0s autopkgtest [08:46:07]: starting date and time: 2024-11-13 08:46:07+0000 0s autopkgtest [08:46:07]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 0s autopkgtest [08:46:07]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.3k9smijr/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade abpoa --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-arm64-55.secgroup --name adt-plucky-arm64-abpoa-20241113-084607-juju-7f2275-prod-proposed-migration-environment-2-3aec0a0f-843b-43af-8311-17453f57ae12 --image adt/ubuntu-plucky-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 95s autopkgtest [08:47:42]: testbed dpkg architecture: arm64 95s autopkgtest [08:47:42]: testbed apt version: 2.9.8 95s autopkgtest [08:47:42]: @@@@@@@@@@@@@@@@@@@@ test bed setup 96s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 97s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 97s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 97s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 97s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 97s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [104 kB] 97s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 Packages [50.3 kB] 97s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [601 kB] 97s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [17.1 kB] 97s Fetched 1793 kB in 1s (2011 kB/s) 97s Reading package lists... 100s Reading package lists... 100s Building dependency tree... 100s Reading state information... 101s Calculating upgrade... 101s The following NEW packages will be installed: 101s python3.13-gdbm 101s The following packages will be upgraded: 101s libpython3-stdlib python3 python3-gdbm python3-minimal 102s 4 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 102s Need to get 101 kB of archives. 102s After this operation, 141 kB of additional disk space will be used. 102s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-minimal arm64 3.12.7-1 [27.4 kB] 102s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3 arm64 3.12.7-1 [24.0 kB] 102s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libpython3-stdlib arm64 3.12.7-1 [10.0 kB] 102s Get:4 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13-gdbm arm64 3.13.0-2 [30.7 kB] 102s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-gdbm arm64 3.12.7-1 [8642 B] 102s Fetched 101 kB in 0s (286 kB/s) 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 103s Preparing to unpack .../python3-minimal_3.12.7-1_arm64.deb ... 103s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 103s Setting up python3-minimal (3.12.7-1) ... 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 103s Preparing to unpack .../python3_3.12.7-1_arm64.deb ... 103s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 103s Preparing to unpack .../libpython3-stdlib_3.12.7-1_arm64.deb ... 103s Unpacking libpython3-stdlib:arm64 (3.12.7-1) over (3.12.6-0ubuntu1) ... 103s Selecting previously unselected package python3.13-gdbm. 103s Preparing to unpack .../python3.13-gdbm_3.13.0-2_arm64.deb ... 103s Unpacking python3.13-gdbm (3.13.0-2) ... 103s Preparing to unpack .../python3-gdbm_3.12.7-1_arm64.deb ... 103s Unpacking python3-gdbm:arm64 (3.12.7-1) over (3.12.6-1ubuntu1) ... 103s Setting up python3.13-gdbm (3.13.0-2) ... 103s Setting up libpython3-stdlib:arm64 (3.12.7-1) ... 103s Setting up python3 (3.12.7-1) ... 103s Setting up python3-gdbm:arm64 (3.12.7-1) ... 103s Processing triggers for man-db (2.12.1-3) ... 104s Reading package lists... 105s Building dependency tree... 105s Reading state information... 105s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 106s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 106s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 106s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 106s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 107s Reading package lists... 107s Reading package lists... 107s Building dependency tree... 107s Reading state information... 108s Calculating upgrade... 108s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 108s Reading package lists... 108s Building dependency tree... 108s Reading state information... 