0s autopkgtest [13:30:39]: starting date and time: 2025-03-15 13:30:39+0000 0s autopkgtest [13:30:39]: git checkout: 325255d2 Merge branch 'pin-any-arch' into 'ubuntu/production' 0s autopkgtest [13:30:39]: host juju-7f2275-prod-proposed-migration-environment-15; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.is1ilp6h/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:glibc --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=glibc/2.41-1ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-15@bos03-arm64-3.secgroup --name adt-plucky-arm64-ncbi-blast+-20250315-133039-juju-7f2275-prod-proposed-migration-environment-15-3a2d2a93-dc9a-4218-9b2c-b3ce26042cbc --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-15 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com,radosgw.ps5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 152s autopkgtest [13:33:11]: testbed dpkg architecture: arm64 152s autopkgtest [13:33:11]: testbed apt version: 2.9.33 153s autopkgtest [13:33:12]: @@@@@@@@@@@@@@@@@@@@ test bed setup 153s autopkgtest [13:33:12]: testbed release detected to be: None 154s autopkgtest [13:33:13]: updating testbed package index (apt update) 154s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [126 kB] 155s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 155s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 155s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 155s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [404 kB] 155s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.8 kB] 155s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [101 kB] 155s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [78.2 kB] 155s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 c-n-f Metadata [1976 B] 155s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 c-n-f Metadata [116 B] 155s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [346 kB] 156s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 c-n-f Metadata [15.8 kB] 156s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [4948 B] 156s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 c-n-f Metadata [572 B] 156s Fetched 1094 kB in 1s (744 kB/s) 157s Reading package lists... 157s + lsb_release --codename --short 157s + RELEASE=plucky 157s + cat 157s + [ plucky != trusty ] 157s + DEBIAN_FRONTEND=noninteractive eatmydata apt-get -y --allow-downgrades -o Dpkg::Options::=--force-confnew dist-upgrade 158s Reading package lists... 158s Building dependency tree... 158s Reading state information... 158s Calculating upgrade... 158s Calculating upgrade... 159s The following packages will be upgraded: 159s python3-jinja2 strace 159s 2 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 159s Need to get 608 kB of archives. 159s After this operation, 11.3 kB of additional disk space will be used. 159s Get:1 http://ftpmaster.internal/ubuntu plucky/main arm64 strace arm64 6.13+ds-1ubuntu1 [499 kB] 160s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 python3-jinja2 all 3.1.5-2ubuntu1 [109 kB] 160s Fetched 608 kB in 1s (725 kB/s) 161s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 161s Preparing to unpack .../strace_6.13+ds-1ubuntu1_arm64.deb ... 161s Unpacking strace (6.13+ds-1ubuntu1) over (6.11-0ubuntu1) ... 161s Preparing to unpack .../python3-jinja2_3.1.5-2ubuntu1_all.deb ... 161s Unpacking python3-jinja2 (3.1.5-2ubuntu1) over (3.1.5-2) ... 161s Setting up python3-jinja2 (3.1.5-2ubuntu1) ... 161s Setting up strace (6.13+ds-1ubuntu1) ... 161s Processing triggers for man-db (2.13.0-1) ... 162s + rm /etc/apt/preferences.d/force-downgrade-to-release.pref 162s + /usr/lib/apt/apt-helper analyze-pattern ?true 162s + uname -r 162s + sed s/\./\\./g 162s + running_kernel_pattern=^linux-.*6\.14\.0-10-generic.* 162s + apt list ?obsolete 162s + tail -n+2 162s + cut -d/ -f1 162s + grep -v ^linux-.*6\.14\.0-10-generic.* 162s + obsolete_pkgs=linux-headers-6.11.0-8-generic 162s linux-headers-6.11.0-8 162s linux-image-6.11.0-8-generic 162s linux-modules-6.11.0-8-generic 162s linux-tools-6.11.0-8-generic 162s linux-tools-6.11.0-8 162s + DEBIAN_FRONTEND=noninteractive eatmydata apt-get -y purge --autoremove linux-headers-6.11.0-8-generic linux-headers-6.11.0-8 linux-image-6.11.0-8-generic linux-modules-6.11.0-8-generic linux-tools-6.11.0-8-generic linux-tools-6.11.0-8 162s Reading package lists... 