0s autopkgtest [14:21:59]: starting date and time: 2025-03-15 14:21:59+0000 0s autopkgtest [14:21:59]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [14:21:59]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.50g1m1vy/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade pinfish --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-arm64-37.secgroup --name adt-plucky-arm64-pinfish-20250315-142159-juju-7f2275-prod-proposed-migration-environment-2-754a442f-c945-4891-a21d-db2939045baf --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 155s autopkgtest [14:24:34]: testbed dpkg architecture: arm64 155s autopkgtest [14:24:34]: testbed apt version: 2.9.33 156s autopkgtest [14:24:35]: @@@@@@@@@@@@@@@@@@@@ test bed setup 156s autopkgtest [14:24:35]: testbed release detected to be: None 157s autopkgtest [14:24:36]: updating testbed package index (apt update) 157s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 158s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 158s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 158s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 158s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 158s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [101 kB] 158s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [404 kB] 158s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [78.2 kB] 158s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 c-n-f Metadata [1976 B] 158s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 c-n-f Metadata [116 B] 158s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [346 kB] 159s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 c-n-f Metadata [15.8 kB] 159s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [4948 B] 159s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 c-n-f Metadata [572 B] 159s Fetched 1094 kB in 2s (670 kB/s) 160s Reading package lists... 161s Reading package lists... 161s Building dependency tree... 161s Reading state information... 162s Calculating upgrade... 162s Calculating upgrade... 162s The following packages will be upgraded: 162s python3-jinja2 strace 162s 2 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 162s Need to get 608 kB of archives. 162s After this operation, 11.3 kB of additional disk space will be used. 162s Get:1 http://ftpmaster.internal/ubuntu plucky/main arm64 strace arm64 6.13+ds-1ubuntu1 [499 kB] 163s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 164s Fetched 608 kB in 1s (590 kB/s) 164s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 164s Preparing to unpack .../strace_6.13+ds-1ubuntu1_arm64.deb ... 164s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 164s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 164s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 164s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 165s Setting up strace (6.13+ds-1ubuntu1) ... 165s Processing triggers for man-db (2.13.0-1) ... 165s Reading package lists... 166s Building dependency tree... 166s Reading state information... 166s Solving dependencies... 166s The following packages will be REMOVED: 166s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 166s libunwind8* linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 166s linux-image-6.11.0-8-generic* linux-modules-6.11.0-8-generic* 166s linux-tools-6.11.0-8* linux-tools-6.11.0-8-generic* 167s 0 upgraded, 0 newly installed, 11 to remove and 5 not upgraded. 167s After this operation, 267 MB disk space will be freed. 