATTAATA 200s ALN-SEQ> CCNCGTTTTAGTAATTAATA 200s ALN-PR> -CACGTTTT----------- 200s PRIMER> PR1 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.125000 200s 200s SEQ3> 200s SEQ> GGGCGTTTTAGTAATTAATA 200s ALN-SEQ> GGGCGTTTTAGTAATTAATA 200s ALN-PR> -GGCGTTTT----------- 200s PRIMER> PR2 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ4> 200s SEQ> GGNNGTTTTACTAATTAATA 200s ALN-SEQ> GGNNGTTTTACTAATTAATA 200s ALN-PR> GGC-GTTTT----------- 200s PRIMER> PR2 200s START> 0 200s END> 9 200s GAPS> 1 200s ERROR> 0.250000 200s 200s SEQ5> 200s SEQ> NNGCNNNNNACTAATTAATA 200s ALN-SEQ> NNGCNNNNNACTAATTAATA 200s ALN-PR> ------------ANATAA-- 200s PRIMER> PR3 200s START> 12 200s END> 18 200s GAPS> 0 200s ERROR> 0.375000 200s 200s SEQ6> 200s SEQ> GGGATANNNACTAATTAATA 200s ALN-SEQ> GGGATANNNACTAATTAATA 200s ALN-PR> -GGANA-------------- 200s PRIMER> PR3 200s START> 1 200s END> 6 200s GAPS> 0 200s ERROR> 0.375000 200s 200s SEQ7> 200s SEQ> NNNNNNNNNNNNNNNNNNNN 200s ALN-SEQ> None 200s ALN-PR> None 200s PRIMER> None 200s START> None 200s END> None 200s GAPS> 0 200s ERROR> 1.000000 200s 200s TEST INDELS> 200s SEQ1> 200s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 200s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 200s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 200s PRIMER> PR1 200s START> 15 200s END> 38 200s GAPS> 0 200s ERROR> 0.083333 200s 200s SEQ2> 200s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 200s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 200s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 200s PRIMER> PR1 200s START> 14 200s END> 38 200s GAPS> 2 200s ERROR> 0.208333 200s 200s SEQ3> 200s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 200s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 200s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 200s PRIMER> PR1 200s START> 15 200s END> 38 200s GAPS> 1 200s ERROR> 0.125000 200s 200s SEQ4> 200s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 200s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 200s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 200s PRIMER> PR2 200s START> 6 200s END> 19 200s GAPS> 1 200s ERROR> 0.250000 200s 200s SEQ5> 200s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 200s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 200s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 200s PRIMER> PR2 200s START> 6 200s END> 18 200s GAPS> 0 200s ERROR> 0.166667 200s 200s SEQ6> 200s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 200s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 200s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 200s PRIMER> PR2 200s START> 0 200s END> 11 200s GAPS> 1 200s ERROR> 0.250000 200s 200s SEQ7> 200s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 200s PRIMER> PR3 200s START> 2 200s END> 15 200s GAPS> 1 200s ERROR> 0.083333 200s 200s SEQ8> 200s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 200s PRIMER> PR3 200s START> 3 200s END> 15 200s GAPS> 1 200s ERROR> 0.166667 200s 200s SEQ9> 200s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 200s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 200s PRIMER> PR3 200s START> 3 200s END> 15 200s GAPS> 1 200s ERROR> 0.333333 200s 200s SEQ10> 200s SEQ> -------------------------------------------------------------- 200s ALN-SEQ> None 200s ALN-PR> None 200s PRIMER> None 200s START> None 200s END> None 200s GAPS> 0 200s ERROR> 1.000000 200s 200s <- test_localAlignment() 0.025 200s -> test_maskSeq() 200s TEST CUT> 200s ID> SEQ|PRIMER=A|BARCODE=CCA 200s SEQ> AGTAATTAATA 200s 200s TEST MASK> 200s ID> SEQ|PRIMER=A|BARCODE=CCA 200s SEQ> NNNNNNAGTAATTAATA 200s 200s TEST TRIM> 200s ID> SEQ|PRIMER=A|BARCODE=CCA 200s SEQ> CGTTTTAGTAATTAATA 200s 