163s Building dependency tree... 163s Reading state information... 163s Solving dependencies... 163s The following packages will be REMOVED: 163s libnsl2* libpython3.12-minimal* libpython3.12-stdlib* libpython3.12t64* 163s libunwind8* linux-headers-6.11.0-8* linux-headers-6.11.0-8-generic* 163s linux-image-6.11.0-8-generic* linux-modules-6.11.0-8-generic* 163s linux-tools-6.11.0-8* linux-tools-6.11.0-8-generic* 164s 0 upgraded, 0 newly installed, 11 to remove and 5 not upgraded. 164s After this operation, 267 MB disk space will be freed. 164s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 117701 files and directories currently installed.) 164s Removing linux-tools-6.11.0-8-generic (6.11.0-8.8) ... 164s Removing linux-tools-6.11.0-8 (6.11.0-8.8) ... 164s Removing libpython3.12t64:arm64 (3.12.9-1) ... 164s Removing libpython3.12-stdlib:arm64 (3.12.9-1) ... 164s Removing libnsl2:arm64 (1.3.0-3build3) ... 164s Removing libpython3.12-minimal:arm64 (3.12.9-1) ... 164s Removing libunwind8:arm64 (1.6.2-3.1) ... 164s Removing linux-headers-6.11.0-8-generic (6.11.0-8.8) ... 164s Removing linux-headers-6.11.0-8 (6.11.0-8.8) ... 166s Removing linux-image-6.11.0-8-generic (6.11.0-8.8) ... 166s I: /boot/vmlinuz.old is now a symlink to vmlinuz-6.14.0-10-generic 166s I: /boot/initrd.img.old is now a symlink to initrd.img-6.14.0-10-generic 166s /etc/kernel/postrm.d/initramfs-tools: 166s update-initramfs: Deleting /boot/initrd.img-6.11.0-8-generic 166s /etc/kernel/postrm.d/zz-flash-kernel: 166s flash-kernel: Kernel 6.11.0-8-generic has been removed. 166s flash-kernel: A higher version (6.14.0-10-generic) is still installed, no reflashing required. 166s /etc/kernel/postrm.d/zz-update-grub: 166s Sourcing file `/etc/default/grub' 166s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 166s Generating grub configuration file ... 167s Found linux image: /boot/vmlinuz-6.14.0-10-generic 167s Found initrd image: /boot/initrd.img-6.14.0-10-generic 167s Warning: os-prober will not be executed to detect other bootable partitions. 167s Systems on them will not be added to the GRUB boot configuration. 167s Check GRUB_DISABLE_OS_PROBER documentation entry. 167s Adding boot menu entry for UEFI Firmware Settings ... 167s done 167s Removing linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 167s Processing triggers for libc-bin (2.41-1ubuntu1) ... 168s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81650 files and directories currently installed.) 168s Purging configuration files for linux-image-6.11.0-8-generic (6.11.0-8.8) ... 168s Purging configuration files for libpython3.12-minimal:arm64 (3.12.9-1) ... 168s Purging configuration files for linux-modules-6.11.0-8-generic (6.11.0-8.8) ... 168s + grep -q trusty /etc/lsb-release 168s + [ ! -d /usr/share/doc/unattended-upgrades ] 168s + [ ! -d /usr/share/doc/lxd ] 168s + [ ! -d /usr/share/doc/lxd-client ] 168s + [ ! -d /usr/share/doc/snapd ] 168s + type iptables 168s + cat 168s + chmod 755 /etc/rc.local 168s + . /etc/rc.local 168s + iptables -w -t mangle -A FORWARD -p tcp --tcp-flags SYN,RST SYN -j TCPMSS --clamp-mss-to-pmtu 168s + iptables -A OUTPUT -d 10.255.255.1/32 -p tcp -j DROP 168s + iptables -A OUTPUT -d 10.255.255.2/32 -p tcp -j DROP 168s + uname -m 168s + [ aarch64 = ppc64le ] 168s + [ -d /run/systemd/system ] 168s + systemd-detect-virt --quiet --vm 168s + mkdir -p /etc/systemd/system/systemd-random-seed.service.d/ 168s + cat 168s + grep -q lz4 /etc/initramfs-tools/initramfs.conf 168s + echo COMPRESS=lz4 168s autopkgtest [13:33:27]: upgrading testbed (apt dist-upgrade and autopurge) 168s Reading package lists... 168s Building dependency tree... 168s Reading state information... 169s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 169s Starting 2 pkgProblemResolver with broken count: 0 169s Done 170s Entering ResolveByKeep 170s 170s Calculating upgrade... 171s The following packages will be upgraded: 171s libc-bin libc-dev-bin libc6 libc6-dev locales 171s 5 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 171s Need to get 9530 kB of archives. 