109s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 112s autopkgtest [08:47:59]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP PREEMPT_DYNAMIC Mon Sep 16 14:19:41 UTC 2024 112s autopkgtest [08:47:59]: @@@@@@@@@@@@@@@@@@@@ apt-source abpoa 114s Get:1 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (dsc) [2276 B] 114s Get:2 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (tar) [163 kB] 114s Get:3 http://ftpmaster.internal/ubuntu plucky/universe abpoa 1.5.3-1 (diff) [9836 B] 114s gpgv: Signature made Wed Sep 25 19:10:18 2024 UTC 114s gpgv: using RSA key 8F91B227C7D6F2B1948C8236793CF67E8F0D11DA 114s gpgv: issuer "emollier@debian.org" 114s gpgv: Can't check signature: No public key 114s dpkg-source: warning: cannot verify inline signature for ./abpoa_1.5.3-1.dsc: no acceptable signature found 115s autopkgtest [08:48:02]: testing package abpoa version 1.5.3-1 115s autopkgtest [08:48:02]: build not needed 117s autopkgtest [08:48:04]: test run-unit-test: preparing testbed 119s Reading package lists... 120s Building dependency tree... 120s Reading state information... 120s Starting pkgProblemResolver with broken count: 0 120s Starting 2 pkgProblemResolver with broken count: 0 120s Done 121s The following additional packages will be installed: 121s abpoa fontconfig fontconfig-config fonts-dejavu-core fonts-dejavu-mono 121s graphviz libann0 libaom3 libcairo2 libcdt5 libcgraph6 libdatrie1 libde265-0 121s libdeflate0 libfontconfig1 libgd3 libgomp1 libgraphite2-3 libgts-0.7-5t64 121s libgvc6 libgvpr2 libharfbuzz0b libheif-plugin-aomdec libheif-plugin-libde265 121s libheif1 libice6 libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 121s liblab-gamut1 liblerc4 libltdl7 libpango-1.0-0 libpangocairo-1.0-0 121s libpangoft2-1.0-0 libpathplan4 libpixman-1-0 libraqm0 libsharpyuv0 libsm6 121s libthai-data libthai0 libtiff6 libwebp7 libxaw7 libxcb-render0 libxcb-shm0 121s libxmu6 libxpm4 libxrender1 libxt6t64 python3-pyabpoa x11-common 121s Suggested packages: 121s gsfonts graphviz-doc libgd-tools libheif-plugin-x265 121s libheif-plugin-ffmpegdec libheif-plugin-jpegdec libheif-plugin-jpegenc 121s libheif-plugin-j2kdec libheif-plugin-j2kenc libheif-plugin-kvazaar 121s libheif-plugin-rav1e libheif-plugin-svtenc 121s Recommended packages: 121s fonts-liberation libgts-bin libheif-plugin-aomenc 121s The following NEW packages will be installed: 121s abpoa autopkgtest-satdep fontconfig fontconfig-config fonts-dejavu-core 121s fonts-dejavu-mono graphviz libann0 libaom3 libcairo2 libcdt5 libcgraph6 121s libdatrie1 libde265-0 libdeflate0 libfontconfig1 libgd3 libgomp1 121s libgraphite2-3 libgts-0.7-5t64 libgvc6 libgvpr2 libharfbuzz0b 121s libheif-plugin-aomdec libheif-plugin-libde265 libheif1 libice6 121s libimagequant0 libjbig0 libjpeg-turbo8 libjpeg8 liblab-gamut1 liblerc4 121s libltdl7 libpango-1.0-0 libpangocairo-1.0-0 libpangoft2-1.0-0 libpathplan4 121s libpixman-1-0 libraqm0 libsharpyuv0 libsm6 libthai-data libthai0 libtiff6 121s libwebp7 libxaw7 libxcb-render0 libxcb-shm0 libxmu6 libxpm4 libxrender1 121s libxt6t64 python3-pyabpoa x11-common 121s 0 upgraded, 55 newly installed, 0 to remove and 0 not upgraded. 121s Need to get 11.4 MB/11.4 MB of archives. 121s After this operation, 32.8 MB of additional disk space will be used. 121s Get:1 /tmp/autopkgtest.Ss1o9C/1-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [712 B] 121s Get:2 http://ftpmaster.internal/ubuntu plucky/universe arm64 libann0 arm64 1.1.2+doc-9build1 [25.7 kB] 121s Get:3 http://ftpmaster.internal/ubuntu plucky/universe arm64 libcdt5 arm64 2.42.4-2build3 [21.3 kB] 121s Get:4 http://ftpmaster.internal/ubuntu plucky/universe arm64 libcgraph6 arm64 2.42.4-2build3 [45.1 kB] 121s Get:5 http://ftpmaster.internal/ubuntu plucky/main arm64 fonts-dejavu-mono all 2.37-8 [502 kB] 121s Get:6 http://ftpmaster.internal/ubuntu plucky/main arm64 fonts-dejavu-core all 2.37-8 [835 kB] 122s Get:7 http://ftpmaster.internal/ubuntu plucky/main arm64 fontconfig-config arm64 2.15.0-1.1ubuntu2 [37.4 kB] 122s Get:8 http://ftpmaster.internal/ubuntu plucky/main arm64 libfontconfig1 arm64 2.15.0-1.1ubuntu2 [142 kB] 122s Get:9 http://ftpmaster.internal/ubuntu plucky/main arm64 libsharpyuv0 arm64 1.4.0-0.1 [16.3 kB] 122s Get:10 http://ftpmaster.internal/ubuntu plucky/main arm64 libaom3 arm64 3.11.0~rc1-1 [1837 kB] 122s Get:11 http://ftpmaster.internal/ubuntu