167s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 167s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 167s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 167s Removing libpython3.12t64:arm64 (3.12.9-1) ... 167s Removing libpython3.12-stdlib:arm64 (3.12.9-1) ... 167s Removing libnsl2:arm64 (1.3.0-3build3) ... 167s Removing libpython3.12-minimal:arm64 (3.12.9-1) ... 167s Removing libunwind8:arm64 (1.6.2-3.1) ... 167s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 168s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 170s Removing linux-image-6.11.0-8-generic (6.11.0-8.8) ... 170s I: /boot/vmlinuz.old is now a symlink to vmlinuz-6.14.0-10-generic 170s I: /boot/initrd.img.old is now a symlink to initrd.img-6.14.0-10-generic 170s /etc/kernel/postrm.d/initramfs-tools: 170s update-initramfs: Deleting /boot/initrd.img-6.11.0-8-generic 170s /etc/kernel/postrm.d/zz-flash-kernel: 170s flash-kernel: Kernel 6.11.0-8-generic has been removed. 170s flash-kernel: A higher version (6.14.0-10-generic) is still installed, no reflashing required. 170s /etc/kernel/postrm.d/zz-update-grub: 170s Sourcing file `/etc/default/grub' 170s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 170s Generating grub configuration file ... 170s Found linux image: /boot/vmlinuz-6.14.0-10-generic 170s Found initrd image: /boot/initrd.img-6.14.0-10-generic 171s Warning: os-prober will not be executed to detect other bootable partitions. 171s Systems on them will not be added to the GRUB boot configuration. 171s Check GRUB_DISABLE_OS_PROBER documentation entry. 171s Adding boot menu entry for UEFI Firmware Settings ... 171s done 171s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 171s Processing triggers for libc-bin (2.41-1ubuntu1) ... 171s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81650 files and directories currently installed.) 171s Purging configuration files for linux-image-6.11.0-8-generic (6.11.0-8.8) ... 172s Purging configuration files for libpython3.12-minimal:arm64 (3.12.9-1) ... 172s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 172s autopkgtest [14:24:51]: upgrading testbed (apt dist-upgrade and autopurge) 172s Reading package lists... 172s Building dependency tree... 172s Reading state information... 173s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 173s Starting 2 pkgProblemResolver with broken count: 0 173s Done 174s Entering ResolveByKeep 174s 174s Calculating upgrade... 175s The following packages will be upgraded: 175s libc-bin libc-dev-bin libc6 libc6-dev locales 175s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 175s Need to get 9530 kB of archives. 175s After this operation, 0 B of additional disk space will be used. 175s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6-dev arm64 2.41-1ubuntu2 [1750 kB] 177s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-dev-bin arm64 2.41-1ubuntu2 [24.0 kB] 177s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6 arm64 2.41-1ubuntu2 [2910 kB] 179s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-bin arm64 2.41-1ubuntu2 [600 kB] 180s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 locales all 2.41-1ubuntu2 [4246 kB] 184s Preconfiguring packages ... 184s Fetched 9530 kB in 9s (1097 kB/s) 184s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 184s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_arm64.deb ... 184s Unpacking libc6-dev:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 184s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_arm64.deb ... 184s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 184s Preparing to unpack .../libc6_2.41-1ubuntu2_arm64.deb ... 