200s TEST TAG> 200s ID> SEQ|PRIMER=A|BARCODE=CCA 200s SEQ> CCACGTTTTAGTAATTAATA 200s 200s <- test_maskSeq() 0.001 200s -> test_scoreAlignment() 200s SEQ1> 200s SEQ> CCACGTTTTAGTAATTAATA 200s ALN-SEQ> CCACGTTTT 200s ALN-PR> -CACGTTTT 200s PRIMER> PR1 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ2> 200s SEQ> CCNCGTTTTAGTAATTAATA 200s ALN-SEQ> CCNCGTTTT 200s ALN-PR> -CACGTTTT 200s PRIMER> PR1 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.125000 200s 200s SEQ3> 200s SEQ> GGGCGTTTTAGTAATTAATA 200s ALN-SEQ> GGGCGTTTT 200s ALN-PR> -GGCGTTTT 200s PRIMER> PR2 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.000000 200s 200s SEQ4> 200s SEQ> GGNNGTTTTACTAATTAATA 200s ALN-SEQ> GGNNGTTTT 200s ALN-PR> -GGCGTTTT 200s PRIMER> PR2 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.250000 200s 200s SEQ5> 200s SEQ> NNGCNNNNNACTAATTAATA 200s ALN-SEQ> NNGCNNNNN 200s ALN-PR> -GGCGTTTT 200s PRIMER> PR2 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.750000 200s 200s SEQ6> 200s SEQ> GGGATANNNACTAATTAATA 200s ALN-SEQ> GGGATANNN 200s ALN-PR> -GGANATAA 200s PRIMER> PR3 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 0.375000 200s 200s SEQ7> 200s SEQ> NNNNNNNNNNNNNNNNNNNN 200s ALN-SEQ> NNNNNNNNN 200s ALN-PR> -CACGTTTT 200s PRIMER> None 200s START> 1 200s END> 9 200s GAPS> 0 200s ERROR> 1.000000 200s 200s <- test_scoreAlignment() 0.008 200s -> test_calculateSetError() 200s REF> CGGCGTAA 0.4347826086956522 200s REF> NNNNNNNN 1.0 200s <- test_calculateSetError() 0.000 200s -> test_filterQuality() 200s RESULT> True 25 200s RESULT> False 5 200s RESULT> False 0 200s <- test_filterQuality() 0.000 200s -> test_meanQuality() 200s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 200s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 200s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 200s <- test_meanQuality() 0.000 200s -> test_scoreDNA() 200s Default DNA Scores> 200s A==A> 1 200s A==T> 0 200s A==R> 1 200s U==T> 1 200s A==N> 1 200s N==A> 1 200s A==-> 0 200s -==A> 0 200s Symmetric DNA Scores> 200s A==A> 1 200s A==T> 0 200s A==R> 1 200s U==T> 1 200s A==N> 1 200s N==A> 1 200s A==-> 1 200s -==A> 1 200s Asymmetric DNA Scores> 200s A==A> 1 200s A==T> 0 200s A==R> 1 200s U==T> 1 200s A==N> 1 200s N==A> 0 200s A==-> 1 200s -==A> 0 200s <- test_scoreDNA() 0.000 200s -> test_scoreSeqPair() 200s Default DNA Scores> 200s SEQ1> CGGCGTAA 200s SEQ2> CGNNGTAG 200s SCORE> 7 200s WEIGHT> 8 200s ERROR> 0.125000 200s 200s SEQ1> CGGCGTAA 200s SEQ3> CGGC--AA 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ1> CGGCGTAA 200s SEQ4> CGNN--AG 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ1> CGGCGTAA 200s SEQ5> NNNNNNNN 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ6> NNNNNNAA 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ2> CGNNGTAG 200s SEQ3> CGGC--AA 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ2> CGNNGTAG 200s SEQ4> CGNN--AG 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ2> CGNNGTAG 200s SEQ5> NNNNNNNN 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ2> CGNNGTAG 200s SEQ6> NNNNNNAA 200s SCORE> 7 200s WEIGHT> 8 200s ERROR> 0.125000 200s 200s SEQ2> CGNNGTAG 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ2> CGNNGTAG 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ3> CGGC--AA 200s SEQ4> CGNN--AG 200s SCORE> 7 200s WEIGHT> 8 200s ERROR> 0.125000 200s 200s SEQ3> CGGC--AA 200s SEQ5> NNNNNNNN 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ6> NNNNNNAA 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ7> -------- 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ3> CGGC--AA 200s SEQ8> CG------ 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ4> CGNN--AG 200s SEQ5> NNNNNNNN 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ4> CGNN--AG 