plucky/main arm64 libheif-plugin-aomdec arm64 1.18.1-2 [10.9 kB] 122s Get:12 http://ftpmaster.internal/ubuntu plucky/main arm64 libde265-0 arm64 1.0.15-1build4 [146 kB] 122s Get:13 http://ftpmaster.internal/ubuntu plucky/main arm64 libheif-plugin-libde265 arm64 1.18.1-2 [8612 B] 122s Get:14 http://ftpmaster.internal/ubuntu plucky/main arm64 libheif1 arm64 1.18.1-2 [274 kB] 122s Get:15 http://ftpmaster.internal/ubuntu plucky/main arm64 libgomp1 arm64 14.2.0-8ubuntu1 [145 kB] 122s Get:16 http://ftpmaster.internal/ubuntu plucky/main arm64 libimagequant0 arm64 2.18.0-1build1 [37.1 kB] 122s Get:17 http://ftpmaster.internal/ubuntu plucky/main arm64 libjpeg-turbo8 arm64 2.1.5-2ubuntu2 [163 kB] 122s Get:18 http://ftpmaster.internal/ubuntu plucky/main arm64 libjpeg8 arm64 8c-2ubuntu11 [2148 B] 122s Get:19 http://ftpmaster.internal/ubuntu plucky/main arm64 libgraphite2-3 arm64 1.3.14-2ubuntu1 [70.6 kB] 122s Get:20 http://ftpmaster.internal/ubuntu plucky/main arm64 libharfbuzz0b arm64 10.0.1-1 [487 kB] 122s Get:21 http://ftpmaster.internal/ubuntu plucky/main arm64 libraqm0 arm64 0.10.1-1build1 [14.7 kB] 122s Get:22 http://ftpmaster.internal/ubuntu plucky/main arm64 libdeflate0 arm64 1.22-1 [46.2 kB] 122s Get:23 http://ftpmaster.internal/ubuntu plucky/main arm64 libjbig0 arm64 2.1-6.1ubuntu2 [29.3 kB] 122s Get:24 http://ftpmaster.internal/ubuntu plucky/main arm64 liblerc4 arm64 4.0.0+ds-4ubuntu2 [154 kB] 122s Get:25 http://ftpmaster.internal/ubuntu plucky/main arm64 libwebp7 arm64 1.4.0-0.1 [192 kB] 122s Get:26 http://ftpmaster.internal/ubuntu plucky/main arm64 libtiff6 arm64 4.5.1+git230720-4ubuntu4 [193 kB] 122s Get:27 http://ftpmaster.internal/ubuntu plucky/main arm64 libxpm4 arm64 1:3.5.17-1build2 [35.1 kB] 122s Get:28 http://ftpmaster.internal/ubuntu plucky/main arm64 libgd3 arm64 2.3.3-12ubuntu3 [122 kB] 122s Get:29 http://ftpmaster.internal/ubuntu plucky/universe arm64 libgts-0.7-5t64 arm64 0.7.6+darcs121130-5.2build1 [154 kB] 122s Get:30 http://ftpmaster.internal/ubuntu plucky/main arm64 libpixman-1-0 arm64 0.44.0-3 [197 kB] 122s Get:31 http://ftpmaster.internal/ubuntu plucky/main arm64 libxcb-render0 arm64 1.17.0-2 [16.6 kB] 122s Get:32 http://ftpmaster.internal/ubuntu plucky/main arm64 libxcb-shm0 arm64 1.17.0-2 [5884 B] 122s Get:33 http://ftpmaster.internal/ubuntu plucky/main arm64 libxrender1 arm64 1:0.9.10-1.1build1 [18.8 kB] 122s Get:34 http://ftpmaster.internal/ubuntu plucky/main arm64 libcairo2 arm64 1.18.2-2 [560 kB] 122s Get:35 http://ftpmaster.internal/ubuntu plucky/main arm64 libltdl7 arm64 2.4.7-7build1 [40.4 kB] 122s Get:36 http://ftpmaster.internal/ubuntu plucky/main arm64 fontconfig arm64 2.15.0-1.1ubuntu2 [190 kB] 122s Get:37 http://ftpmaster.internal/ubuntu plucky/main arm64 libthai-data all 0.1.29-2build1 [158 kB] 122s Get:38 http://ftpmaster.internal/ubuntu plucky/main arm64 libdatrie1 arm64 0.2.13-3build1 [19.2 kB] 122s Get:39 http://ftpmaster.internal/ubuntu plucky/main arm64 libthai0 arm64 0.1.29-2build1 [18.2 kB] 122s Get:40 http://ftpmaster.internal/ubuntu plucky/main arm64 libpango-1.0-0 arm64 1.54.0+ds-3 [234 kB] 122s Get:41 http://ftpmaster.internal/ubuntu plucky/main arm64 libpangoft2-1.0-0 arm64 1.54.0+ds-3 [48.9 kB] 122s Get:42 http://ftpmaster.internal/ubuntu plucky/main arm64 libpangocairo-1.0-0 arm64 1.54.0+ds-3 [27.5 kB] 122s Get:43 http://ftpmaster.internal/ubuntu plucky/universe arm64 libpathplan4 arm64 2.42.4-2build3 [23.4 kB] 122s Get:44 http://ftpmaster.internal/ubuntu plucky/universe arm64 libgvc6 arm64 2.42.4-2build3 [706 kB] 122s Get:45 http://ftpmaster.internal/ubuntu plucky/universe arm64 libgvpr2 arm64 2.42.4-2build3 [187 kB] 122s Get:46 http://ftpmaster.internal/ubuntu plucky/universe arm64 liblab-gamut1 arm64 2.42.4-2build3 [1840 kB] 122s Get:47 http://ftpmaster.internal/ubuntu plucky/main arm64 x11-common all 1:7.7+23ubuntu3 [21.7 kB] 122s Get:48 http://ftpmaster.internal/ubuntu plucky/main arm64 libice6 arm64 2:1.1.1-1 [42.3 kB] 122s Get:49 http://ftpmaster.internal/ubuntu plucky/main arm64 libsm6 arm64 2:1.2.4-1 [16.4 kB] 122s Get:50 http://ftpmaster.internal/ubuntu plucky/main arm64 libxt6t64 arm64 1:1.2.1-1.2build1 [168 kB] 122s Get:51 http://ftpmaster.internal/ubuntu plucky/main arm64 libxmu6 arm64 2:1.1.3-3build2 [47.5 kB] 122s Get:52 http://ftpmaster.internal/ubuntu plucky/main arm64 libxaw7 arm64 2:1.0.16-1 [184 kB] 122s Get:53 http://ftpmaster.internal/ubuntu plucky/universe arm64 graphviz arm64 2.42.4-2build3 [619 kB] 122s Get:54 http://ftpmaster.internal/ubuntu plucky/universe arm64 abpoa arm64 1.5.3-1 [132 kB] 122s Get:55 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-pyabpoa arm64 1.5.3-1 [171 kB] 123s Fetched 11.4 MB in 1s (8519 kB/s) 123s Selecting previously unselected package libann0. 