185s Unpacking libc6:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 185s Setting up libc6:arm64 (2.41-1ubuntu2) ... 185s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 185s Preparing to unpack .../libc-bin_2.41-1ubuntu2_arm64.deb ... 185s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 185s Setting up libc-bin (2.41-1ubuntu2) ... 185s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 185s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 185s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 185s Setting up locales (2.41-1ubuntu2) ... 186s Generating locales (this might take a while)... 189s en_US.UTF-8... done 189s Generation complete. 189s Setting up libc-dev-bin (2.41-1ubuntu2) ... 189s Setting up libc6-dev:arm64 (2.41-1ubuntu2) ... 189s Processing triggers for man-db (2.13.0-1) ... 190s Processing triggers for systemd (257.3-1ubuntu3) ... 191s Reading package lists... 191s Building dependency tree... 191s Reading state information... 192s Starting pkgProblemResolver with broken count: 0 192s Starting 2 pkgProblemResolver with broken count: 0 192s Done 192s Solving dependencies... 193s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 193s autopkgtest [14:25:12]: rebooting testbed after setup commands that affected boot 218s autopkgtest [14:25:37]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP PREEMPT_DYNAMIC Wed Mar 12 15:45:31 UTC 2025 220s autopkgtest [14:25:39]: @@@@@@@@@@@@@@@@@@@@ apt-source pinfish 292s Get:1 http://ftpmaster.internal/ubuntu plucky/universe pinfish 0.1.0+ds-4 (dsc) [2529 B] 292s Get:2 http://ftpmaster.internal/ubuntu plucky/universe pinfish 0.1.0+ds-4 (tar) [68.6 MB] 292s Get:3 http://ftpmaster.internal/ubuntu plucky/universe pinfish 0.1.0+ds-4 (tar) [5055 kB] 292s Get:4 http://ftpmaster.internal/ubuntu plucky/universe pinfish 0.1.0+ds-4 (diff) [6600 B] 293s gpgv: Signature made Fri Jan 12 07:59:53 2024 UTC 293s gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 293s gpgv: issuer "tille@debian.org" 293s gpgv: Can't check signature: No public key 293s dpkg-source: warning: cannot verify inline signature for ./pinfish_0.1.0+ds-4.dsc: no acceptable signature found 298s autopkgtest [14:26:57]: testing package pinfish version 0.1.0+ds-4 299s autopkgtest [14:26:58]: build not needed 325s autopkgtest [14:27:24]: test run-unit-test: preparing testbed 325s Reading package lists... 325s Building dependency tree... 325s Reading state information... 326s Starting pkgProblemResolver with broken count: 0 326s Starting 2 pkgProblemResolver with broken count: 0 326s Done 327s The following NEW packages will be installed: 327s libedlib1 libspoa7.0.0 minimap2 pinfish pinfish-examples racon 327s 0 upgraded, 6 newly installed, 0 to remove and 0 not upgraded. 327s Need to get 184 MB of archives. 327s After this operation, 192 MB of additional disk space will be used. 327s Get:1 http://ftpmaster.internal/ubuntu plucky/universe arm64 libedlib1 arm64 1.2.7-6build2 [18.8 kB] 327s Get:2 http://ftpmaster.internal/ubuntu plucky/universe arm64 libspoa7.0.0 arm64 4.1.4-2 [60.1 kB] 327s Get:3 http://ftpmaster.internal/ubuntu plucky/universe arm64 minimap2 arm64 2.27+dfsg-1build2 [384 kB] 327s Get:4 http://ftpmaster.internal/ubuntu plucky/universe arm64 racon arm64 1.5.0-3 [3114 kB] 330s Get:5 http://ftpmaster.internal/ubuntu plucky/universe arm64 pinfish arm64 0.1.0+ds-4 [1351 kB] 331s Get:6 http://ftpmaster.internal/ubuntu plucky/universe arm64 pinfish-examples all 0.1.0+ds-4 [179 MB] 488s Fetched 184 MB in 2min 41s (1143 kB/s) 488s Selecting previously unselected package libedlib1:arm64. 