171s After this operation, 0 B of additional disk space will be used. 171s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6-dev arm64 2.41-1ubuntu2 [1750 kB] 172s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-dev-bin arm64 2.41-1ubuntu2 [24.0 kB] 172s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc6 arm64 2.41-1ubuntu2 [2910 kB] 174s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libc-bin arm64 2.41-1ubuntu2 [600 kB] 174s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 locales all 2.41-1ubuntu2 [4246 kB] 178s Preconfiguring packages ... 178s Fetched 9530 kB in 7s (1394 kB/s) 178s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 178s Preparing to unpack .../libc6-dev_2.41-1ubuntu2_arm64.deb ... 179s Unpacking libc6-dev:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 179s Preparing to unpack .../libc-dev-bin_2.41-1ubuntu2_arm64.deb ... 179s Unpacking libc-dev-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 179s Preparing to unpack .../libc6_2.41-1ubuntu2_arm64.deb ... 179s Unpacking libc6:arm64 (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 179s Setting up libc6:arm64 (2.41-1ubuntu2) ... 179s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 179s Preparing to unpack .../libc-bin_2.41-1ubuntu2_arm64.deb ... 179s Unpacking libc-bin (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 179s Setting up libc-bin (2.41-1ubuntu2) ... 180s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 180s Preparing to unpack .../locales_2.41-1ubuntu2_all.deb ... 180s Unpacking locales (2.41-1ubuntu2) over (2.41-1ubuntu1) ... 180s Setting up locales (2.41-1ubuntu2) ... 180s Generating locales (this might take a while)... 182s en_US.UTF-8... done 182s Generation complete. 183s Setting up libc-dev-bin (2.41-1ubuntu2) ... 183s Setting up libc6-dev:arm64 (2.41-1ubuntu2) ... 183s Processing triggers for man-db (2.13.0-1) ... 183s Processing triggers for systemd (257.3-1ubuntu3) ... 184s Reading package lists... 185s Building dependency tree... 185s Reading state information... 185s Starting pkgProblemResolver with broken count: 0 185s Starting 2 pkgProblemResolver with broken count: 0 185s Done 186s Solving dependencies... 186s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 186s autopkgtest [13:33:45]: rebooting testbed after setup commands that affected boot 210s autopkgtest [13:34:09]: testbed running kernel: Linux 6.14.0-10-generic #10-Ubuntu SMP PREEMPT_DYNAMIC Wed Mar 12 15:45:31 UTC 2025 213s autopkgtest [13:34:12]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 232s Get:1 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (dsc) [2401 B] 232s Get:2 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (tar) [18.4 MB] 232s Get:3 http://ftpmaster.internal/ubuntu plucky/universe ncbi-blast+ 2.16.0+ds-6build1 (diff) [40.8 kB] 232s gpgv: Signature made Thu Nov 21 15:47:04 2024 UTC 232s gpgv: using RSA key 4D0BE12F0E4776D8AACE9696E66C775AEBFE6C7D 232s gpgv: Can't check signature: No public key 232s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.16.0+ds-6build1.dsc: no acceptable signature found 233s autopkgtest [13:34:32]: testing package ncbi-blast+ version 2.16.0+ds-6build1 234s autopkgtest [13:34:33]: build not needed 240s autopkgtest [13:34:39]: test run-unit-test: preparing testbed 240s Reading package lists... 240s Building dependency tree... 240s Reading state information... 240s Starting pkgProblemResolver with broken count: 0 241s Starting 2 pkgProblemResolver with broken count: 0 241s Done 241s The following NEW packages will be installed: 241s libgomp1 libmbedcrypto16 libmbedtls21 libmbedx509-7 ncbi-blast+ 241s ncbi-blast+-legacy ncbi-data 241s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 241s Need to get 19.3 MB of archives. 241s After this operation, 90.5 MB of additional disk space will be used. 241s Get:1 http://ftpmaster.internal/ubuntu plucky/main arm64 libgomp1 arm64 15-20250222-0ubuntu1 [146 kB] 242s Get:2 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedcrypto16 arm64 3.6.2-3ubuntu1 [258 kB] 242s Get:3 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedx509-7 arm64 3.6.2-3ubuntu1 [35.7 kB] 242s Get:4 http://ftpmaster.internal/ubuntu plucky/universe arm64 libmbedtls21 arm64 3.6.2-3ubuntu1 [122 kB] 242s Get:5 http://ftpmaster.internal/ubuntu plucky/universe arm64 ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 246s Get:6 http://ftpmaster.internal/ubuntu plucky/universe arm64 ncbi-blast+ arm64 2.16.0+ds-6build1 [14.8 MB] 255s Get:7 http://ftpmaster.internal/ubuntu plucky/universe arm64 ncbi-blast+-legacy all 2.16.0+ds-6build1 [4984 B] 256s Fetched 19.3 MB in 14s (1367 kB/s) 256s Selecting previously unselected package libgomp1:arm64. 