123s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79931 files and directories currently installed.) 123s Preparing to unpack .../00-libann0_1.1.2+doc-9build1_arm64.deb ... 123s Unpacking libann0 (1.1.2+doc-9build1) ... 123s Selecting previously unselected package libcdt5:arm64. 123s Preparing to unpack .../01-libcdt5_2.42.4-2build3_arm64.deb ... 123s Unpacking libcdt5:arm64 (2.42.4-2build3) ... 123s Selecting previously unselected package libcgraph6:arm64. 123s Preparing to unpack .../02-libcgraph6_2.42.4-2build3_arm64.deb ... 123s Unpacking libcgraph6:arm64 (2.42.4-2build3) ... 123s Selecting previously unselected package fonts-dejavu-mono. 123s Preparing to unpack .../03-fonts-dejavu-mono_2.37-8_all.deb ... 123s Unpacking fonts-dejavu-mono (2.37-8) ... 123s Selecting previously unselected package fonts-dejavu-core. 123s Preparing to unpack .../04-fonts-dejavu-core_2.37-8_all.deb ... 123s Unpacking fonts-dejavu-core (2.37-8) ... 123s Selecting previously unselected package fontconfig-config. 123s Preparing to unpack .../05-fontconfig-config_2.15.0-1.1ubuntu2_arm64.deb ... 123s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 123s Selecting previously unselected package libfontconfig1:arm64. 123s Preparing to unpack .../06-libfontconfig1_2.15.0-1.1ubuntu2_arm64.deb ... 123s Unpacking libfontconfig1:arm64 (2.15.0-1.1ubuntu2) ... 123s Selecting previously unselected package libsharpyuv0:arm64. 123s Preparing to unpack .../07-libsharpyuv0_1.4.0-0.1_arm64.deb ... 123s Unpacking libsharpyuv0:arm64 (1.4.0-0.1) ... 123s Selecting previously unselected package libaom3:arm64. 123s Preparing to unpack .../08-libaom3_3.11.0~rc1-1_arm64.deb ... 123s Unpacking libaom3:arm64 (3.11.0~rc1-1) ... 123s Selecting previously unselected package libheif-plugin-aomdec:arm64. 123s Preparing to unpack .../09-libheif-plugin-aomdec_1.18.1-2_arm64.deb ... 123s Unpacking libheif-plugin-aomdec:arm64 (1.18.1-2) ... 123s Selecting previously unselected package libde265-0:arm64. 123s Preparing to unpack .../10-libde265-0_1.0.15-1build4_arm64.deb ... 123s Unpacking libde265-0:arm64 (1.0.15-1build4) ... 123s Selecting previously unselected package libheif-plugin-libde265:arm64. 123s Preparing to unpack .../11-libheif-plugin-libde265_1.18.1-2_arm64.deb ... 123s Unpacking libheif-plugin-libde265:arm64 (1.18.1-2) ... 123s Selecting previously unselected package libheif1:arm64. 123s Preparing to unpack .../12-libheif1_1.18.1-2_arm64.deb ... 123s Unpacking libheif1:arm64 (1.18.1-2) ... 123s Selecting previously unselected package libgomp1:arm64. 123s Preparing to unpack .../13-libgomp1_14.2.0-8ubuntu1_arm64.deb ... 123s Unpacking libgomp1:arm64 (14.2.0-8ubuntu1) ... 124s Selecting previously unselected package libimagequant0:arm64. 124s Preparing to unpack .../14-libimagequant0_2.18.0-1build1_arm64.deb ... 124s Unpacking libimagequant0:arm64 (2.18.0-1build1) ... 124s Selecting previously unselected package libjpeg-turbo8:arm64. 124s Preparing to unpack .../15-libjpeg-turbo8_2.1.5-2ubuntu2_arm64.deb ... 124s Unpacking libjpeg-turbo8:arm64 (2.1.5-2ubuntu2) ... 124s Selecting previously unselected package libjpeg8:arm64. 124s Preparing to unpack .../16-libjpeg8_8c-2ubuntu11_arm64.deb ... 124s Unpacking libjpeg8:arm64 (8c-2ubuntu11) ... 124s Selecting previously unselected package libgraphite2-3:arm64. 124s Preparing to unpack .../17-libgraphite2-3_1.3.14-2ubuntu1_arm64.deb ... 124s Unpacking libgraphite2-3:arm64 (1.3.14-2ubuntu1) ... 124s Selecting previously unselected package libharfbuzz0b:arm64. 124s Preparing to unpack .../18-libharfbuzz0b_10.0.1-1_arm64.deb ... 124s Unpacking libharfbuzz0b:arm64 (10.0.1-1) ... 124s Selecting previously unselected package libraqm0:arm64. 124s Preparing to unpack .../19-libraqm0_0.10.1-1build1_arm64.deb ... 124s Unpacking libraqm0:arm64 (0.10.1-1build1) ... 