489s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 489s Preparing to unpack .../0-libedlib1_1.2.7-6build2_arm64.deb ... 489s Unpacking libedlib1:arm64 (1.2.7-6build2) ... 489s Selecting previously unselected package libspoa7.0.0:arm64. 489s Preparing to unpack .../1-libspoa7.0.0_4.1.4-2_arm64.deb ... 489s Unpacking libspoa7.0.0:arm64 (4.1.4-2) ... 489s Selecting previously unselected package minimap2. 489s Preparing to unpack .../2-minimap2_2.27+dfsg-1build2_arm64.deb ... 489s Unpacking minimap2 (2.27+dfsg-1build2) ... 489s Selecting previously unselected package racon. 489s Preparing to unpack .../3-racon_1.5.0-3_arm64.deb ... 489s Unpacking racon (1.5.0-3) ... 489s Selecting previously unselected package pinfish. 489s Preparing to unpack .../4-pinfish_0.1.0+ds-4_arm64.deb ... 489s Unpacking pinfish (0.1.0+ds-4) ... 489s Selecting previously unselected package pinfish-examples. 489s Preparing to unpack .../5-pinfish-examples_0.1.0+ds-4_all.deb ... 489s Unpacking pinfish-examples (0.1.0+ds-4) ... 489s Setting up pinfish-examples (0.1.0+ds-4) ... 489s Setting up minimap2 (2.27+dfsg-1build2) ... 489s Setting up libspoa7.0.0:arm64 (4.1.4-2) ... 489s Setting up libedlib1:arm64 (1.2.7-6build2) ... 489s Setting up racon (1.5.0-3) ... 489s Setting up pinfish (0.1.0+ds-4) ... 489s Processing triggers for man-db (2.13.0-1) ... 490s Processing triggers for libc-bin (2.41-1ubuntu2) ... 491s autopkgtest [14:30:10]: test run-unit-test: [----------------------- 494s Test 1 494s ##gff-version 2 494s SIRV1 pinfish mRNA 6450 10365 40 - . gene_id "6017994c-1dec-410d-ab27-94359a290e26"; transcript_id "c3a59a39-80ec-403c-88fd-a1d73d855208"; 494s SIRV1 pinfish exon 6450 6473 40 - . transcript_id "c3a59a39-80ec-403c-88fd-a1d73d855208"; 494s SIRV1 pinfish exon 6561 6813 40 - . transcript_id "c3a59a39-80ec-403c-88fd-a1d73d855208"; 494s SIRV1 pinfish exon 7553 7814 40 - . transcript_id "c3a59a39-80ec-403c-88fd-a1d73d855208"; 494s SIRV1 pinfish exon 10283 10365 40 - . transcript_id "c3a59a39-80ec-403c-88fd-a1d73d855208"; 494s SIRV1 pinfish mRNA 6450 7814 1 - . gene_id "6017994c-1dec-410d-ab27-94359a290e26"; transcript_id "22b22130-1200-46c7-b3e3-8ead589b0fff"; 494s SIRV1 pinfish exon 6450 6473 1 - . transcript_id "22b22130-1200-46c7-b3e3-8ead589b0fff"; 494s SIRV1 pinfish exon 6561 6813 1 - . transcript_id "22b22130-1200-46c7-b3e3-8ead589b0fff"; 494s SIRV1 pinfish exon 7553 7814 1 - . transcript_id "22b22130-1200-46c7-b3e3-8ead589b0fff"; 494s SIRV1 pinfish mRNA 6450 10347 1 - . gene_id "6017994c-1dec-410d-ab27-94359a290e26"; transcript_id "d5b9d928-155d-4fd0-bc9a-ad74f0b55380"; 494s SIRV1 pinfish exon 6450 6463 1 - . transcript_id "d5b9d928-155d-4fd0-bc9a-ad74f0b55380"; 494s SIRV1 pinfish exon 6554 6822 1 - . transcript_id "d5b9d928-155d-4fd0-bc9a-ad74f0b55380"; 494s SIRV1 pinfish exon 7578 7814 1 - . transcript_id "d5b9d928-155d-4fd0-bc9a-ad74f0b55380"; 494s SIRV1 pinfish exon 10283 10347 1 - . transcript_id "d5b9d928-155d-4fd0-bc9a-ad74f0b55380"; 494s SIRV7 pinfish mRNA 147813 147946 2 - . gene_id "2a3eb906-dfc0-4b02-8dc2-ce4e94f5c62f"; transcript_id "8662c89f-142b-451e-95ea-60629c507845"; 494s SIRV7 pinfish exon 147813 147946 2 - . transcript_id "8662c89f-142b-451e-95ea-60629c507845"; 494s PASS 494s Test 2 494s ##gff-version 2 494s SIRV1 pinfish mRNA 6452 10366 78 - . gene_id "70ec1c0e-e13f-4977-8103-0607e3e4f43c"; transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1"; 494s SIRV1 pinfish exon 6452 6473 78 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1"; 494s SIRV1 pinfish