200s SEQ6> NNNNNNAA 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ4> CGNN--AG 200s SEQ7> -------- 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ4> CGNN--AG 200s SEQ8> CG------ 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ5> NNNNNNNN 200s SEQ6> NNNNNNAA 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ6> NNNNNNAA 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ6> NNNNNNAA 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ7> -------- 200s SEQ8> CG------ 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s Asymmetric DNA Scores> 200s SEQ1> CGGCGTAA 200s SEQ2> CGNNGTAG 200s SCORE> 7 200s WEIGHT> 8 200s ERROR> 0.125000 200s 200s SEQ1> CGGCGTAA 200s SEQ3> CGGC--AA 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ4> CGNN--AG 200s SCORE> 7 200s WEIGHT> 8 200s ERROR> 0.125000 200s 200s SEQ1> CGGCGTAA 200s SEQ5> NNNNNNNN 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ6> NNNNNNAA 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ7> -------- 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ8> CG------ 200s SCORE> 8 200s WEIGHT> 8 200s ERROR> 0.000000 200s 200s SEQ2> CGNNGTAG 200s SEQ3> CGGC--AA 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ2> CGNNGTAG 200s SEQ4> CGNN--AG 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ2> CGNNGTAG 200s SEQ5> NNNNNNNN 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ2> CGNNGTAG 200s SEQ6> NNNNNNAA 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ2> CGNNGTAG 200s SEQ7> -------- 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ2> CGNNGTAG 200s SEQ8> CG------ 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ4> CGNN--AG 200s SCORE> 5 200s WEIGHT> 8 200s ERROR> 0.375000 200s 200s SEQ3> CGGC--AA 200s SEQ5> NNNNNNNN 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ6> NNNNNNAA 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ7> -------- 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ3> CGGC--AA 200s SEQ8> CG------ 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ4> CGNN--AG 200s SEQ5> NNNNNNNN 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ4> CGNN--AG 200s SEQ6> NNNNNNAA 200s SCORE> 3 200s WEIGHT> 8 200s ERROR> 0.625000 200s 200s SEQ4> CGNN--AG 200s SEQ7> -------- 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ4> CGNN--AG 200s SEQ8> CG------ 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ5> NNNNNNNN 200s SEQ6> NNNNNNAA 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ8> CG------ 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ6> NNNNNNAA 200s SEQ7> -------- 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ6> NNNNNNAA 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ7> -------- 200s SEQ8> CG------ 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s Masked DNA Scores> 200s SEQ1> CGGCGTAA 200s SEQ2> CGNNGTAG 200s SCORE> 5 200s WEIGHT> 6 200s ERROR> 0.166667 200s 200s SEQ1> CGGCGTAA 200s SEQ3> CGGC--AA 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s SEQ1> CGGCGTAA 200s SEQ4> CGNN--AG 200s SCORE> 3 200s WEIGHT> 6 200s ERROR> 0.500000 200s 200s SEQ1> CGGCGTAA 200s SEQ5> NNNNNNNN 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ6> NNNNNNAA 200s SCORE> 2 200s WEIGHT> 2 200s ERROR> 0.