124s Selecting previously unselected package libdeflate0:arm64. 124s Preparing to unpack .../20-libdeflate0_1.22-1_arm64.deb ... 124s Unpacking libdeflate0:arm64 (1.22-1) ... 124s Selecting previously unselected package libjbig0:arm64. 124s Preparing to unpack .../21-libjbig0_2.1-6.1ubuntu2_arm64.deb ... 124s Unpacking libjbig0:arm64 (2.1-6.1ubuntu2) ... 124s Selecting previously unselected package liblerc4:arm64. 124s Preparing to unpack .../22-liblerc4_4.0.0+ds-4ubuntu2_arm64.deb ... 124s Unpacking liblerc4:arm64 (4.0.0+ds-4ubuntu2) ... 124s Selecting previously unselected package libwebp7:arm64. 124s Preparing to unpack .../23-libwebp7_1.4.0-0.1_arm64.deb ... 124s Unpacking libwebp7:arm64 (1.4.0-0.1) ... 124s Selecting previously unselected package libtiff6:arm64. 124s Preparing to unpack .../24-libtiff6_4.5.1+git230720-4ubuntu4_arm64.deb ... 124s Unpacking libtiff6:arm64 (4.5.1+git230720-4ubuntu4) ... 124s Selecting previously unselected package libxpm4:arm64. 124s Preparing to unpack .../25-libxpm4_1%3a3.5.17-1build2_arm64.deb ... 124s Unpacking libxpm4:arm64 (1:3.5.17-1build2) ... 124s Selecting previously unselected package libgd3:arm64. 124s Preparing to unpack .../26-libgd3_2.3.3-12ubuntu3_arm64.deb ... 124s Unpacking libgd3:arm64 (2.3.3-12ubuntu3) ... 124s Selecting previously unselected package libgts-0.7-5t64:arm64. 124s Preparing to unpack .../27-libgts-0.7-5t64_0.7.6+darcs121130-5.2build1_arm64.deb ... 124s Unpacking libgts-0.7-5t64:arm64 (0.7.6+darcs121130-5.2build1) ... 124s Selecting previously unselected package libpixman-1-0:arm64. 124s Preparing to unpack .../28-libpixman-1-0_0.44.0-3_arm64.deb ... 124s Unpacking libpixman-1-0:arm64 (0.44.0-3) ... 124s Selecting previously unselected package libxcb-render0:arm64. 124s Preparing to unpack .../29-libxcb-render0_1.17.0-2_arm64.deb ... 124s Unpacking libxcb-render0:arm64 (1.17.0-2) ... 124s Selecting previously unselected package libxcb-shm0:arm64. 124s Preparing to unpack .../30-libxcb-shm0_1.17.0-2_arm64.deb ... 124s Unpacking libxcb-shm0:arm64 (1.17.0-2) ... 124s Selecting previously unselected package libxrender1:arm64. 124s Preparing to unpack .../31-libxrender1_1%3a0.9.10-1.1build1_arm64.deb ... 124s Unpacking libxrender1:arm64 (1:0.9.10-1.1build1) ... 124s Selecting previously unselected package libcairo2:arm64. 124s Preparing to unpack .../32-libcairo2_1.18.2-2_arm64.deb ... 124s Unpacking libcairo2:arm64 (1.18.2-2) ... 124s Selecting previously unselected package libltdl7:arm64. 124s Preparing to unpack .../33-libltdl7_2.4.7-7build1_arm64.deb ... 124s Unpacking libltdl7:arm64 (2.4.7-7build1) ... 124s Selecting previously unselected package fontconfig. 124s Preparing to unpack .../34-fontconfig_2.15.0-1.1ubuntu2_arm64.deb ... 124s Unpacking fontconfig (2.15.0-1.1ubuntu2) ... 124s Selecting previously unselected package libthai-data. 124s Preparing to unpack .../35-libthai-data_0.1.29-2build1_all.deb ... 124s Unpacking libthai-data (0.1.29-2build1) ... 124s Selecting previously unselected package libdatrie1:arm64. 124s Preparing to unpack .../36-libdatrie1_0.2.13-3build1_arm64.deb ... 124s Unpacking libdatrie1:arm64 (0.2.13-3build1) ... 124s Selecting previously unselected package libthai0:arm64. 124s Preparing to unpack .../37-libthai0_0.1.29-2build1_arm64.deb ... 124s Unpacking libthai0:arm64 (0.1.29-2build1) ... 124s Selecting previously unselected package libpango-1.0-0:arm64. 124s Preparing to unpack .../38-libpango-1.0-0_1.54.0+ds-3_arm64.deb ... 124s Unpacking libpango-1.0-0:arm64 (1.54.0+ds-3) ... 124s Selecting previously unselected package libpangoft2-1.0-0:arm64. 124s Preparing to unpack .../39-libpangoft2-1.0-0_1.54.0+ds-3_arm64.deb ... 124s Unpacking libpangoft2-1.0-0:arm64 (1.54.0+ds-3) ... 125s Selecting previously unselected package libpangocairo-1.0-0:arm64. 125s Preparing to unpack .../40-libpangocairo-1.0-0_1.54.0+ds-3_arm64.deb ... 125s Unpacking libpangocairo-1.0-0:arm64 (1.54.0+ds-3) ... 125s Selecting previously unselected package libpathplan4:arm64. 125s Preparing to unpack .../41-libpathplan4_2.42.4-2build3_arm64.deb ... 125s Unpacking libpathplan4:arm64 (2.42.4-2build3) ... 125s Selecting previously unselected package libgvc6. 125s Preparing to unpack .../42-libgvc6_2.42.4-2build3_arm64.deb ... 