exon 6561 6813 78 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1"; 494s SIRV1 pinfish exon 7553 7814 78 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1"; 494s SIRV1 pinfish exon 10283 10366 78 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1"; 494s SIRV1 pinfish mRNA 6452 10366 39 - . gene_id "70ec1c0e-e13f-4977-8103-0607e3e4f43c"; transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1_skip"; 494s SIRV1 pinfish exon 6452 6473 39 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1_skip"; 494s SIRV1 pinfish exon 6561 6813 39 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1_skip"; 494s SIRV1 pinfish exon 10283 10366 39 - . transcript_id "871870d5-d85c-4583-84fd-0a8d32b6f3f1_skip"; 494s SIRV1 pinfish mRNA 10606 11596 3450 + . gene_id "be3137fb-8749-4a4d-9e0f-091baf5cad54"; transcript_id "289ed951-14e6-4c94-a619-512b17b95689"; 494s SIRV1 pinfish exon 10606 10791 3450 + . transcript_id "289ed951-14e6-4c94-a619-512b17b95689"; 494s SIRV1 pinfish exon 10898 11187 3450 + . transcript_id "289ed951-14e6-4c94-a619-512b17b95689"; 494s SIRV1 pinfish exon 11404 11596 3450 + . transcript_id "289ed951-14e6-4c94-a619-512b17b95689"; 494s SIRV2 pinfish mRNA 11404 11599 1150 . . gene_id "322a35f6-3f8f-4b55-bc3b-84138115a8dd"; transcript_id "289ed951-14e6-4c94-a619-512b17b95689_partu"; 494s SIRV2 pinfish exon 11404 11599 1150 . . transcript_id "289ed951-14e6-4c94-a619-512b17b95689_partu"; 494s SIRV2 pinfish mRNA 11404 11599 1150 . . gene_id "b34b5bc7-9286-4b0f-a81b-1f36fbf25e3e"; transcript_id "289ed951-14e6-4c94-a619-512b17b95689_partu2"; 494s SIRV2 pinfish exon 11404 11599 1150 . . transcript_id "289ed951-14e6-4c94-a619-512b17b95689_partu2"; 494s PASS 494s Test 3 496s polish_clusters: 14:30:15 Polishing cluster 69f7c638-9817-4707-83f2-a549b535f4fa of size 660 499s polish_clusters: 14:30:18 Polishing cluster d5311d0b-a683-459b-afa0-64bb6588cb4b of size 189 499s polish_clusters: 14:30:18 Polishing cluster c0d1a2e2-b5ed-4f09-aa77-847f943eb6be of size 384 501s polish_clusters: 14:30:20 Polishing cluster f2147906-bfa8-45e9-adfd-bab58da87b64 of size 139 501s polish_clusters: 14:30:20 Polishing cluster e0025e4f-e30d-4e5c-a47d-be4dd5834770 of size 3250 522s polish_clusters: 14:30:41 Polishing cluster d0d849a5-73ce-486d-9973-9604eb738e97 of size 161 523s polish_clusters: 14:30:42 Polishing cluster 2f125dd9-4f44-49fc-8905-505e266837d5 of size 156 523s polish_clusters: 14:30:42 Polishing cluster be4745f6-5709-4e0d-8a6f-d84da88e509f of size 55 523s polish_clusters: 14:30:42 Polishing cluster d3f33464-b7d7-4fe0-8bf3-4e16a052979c of size 163 524s polish_clusters: 14:30:43 Polishing cluster e59d225e-8639-4817-a814-9cf01a5fad69 of size 726 527s polish_clusters: 14:30:46 Polishing cluster 9501166c-fbff-401c-ad9e-ba089d18fdf9 of size 135 528s polish_clusters: 14:30:47 Polishing cluster e0053551-d160-4101-8d68-abc4db19f09a of size 225 529s polish_clusters: 14:30:47 Polishing cluster 710702cf-0166-4db7-bf92-f14eaf85e10d of size 493 531s polish_clusters: 14:30:50 Polishing cluster 2cba12d8-00f3-447b-b464-4ebfd02da9da of size 1292 537s polish_clusters: 14:30:56 Polishing cluster 7b233454-c6de-4bad-999e-43a8107f802a of size 2507 554s polish_clusters: 14:31:13 Polishing cluster 218a0234-6cad-4ed2-a482-bcf49262195c of size 213 555s polish_clusters: 14:31:14 Polishing cluster cb231a46-23e5-4a95-b83d-e2f5870a8f60 of size 246 555s polish_clusters: 14:31:14 Polishing cluster 68c7f8fd-e27f-4ae5-971b-3ac00256abed of size 7709 617s polish_clusters: 14:32:16 Polishing cluster 55a736fe-8adb-40e2-a89f-a59646876d66 of size 598 619s