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 8 200s ERROR> 1.000000 200s 200s SEQ1> CGGCGTAA 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ2> CGNNGTAG 200s SEQ3> CGGC--AA 200s SCORE> 3 200s WEIGHT> 6 200s ERROR> 0.500000 200s 200s SEQ2> CGNNGTAG 200s SEQ4> CGNN--AG 200s SCORE> 4 200s WEIGHT> 6 200s ERROR> 0.333333 200s 200s SEQ2> CGNNGTAG 200s SEQ5> NNNNNNNN 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ2> CGNNGTAG 200s SEQ6> NNNNNNAA 200s SCORE> 1 200s WEIGHT> 2 200s ERROR> 0.500000 200s 200s SEQ2> CGNNGTAG 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 6 200s ERROR> 1.000000 200s 200s SEQ2> CGNNGTAG 200s SEQ8> CG------ 200s SCORE> 2 200s WEIGHT> 6 200s ERROR> 0.666667 200s 200s SEQ3> CGGC--AA 200s SEQ4> CGNN--AG 200s SCORE> 5 200s WEIGHT> 6 200s ERROR> 0.166667 200s 200s SEQ3> CGGC--AA 200s SEQ5> NNNNNNNN 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ3> CGGC--AA 200s SEQ6> NNNNNNAA 200s SCORE> 2 200s WEIGHT> 2 200s ERROR> 0.000000 200s 200s SEQ3> CGGC--AA 200s SEQ7> -------- 200s SCORE> 2 200s WEIGHT> 8 200s ERROR> 0.750000 200s 200s SEQ3> CGGC--AA 200s SEQ8> CG------ 200s SCORE> 4 200s WEIGHT> 8 200s ERROR> 0.500000 200s 200s SEQ4> CGNN--AG 200s SEQ5> NNNNNNNN 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ4> CGNN--AG 200s SEQ6> NNNNNNAA 200s SCORE> 1 200s WEIGHT> 2 200s ERROR> 0.500000 200s 200s SEQ4> CGNN--AG 200s SEQ7> -------- 200s SCORE> 2 200s WEIGHT> 6 200s ERROR> 0.666667 200s 200s SEQ4> CGNN--AG 200s SEQ8> CG------ 200s SCORE> 4 200s WEIGHT> 6 200s ERROR> 0.333333 200s 200s SEQ5> NNNNNNNN 200s SEQ6> NNNNNNAA 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ5> NNNNNNNN 200s SEQ8> CG------ 200s SCORE> 0 200s WEIGHT> 0 200s ERROR> 1.000000 200s 200s SEQ6> NNNNNNAA 200s SEQ7> -------- 200s SCORE> 0 200s WEIGHT> 2 200s ERROR> 1.000000 200s 200s SEQ6> NNNNNNAA 200s SEQ8> CG------ 200s SCORE> 0 200s WEIGHT> 2 200s ERROR> 1.000000 200s 200s SEQ7> -------- 200s SEQ8> CG------ 200s SCORE> 6 200s WEIGHT> 8 200s ERROR> 0.250000 200s 200s <- test_scoreSeqPair() 0.006 200s -> test_weightDNA() 200s DNA Weight> 200s SEQ1> 8 200s SEQ2> 6 200s SEQ3> 8 200s SEQ4> 6 200s SEQ5> 0 200s SEQ6> 2 200s SEQ7> 8 200s SEQ8> 8 200s AA Weight> 200s SEQ1> 8 200s SEQ2> 6 200s SEQ3> 8 200s SEQ4> 6 200s <- test_weightDNA() 0.000 200s -> test_consensusUnify() 200s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 200s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 200s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 200s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 200s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 200s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 200s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 200s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 200s <- test_consensusUnify() 0.000 200s -> test_deletionUnify() 200s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 200s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 200s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 200s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 200s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 200s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 200s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 200s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 200s <- test_deletionUnify() 0.000 200s pybuild-autopkgtest: error: pybuild --autopkgtest -i python{version} -p "3.13 3.12" returned exit code 13 200s make: *** [/tmp/FQG5ZI37hi/run:4: pybuild-autopkgtest] Error 25 200s pybuild-autopkgtest: error: /tmp/FQG5ZI37hi/run pybuild-autopkgtest returned exit code 2 201s autopkgtest [09:57:11]: test pybuild-autopkgtest: -----------------------] 201s pybuild-autopkgtest FAIL non-zero exit status 25 201s autopkgtest [09:57:11]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 202s autopkgtest [09:57:12]: @@@@@@@@@@@@@@@@@@@@ summary 202s pybuild-autopkgtest FAIL non-zero exit status 25 216s virt: nova [W] Skipping flock in bos03-arm64 216s virt: Creating nova instance adt-plucky-arm64-presto-20241113-095349-juju-7f2275-prod-proposed-migration-environment-2-59630117-af7a-45a1-b769-520ec79d9be0 from image adt/ubuntu-plucky-arm64-server-20241113.img (UUID 2d7760e6-2439-4200-89d6-5ed33e5c6330)...