125s Unpacking libgvc6 (2.42.4-2build3) ... 125s Selecting previously unselected package libgvpr2:arm64. 125s Preparing to unpack .../43-libgvpr2_2.42.4-2build3_arm64.deb ... 125s Unpacking libgvpr2:arm64 (2.42.4-2build3) ... 125s Selecting previously unselected package liblab-gamut1:arm64. 125s Preparing to unpack .../44-liblab-gamut1_2.42.4-2build3_arm64.deb ... 125s Unpacking liblab-gamut1:arm64 (2.42.4-2build3) ... 125s Selecting previously unselected package x11-common. 125s Preparing to unpack .../45-x11-common_1%3a7.7+23ubuntu3_all.deb ... 125s Unpacking x11-common (1:7.7+23ubuntu3) ... 125s Selecting previously unselected package libice6:arm64. 125s Preparing to unpack .../46-libice6_2%3a1.1.1-1_arm64.deb ... 125s Unpacking libice6:arm64 (2:1.1.1-1) ... 125s Selecting previously unselected package libsm6:arm64. 125s Preparing to unpack .../47-libsm6_2%3a1.2.4-1_arm64.deb ... 125s Unpacking libsm6:arm64 (2:1.2.4-1) ... 125s Selecting previously unselected package libxt6t64:arm64. 125s Preparing to unpack .../48-libxt6t64_1%3a1.2.1-1.2build1_arm64.deb ... 125s Unpacking libxt6t64:arm64 (1:1.2.1-1.2build1) ... 125s Selecting previously unselected package libxmu6:arm64. 125s Preparing to unpack .../49-libxmu6_2%3a1.1.3-3build2_arm64.deb ... 125s Unpacking libxmu6:arm64 (2:1.1.3-3build2) ... 125s Selecting previously unselected package libxaw7:arm64. 125s Preparing to unpack .../50-libxaw7_2%3a1.0.16-1_arm64.deb ... 125s Unpacking libxaw7:arm64 (2:1.0.16-1) ... 125s Selecting previously unselected package graphviz. 125s Preparing to unpack .../51-graphviz_2.42.4-2build3_arm64.deb ... 125s Unpacking graphviz (2.42.4-2build3) ... 125s Selecting previously unselected package abpoa. 125s Preparing to unpack .../52-abpoa_1.5.3-1_arm64.deb ... 125s Unpacking abpoa (1.5.3-1) ... 125s Selecting previously unselected package python3-pyabpoa. 125s Preparing to unpack .../53-python3-pyabpoa_1.5.3-1_arm64.deb ... 125s Unpacking python3-pyabpoa (1.5.3-1) ... 125s Selecting previously unselected package autopkgtest-satdep. 125s Preparing to unpack .../54-1-autopkgtest-satdep.deb ... 125s Unpacking autopkgtest-satdep (0) ... 125s Setting up libgraphite2-3:arm64 (1.3.14-2ubuntu1) ... 125s Setting up libpixman-1-0:arm64 (0.44.0-3) ... 125s Setting up libsharpyuv0:arm64 (1.4.0-0.1) ... 125s Setting up libaom3:arm64 (3.11.0~rc1-1) ... 125s Setting up liblerc4:arm64 (4.0.0+ds-4ubuntu2) ... 125s Setting up libxpm4:arm64 (1:3.5.17-1build2) ... 125s Setting up libxrender1:arm64 (1:0.9.10-1.1build1) ... 125s Setting up libdatrie1:arm64 (0.2.13-3build1) ... 125s Setting up python3-pyabpoa (1.5.3-1) ... 125s Setting up libxcb-render0:arm64 (1.17.0-2) ... 125s Setting up liblab-gamut1:arm64 (2.42.4-2build3) ... 125s Setting up x11-common (1:7.7+23ubuntu3) ... 126s Setting up libdeflate0:arm64 (1.22-1) ... 126s Setting up libxcb-shm0:arm64 (1.17.0-2) ... 126s Setting up libgomp1:arm64 (14.2.0-8ubuntu1) ... 126s Setting up libjbig0:arm64 (2.1-6.1ubuntu2) ... 126s Setting up libpathplan4:arm64 (2.42.4-2build3) ... 126s Setting up libann0 (1.1.2+doc-9build1) ... 126s Setting up libimagequant0:arm64 (2.18.0-1build1) ... 126s Setting up fonts-dejavu-mono (2.37-8) ... 126s Setting up fonts-dejavu-core (2.37-8) ... 126s Setting up libjpeg-turbo8:arm64 (2.1.5-2ubuntu2) ... 126s Setting up libltdl7:arm64 (2.4.7-7build1) ... 126s Setting up libwebp7:arm64 (1.4.0-0.1) ... 126s Setting up libharfbuzz0b:arm64 (10.0.1-1) ... 126s Setting up libthai-data (0.1.29-2build1) ... 126s Setting up libgts-0.7-5t64:arm64 (0.7.6+darcs121130-5.2build1) ... 126s Setting up libcdt5:arm64 (2.42.4-2build3) ... 126s Setting up libcgraph6:arm64 (2.42.4-2build3) ... 126s Setting up libde265-0:arm64 (1.0.15-1build4) ... 126s Setting up libjpeg8:arm64 (8c-2ubuntu11) ... 126s Setting up libice6:arm64 (2:1.1.1-1) ... 126s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 126s Setting up libthai0:arm64 (0.1.29-2build1) ... 126s Setting up libraqm0:arm64 (0.10.1-1build1) ... 126s Setting up libgvpr2:arm64 (2.42.4-2build3) ... 126s Setting up libtiff6:arm64 (4.5.1+git230720-4ubuntu4) ... 126s Setting up libfontconfig1:arm64 (2.15.0-1.1ubuntu2) ... 126s Setting up libsm6:arm64 (2:1.2.4-1) ... 126s Setting up fontconfig (2.15.0-1.1ubuntu2) ... 