polish_clusters: 14:32:18 Polishing cluster 6cfc810d-520f-417e-b537-7e2601950743 of size 58 619s polish_clusters: 14:32:18 Polishing cluster e7d4f2aa-b589-4d2d-8319-79c438dc5afe of size 51 620s polish_clusters: 14:32:19 Polishing cluster 7e4d23f4-33f1-4f7a-bafa-16f03e38d434 of size 668 621s polish_clusters: 14:32:20 Polishing cluster 4f572852-145e-456f-a471-c1ed7b6a8d98 of size 67 622s polish_clusters: 14:32:21 Polishing cluster 6d59fc72-bb51-4146-ae35-307f2d17160f of size 1533 630s polish_clusters: 14:32:29 Polishing cluster 2af4fcf7-3856-46f1-aea5-02bf6bafe48e of size 1139 639s polish_clusters: 14:32:38 Polishing cluster 3c9024a7-cb04-4127-84bf-77df0604a0ce of size 504 642s polish_clusters: 14:32:40 Polishing cluster 10a9f426-ef5f-4c54-b5e6-b258cd7d5fdf of size 1225 648s polish_clusters: 14:32:47 Polishing cluster 81b0fca0-68ae-46ed-986f-27480f8e0c19 of size 4080 676s polish_clusters: 14:33:15 Polishing cluster 18711817-b430-4614-b923-440b354b59e7 of size 253 677s polish_clusters: 14:33:16 Polishing cluster 47e8ce77-e884-4cd4-b867-64cd93d78dd4 of size 597 680s polish_clusters: 14:33:19 Polishing cluster 1c874012-0ea4-4f2c-bf2f-1d60587f1a03 of size 213 680s polish_clusters: 14:33:19 Polishing cluster 89dc6d62-24d1-4005-b436-650a59bc3682 of size 99 680s polish_clusters: 14:33:19 Polishing cluster d575b61e-9056-4566-87b7-964b2777719f of size 437 681s polish_clusters: 14:33:20 Polishing cluster 6127afda-033c-4858-91d8-852f5dec20ea of size 145 682s polish_clusters: 14:33:21 Polishing cluster db28b817-968e-412f-bfa0-8afffc934436 of size 2888 701s polish_clusters: 14:33:40 Polishing cluster 16e0a1a8-e2d1-49dd-9f06-d7aacf9ebcf9 of size 232 703s polish_clusters: 14:33:42 Polishing cluster 5794c2d1-91d4-42e6-8688-d3f00bef54b6 of size 263 704s polish_clusters: 14:33:43 Polishing cluster aeeb53dd-7118-4273-bafa-d3e981dfa839 of size 401 705s polish_clusters: 14:33:44 Polishing cluster 8113bd02-5f8b-402c-aa43-73506beda23f of size 237 707s polish_clusters: 14:33:46 Polishing cluster c237f8ae-842e-45c8-85ff-c3f21d166805 of size 170 708s polish_clusters: 14:33:46 Polishing cluster 70e9cf32-0c93-4b9b-9da7-abd9be001810 of size 66 708s polish_clusters: 14:33:47 Polishing cluster b626f358-74fb-4130-bcb6-0be3e2ac3caf of size 161 708s polish_clusters: 14:33:47 Polishing cluster 0a87121d-8e1d-4e24-9a63-78d8b45c7555 of size 299 709s polish_clusters: 14:33:48 Polishing cluster 882acd77-2d08-4da8-80c6-a12e2939df3d of size 146 710s polish_clusters: 14:33:49 Polishing cluster f0ad0445-ea9a-4b39-9aeb-c561914e153e of size 500 712s polish_clusters: 14:33:50 Polishing cluster dcb4e1a7-80d0-43f8-95af-b0e5348c64be of size 430 714s polish_clusters: 14:33:53 Polishing cluster c6f23119-a7b5-4107-b5a8-18e6636a3370 of size 395 715s polish_clusters: 14:33:54 Polishing cluster 3adacf7a-2518-4dcb-a8c2-24ddeece5361 of size 192 716s polish_clusters: 14:33:55 Polishing cluster 0320c793-8011-447c-b03f-e5f452a2290e of size 2037 732s polish_clusters: 14:34:11 Polishing cluster 55be0ad3-0fc6-4bc6-807d-7395ccf2ec5f of size 404 733s polish_clusters: 14:34:12 Polishing cluster 703d1ac8-8014-45b7-a907-0360db4c6ee3 of size 248 734s polish_clusters: 14:34:13 Polishing cluster 7fa17a75-bfe4-46c3-8db2-a27c5464708d of size 50 734s polish_clusters: 14:34:13 Polishing cluster 2628a837-ba85-413d-afc2-05afafe0fc23 of size 732 738s polish_clusters: 14:34:17 Polishing cluster 721a1e6b-0ca5-4902-b19d-0f68b3fff3ea of size 87 738s polish_clusters: 14:34:17 Polishing cluster 90d2fc79-77a5-4fcd-8fbf-d69d94558575 of size 20898 993s polish_clusters: 14:38:32 Polishing