256s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 81647 files and directories currently installed.) 256s Preparing to unpack .../0-libgomp1_15-20250222-0ubuntu1_arm64.deb ... 256s Unpacking libgomp1:arm64 (15-20250222-0ubuntu1) ... 256s Selecting previously unselected package libmbedcrypto16:arm64. 256s Preparing to unpack .../1-libmbedcrypto16_3.6.2-3ubuntu1_arm64.deb ... 256s Unpacking libmbedcrypto16:arm64 (3.6.2-3ubuntu1) ... 256s Selecting previously unselected package libmbedx509-7:arm64. 256s Preparing to unpack .../2-libmbedx509-7_3.6.2-3ubuntu1_arm64.deb ... 256s Unpacking libmbedx509-7:arm64 (3.6.2-3ubuntu1) ... 256s Selecting previously unselected package libmbedtls21:arm64. 256s Preparing to unpack .../3-libmbedtls21_3.6.2-3ubuntu1_arm64.deb ... 256s Unpacking libmbedtls21:arm64 (3.6.2-3ubuntu1) ... 256s Selecting previously unselected package ncbi-data. 256s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 256s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 257s Selecting previously unselected package ncbi-blast+. 257s Preparing to unpack .../5-ncbi-blast+_2.16.0+ds-6build1_arm64.deb ... 257s Unpacking ncbi-blast+ (2.16.0+ds-6build1) ... 257s Selecting previously unselected package ncbi-blast+-legacy. 257s Preparing to unpack .../6-ncbi-blast+-legacy_2.16.0+ds-6build1_all.deb ... 257s Unpacking ncbi-blast+-legacy (2.16.0+ds-6build1) ... 257s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 257s Setting up libgomp1:arm64 (15-20250222-0ubuntu1) ... 257s Setting up libmbedcrypto16:arm64 (3.6.2-3ubuntu1) ... 257s Setting up libmbedx509-7:arm64 (3.6.2-3ubuntu1) ... 257s Setting up libmbedtls21:arm64 (3.6.2-3ubuntu1) ... 257s Setting up ncbi-blast+ (2.16.0+ds-6build1) ... 257s Setting up ncbi-blast+-legacy (2.16.0+ds-6build1) ... 257s Processing triggers for man-db (2.13.0-1) ... 258s Processing triggers for libc-bin (2.41-1ubuntu2) ... 259s autopkgtest [13:34:58]: test run-unit-test: [----------------------- 259s ---Creating Database-- 259s 259s 259s Building a new DB, current time: 03/15/2025 13:34:58 259s New DB name: /tmp/autopkgtest.rvz5JW/autopkgtest_tmp/testdb 259s New DB title: testdatabase.fa 259s Sequence type: Nucleotide 259s Keep MBits: T 259s Maximum file size: 3000000000B 259s Adding sequences from FASTA; added 3 sequences in 0.177624 seconds. 259s 259s 259s ---Searching Database for Hits--- 259s Warning: [blastn] Examining 5 or more matches is recommended 259s # BLASTN 2.16.0+ 259s # Query: gnl|MYDB|1 this is sequence 1 259s # Database: testdb 259s # Fields: query id, subject id, evalue, bit score 259s # 2 hits found 259s gnl|MYDB|1 gnl2 0.0 1299 259s gnl|MYDB|1 gnl1 0.0 1299 259s # BLAST processed 1 queries 259s ---Search and Fetch An Entry From Database--- 260s >gnl1 260s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 260s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 260s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 260s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 260s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 260s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 260s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 260s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 260s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 260s PASS 260s autopkgtest [13:34:59]: test run-unit-test: -----------------------] 260s run-unit-test PASS 260s autopkgtest [13:34:59]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 261s autopkgtest [13:35:00]: @@@@@@@@@@@@@@@@@@@@ summary 261s run-unit-test PASS 267s nova [W] Using flock in prodstack6-arm64 267s Creating nova instance adt-plucky-arm64-ncbi-blast+-20250315-133039-juju-7f2275-prod-proposed-migration-environment-15-3a2d2a93-dc9a-4218-9b2c-b3ce26042cbc from image adt/ubuntu-plucky-arm64-server-20250315.img (UUID bd6e766c-b51f-4b53-86d6-23aa4d18f524)... 267s nova [W] Timed out waiting for a71540b3-03e0-46ec-827b-fc57abe6d23d to get deleted.