128s Regenerating fonts cache... done. 128s Setting up libpango-1.0-0:arm64 (1.54.0+ds-3) ... 128s Setting up libcairo2:arm64 (1.18.2-2) ... 128s Setting up libxt6t64:arm64 (1:1.2.1-1.2build1) ... 128s Setting up libpangoft2-1.0-0:arm64 (1.54.0+ds-3) ... 128s Setting up libpangocairo-1.0-0:arm64 (1.54.0+ds-3) ... 128s Setting up libxmu6:arm64 (2:1.1.3-3build2) ... 128s Setting up libxaw7:arm64 (2:1.0.16-1) ... 128s Setting up libheif-plugin-aomdec:arm64 (1.18.1-2) ... 128s Setting up libheif-plugin-libde265:arm64 (1.18.1-2) ... 128s Setting up libheif1:arm64 (1.18.1-2) ... 128s Setting up libgd3:arm64 (2.3.3-12ubuntu3) ... 128s Setting up libgvc6 (2.42.4-2build3) ... 128s Setting up graphviz (2.42.4-2build3) ... 128s Setting up abpoa (1.5.3-1) ... 128s Setting up autopkgtest-satdep (0) ... 128s Processing triggers for libc-bin (2.40-1ubuntu3) ... 128s Processing triggers for man-db (2.12.1-3) ... 133s (Reading database ... 80513 files and directories currently installed.) 133s Removing autopkgtest-satdep (0) ... 134s autopkgtest [08:48:21]: test run-unit-test: [----------------------- 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' avx2 = dispatch ']' 134s + '[' avx2 = generic ']' 134s + grep -q avx2 /proc/cpuinfo 134s + continue 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' avx = dispatch ']' 134s + '[' avx = generic ']' 134s + grep -q avx /proc/cpuinfo 134s + continue 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' sse4.1 = dispatch ']' 134s + '[' sse4.1 = generic ']' 134s + grep -q sse4.1 /proc/cpuinfo 134s + continue 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' ssse3 = dispatch ']' 134s + '[' ssse3 = generic ']' 134s + grep -q ssse3 /proc/cpuinfo 134s + continue 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' sse3 = dispatch ']' 134s + '[' sse3 = generic ']' 134s + grep -q sse3 /proc/cpuinfo 134s + continue 134s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 134s + '[' generic = dispatch ']' 134s + '[' generic = generic ']' 134s + command -v abpoa.generic 134s + BINARY=abpoa.generic 134s + abpoa.generic --version 134s + abpoa.generic --help 134s 134s abpoa: adaptive banded Partial Order Alignment 134s 134s Version: 1.5.3 Contact: yangao@ds.dfci.harvard.edu 134s 134s Usage: abpoa [options] > cons.fa/msa.fa/abpoa.gfa 134s 134s Options: 134s Alignment: 134s -m --aln-mode INT alignment mode [0] 134s 0: global, 1: local, 2: extension 134s -M --match INT match score [2] 134s -X --mismatch INT mismatch penalty [4] 134s -t --matrix FILE scoring matrix file, '-M' and '-X' are not used when '-t' is used [Null] 134s e.g., 'HOXD70.mtx, BLOSUM62.mtx' 134s -O --gap-open INT(,INT) gap opening penalty (O1,O2) [4,24] 134s -E --gap-ext INT(,INT) gap extension penalty (E1,E2) [2,1] 134s abPOA provides three gap penalty modes, cost of a g-long gap: 134s - convex (default): min{O1+g*E1, O2+g*E2} 134s - affine (set O2 as 0): O1+g*E1 134s - linear (set O1 as 0): g*E1 134s -s --amb-strand ambiguous strand mode [False] 134s for each input sequence, try the reverse complement if the current 134s alignment score is too low, and pick the strand with a higher score 134s Adaptive banded DP: 134s -b --extra-b INT first adaptive banding parameter [10] 134s set b as < 0 to disable adaptive banded DP 134s -f --extra-f FLOAT second adaptive banding parameter [0.01] 134s the number of extra bases added on both sites of the band is 134s b+f*L, where L is the length of the aligned sequence 134s Minimizer-based seeding and partition (only effective in global alignment mode): 134s -S --seeding enable minimizer-based seeding and anchoring [False] 134s -k --k-mer INT minimizer k-mer size [19] 134s -w --window INT minimizer window size [10] 134s -n --min-poa-win INT min. size of window to perform POA [500] 134s -p --progressive build guide tree and perform progressive partial order alignment [False] 134s Input/Output: 134s -Q --use-qual-weight take base quality score from FASTQ input file as graph edge weight for consensus calling [False] 134s effective only when input sequences are in FASTQ format and consensus calling with heaviest bundling 134s -c --amino-acid input sequences are amino acid (default is nucleotide) [False] 134s -l --in-list input file is a list of sequence file