cluster 6710eb9c-190b-4d4b-ac62-7211ed4fdd67 of size 2365 1012s polish_clusters: 14:38:50 Polishing cluster 79cb3bac-dece-4ab4-9414-4e98daeffb79 of size 4909 1051s polish_clusters: 14:39:30 Polishing cluster 7fb67f8c-1a46-4663-9561-792fa99ff746 of size 718 1055s polish_clusters: 14:39:34 Polishing cluster 067c64ae-5cbb-4648-8459-e01b84055974 of size 1353 1063s polish_clusters: 14:39:42 Polishing cluster 28ad623e-16e7-47c0-8b7b-fb0b7a8ccff1 of size 409 1064s polish_clusters: 14:39:43 Polishing cluster 75fe5beb-a3fe-4085-8ac8-e84f1d6da63b of size 236 1065s polish_clusters: 14:39:44 Polishing cluster ba726322-f95e-4d7e-9e8b-15d4b1d5a79f of size 1700 1076s polish_clusters: 14:39:55 Polishing cluster 086dbac1-56e8-4da1-8631-2797705773d9 of size 121 1076s polish_clusters: 14:39:55 Polishing cluster 875398a8-66ad-4cea-a8b0-3f310ef37f41 of size 1074 1085s polish_clusters: 14:40:04 Polishing cluster da8a55a8-9de2-47e4-bbde-97c7ecb11f3d of size 74 1085s polish_clusters: 14:40:04 Polishing cluster dddef182-804d-4ef3-b782-76ee9bbaef5d of size 1160 1095s polish_clusters: 14:40:14 Polishing cluster 817a7c5e-fde3-436e-a7b7-69da2eb402aa of size 578 1098s >69f7c638-9817-4707-83f2-a549b535f4fa|660 1098s TTGTTGTACTTCGTTCAGTTCGGAATTTGGGTGTTTAACCGGTTCGCCGCCTACCGTGACTCGATTCCGTTTGTAGTCGTCTGTTTTCTGTTGGTGCTGA 1098s TATTGCTGGGGGCCTCTAAATTCGGTATCAAGTATTTGCTTCTCCACCTGCCAAGCGCACATAAATTCTTTGCGAGTGTTGTTTGGCCACTTTTGGTAGC 1098s TCCTGTTTCTTGGCAATTTTGGCTGACACGTTCAGTTTCTTTTGCTCCAACTTCGTAAGCAGTTAGTGTAGGCGTGCGCTAAGGCATTGCGCTACTCGCT 1098s TCCATCGTTGGTTCTACCACCCATATGCCATGGCGTCCTGTAAGTTTGCGCCTAATTACTCGAAGCGCTTTCATTTCTACGAAACGTTTTGGAATAATGT 1098s CAACAGGGCATTGTTGAAACTACGGCTTCCTTAATGCTCTTGACAACCTTGTTTAGTTGTTGTTCTTCCTTCTTCCAGCATTTAATAACCGGCTTTTGTT 1098s TTAACTCCTTCGCTTTTCGACTTTCTCCTTTAGCACCGCAACGTTCTTTTTAAGCTACAACGCTTTCTTGAAATGCTTCTCGTCATAAAAAAAAAAAAAA 1098s AAAAAAAATAGAGCGACAGGCAAGTAGGTTAAACAGACGACTACAAACAGGCC 1098s >d5311d0b-a683-459b-afa0-64bb6588cb4b|189 1098s GCCTACCGTGACTCGATTCCGTTTGTAGTCGTCTGTTTTCTGTTGGTGCTGATATTGCTGGGGCGATGGGGGCGACAATTGTGGACCGTATGGACTCCAT 1098s TATGCTGGGACTCCTCGGGTCAACCGCTCTAAAGCGAAGTTGTTGGACAAACAGTTATGCGTAACTGTAAAAAGCAAGGTGCCCAAAGTAGACTGAGCGA 1098s CAGTCGAAACCAGCCCCAATGAACAAGACGCCATTGCAAAACGTCTATACGCTACGGTCAAAGACGCTTCCACACCACATGCTCTCATGTAGCCTACCTT 1098s ACGAAGAAATCGCACAAGTCGGTCGCCCAGCGGTGGCATATGTCTTGCCTAACGTTTCTAGACCGATCAGCCTCACAGTAGCCTGCTTGTGGTGTTTATA 1098s GTTTACGCTAGTCCAATCTGTATCGTGCCGCTTGGTATGGCTATTGTCGGCCTGGATGCAATTGTGCTCGCCATTTCAACTAGTGCAGTTGCTAAAGTGC 1098s CAACTAAGGTTCGTCTTGAAGCAATCGGTAGTATCTGCAGTCAAGTCGTAGTCGTAGGTATGGCACTTGTCGTGCGTCTAGGACGCGTTGAAGCTATCTT 1098s ATTGCCCGAAGGAGCCGAAAGTCTGGGACACGTCGTGGGACGTATCGTTAGGACTATGGGACTAGTCGTCTTCGGTCTTACAAATGTTGCAATGCCCTGT 1098s GAGCTACTTATGAAACATGAATGGTCGGTCTTGTGGTCGCTTTTGTCGAAATCACCGAAGTGCGTATAATTGATGAACGAGTCGAAGTCGAAGTTGTTCA 1098s ACAAAGAGTTAGGTAGTGCCGCTTGAAAAGTAATAGTGCAAATAAGAAAAAAAGCGAAACGGCATTCGTTTAACAAAACGTCACATATTTAGGTATAGTA 1098s GATTGCGTTCACAAAAGAAATTTAAAGTCTTGTAATTATGGTGGTCGATTTATTGGTAGTATATTTGGAAATAGCATGCAATTTTGGAATGGACGAAGAA 1098s CCTGACATCTGAGCTATTGTAAGTTTAATTTACCATTTCGTCATTGTATATGCGGTAAACGTAAATTTACACATATGACACGAACTTTGAGTTTTATTAG 1098s PASS 1098s Test 4 1098s ##gff-version 2 1098s SIRV1 pinfish mRNA 998 7648 . - . gene_id "f5624682-c18f-4126-b563-352ed883406d|+"; transcript_id "f5624682-c18f-4126-b563-352ed883406d|+"; 1098s SIRV1 pinfish exon 998 1484 . - . transcript_id "f5624682-c18f-4126-b563-352ed883406d|+"; 1098s SIRV1 pinfish exon 6338 6473 . - . transcript_id "f5624682-c18f-4126-b563-352ed883406d|+"; 1098s SIRV1 pinfish exon 6561 6813 . - . transcript_id "f5624682-c18f-4126-b563-352ed883406d|+"; 1098s SIRV1 pinfish exon 7553 7648 . - . transcript_id "f5624682-c18f-4126-b563-352ed883406d|+"; 1098s SIRV1 pinfish mRNA 998 10367 . - . gene_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish exon 998 1484 . - . transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish exon 6338 6473 . - . transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish exon 6561 6813 . - . transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish exon 7553 7814 . - . transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish exon 10283 10367 . - . transcript_id "4653124d-45d2-41a5-a307-c7aa9a585c08|+"; 1098s SIRV1 pinfish mRNA 998 10787 . - . gene_id "014c53fc-eb7b-4f4f-a529-2a96bbd0f5f8|+"; transcript_id "014c53fc-eb7b-4f4f-a529-2a96bbd0f5f8|+"; 1098s SIRV1 pinfish exon 998 1484 . - . transcript_id "014c53fc-eb7b-4f4f-a529-2a96bbd0f5f8|+"; 1098s SIRV1 pinfish exon 7553 7808 . - . transcript_id "014c53fc-eb7b-4f4f-a529-2a96bbd0f5f8|+"; 1098s SIRV1 pinfish exon 10554 10787 . - . transcript_id "014c53fc-eb7b-4f4f-a529-2a96bbd0f5f8|+"; 1098s SIRV1 pinfish mRNA 998 10779 . - . gene_id "4a42327a-1b55-4ccd-9507-47ba395381af|+"; transcript_id "4a42327a-1b55-4ccd-9507-47ba395381af|+"; 1098s SIRV1 pinfish exon 998 1484 . - . transcript_id "4a42327a-1b55-4ccd-9507-47ba395381af|+"; 1098s SIRV1 pinfish exon 6338 6473 . - . transcript_id "4a42327a-1b55-4ccd-9507-47ba395381af|+"; 1098s SIRV1 pinfish exon 6561 6813 . - . transcript_id "4a42327a-1b55-4ccd-9507-47ba395381af|+"; 1098s ##gff-version 2 1098s SIRV1 pinfish mRNA 1001 10785 . - . gene_id "SIRV106"; transcript_id "SIRV106"; 1098s SIRV1 pinfish exon 1001 1484 . - . transcript_id "SIRV106"; 1098s SIRV1 pinfish exon 7553 7808 . - . transcript_id "SIRV106"; 1098s SIRV1 pinfish exon 10554 10785 . - . transcript_id "SIRV106"; 1098s SIRV1 pinfish mRNA 1001 10786 . - . gene_id "SIRV101"; transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 1001 1484 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 6338 6473 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 6561 6813 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 7553 7814 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 10283 10366 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish exon 10445 10786 . - . transcript_id "SIRV101"; 1098s SIRV1 pinfish mRNA 1001 10791 . - . gene_id "SIRV103"; transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 1001 1484 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 6338 6473 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 6561 6813 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 7553 7816 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 10290 10366 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish exon 10648 10791 . - . transcript_id "SIRV103"; 1098s SIRV1 pinfish mRNA 1007 10366 . - . gene_id "SIRV102"; transcript_id "SIRV102"; 1098s PASS 1098s autopkgtest [14:40:17]: test run-unit-test: -----------------------] 1099s run-unit-test PASS 1099s autopkgtest [14:40:18]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 1099s autopkgtest [14:40:18]: @@@@@@@@@@@@@@@@@@@@ summary 1099s run-unit-test PASS 1117s nova [W] Using flock in prodstack6-arm64 1117s Creating nova instance adt-plucky-arm64-pinfish-20250315-142159-juju-7f2275-prod-proposed-migration-environment-2-754a442f-c945-4891-a21d-db2939045baf from image adt/ubuntu-plucky-arm64-server-20250315.img (UUID bd6e766c-b51f-4b53-86d6-23aa4d18f524)... 1117s nova [W] Timed out waiting for 12afbd33-0611-49de-b14c-fdcb7424e612 to get deleted.