names [False] 134s each line is one sequence file containing a set of sequences 134s which will be aligned by abPOA to generate a consensus sequence 134s -i --incrmnt FILE incrementally align sequences to an existing graph/MSA [Null] 134s graph could be in GFA or MSA format generated by abPOA 134s -o --output FILE output to FILE [stdout] 134s -r --result INT output result mode [0] 134s - 0: consensus in FASTA format 134s - 1: MSA in PIR format 134s - 2: both 0 & 1 134s - 3: graph in GFA format 134s - 4: graph with consensus path in GFA format 134s - 5: consensus in FASTQ format 134s -a --cons-algrm INT consensus algorithm [0] 134s - 0: heaviest bundling path in partial order graph 134s - 1: most frequent bases at each position 134s -d --maxnum-cons INT max. number of consensus sequence to generate [1] 134s -q --min-freq FLOAT min. frequency of each consensus sequence (only effective when -d/--num-cons > 1) [0.25] 134s -g --out-pog FILE dump final alignment graph to FILE (.pdf/.png) [Null] 134s 134s -h --help print this help usage information 134s -v --version show version number 134s -V --verbose INT verbose level (0-2). 0: none, 1: information, 2: debug [0] 134s 134s + test 1 = 1 134s + abpoa.generic ./test_data/seq.fa 134s 1.5.3 134s [main] CMD: abpoa.generic ./test_data/seq.fa 134s [abpoa_main] Real time: 0.002 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 134s + diff - cons.fa 134s + abpoa.generic ./test_data/heter.fa 135s [main] CMD: abpoa.generic ./test_data/heter.fa 135s [abpoa_main] Real time: 0.033 sec; CPU: 0.034 sec; Peak RSS: 0.008 GB. 135s + abpoa.generic -r1 ./test_data/seq.fa 135s [main] CMD: abpoa.generic -r1 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 135s + diff - out.msa 135s + abpoa.generic -r2 ./test_data/seq.fa 135s [main] CMD: abpoa.generic -r2 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.002 sec; Peak RSS: 0.002 GB. 135s + diff - out_cons.msa 135s + abpoa.generic -r3 ./test_data/seq.fa 135s [main] CMD: abpoa.generic -r3 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.002 sec; Peak RSS: 0.002 GB. 135s + diff - out.gfa 135s + abpoa.generic -r4 ./test_data/seq.fa 135s [main] CMD: abpoa.generic -r4 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 135s + diff - out4.gfa 135s + cp out.gfa in.gfa 135s + cp out.msa in.msa 135s + abpoa.generic -i in.gfa ./test_data/seq.fa -r3 135s [main] CMD: abpoa.generic -i in.gfa -r3 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 135s + diff - out.gfa 135s + abpoa.generic -i in.msa ./test_data/seq.fa -r1 135s [main] CMD: abpoa.generic -i in.msa -r1 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 135s + diff - out.msa 135s + abpoa.generic ./test_data/seq.fa -g poa.png 135s [main] CMD: abpoa.generic -g poa.png ./test_data/seq.fa 135s [abpoa_main] Real time: 0.457 sec; CPU: 0.003 sec; Peak RSS: 0.002 GB. 135s + diff - cons.fa 135s + abpoa.generic ./test_data/heter.fa -d2 135s [main] CMD: abpoa.generic -d2 ./test_data/heter.fa 135s >Consensus_sequence_1 0,2,3,4,10,13,14 135s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 135s >Consensus_sequence_2 1,5,6,7,8,9,11,12 135s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCATCCCCACCGCCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 135s [abpoa_main] Real time: 0.033 sec; CPU: 0.034 sec; Peak RSS: 0.009 GB. 135s + for SIMDE in avx2 avx sse4.1 ssse3 sse3 generic dispatch 135s + '[' dispatch = dispatch ']' 135s + BINARY=abpoa 135s + abpoa --version 135s 1.5.3 135s + abpoa --help 135s 135s abpoa: adaptive banded Partial Order Alignment 135s 135s Version: 1.5.3 Contact: yangao@ds.dfci.harvard.edu 135s 135s Usage: abpoa [options] > cons.fa/msa.fa/abpoa.gfa 135s 135s Options: 135s Alignment: 135s -m --aln-mode INT alignment mode [0] 135s 0: global, 1: local, 2: extension 135s -M --match INT match score [2] 135s -X --mismatch INT mismatch penalty [4] 135s -t --matrix FILE scoring matrix file, '-M' and '-X' are not used when '-t' is used [Null] 135s e.g., 'HOXD70.mtx, BLOSUM62.mtx' 135s -O --gap-open INT(,INT) gap opening penalty (O1,O2) [4,24] 135s -E --gap-ext INT(,INT) gap extension penalty (E1,E2) [2,1] 135s abPOA provides three gap penalty modes, cost of a g-long gap: 135s - convex (default): min{O1+g*E1, O2+g*E2} 135s - affine (set O2 as 0): O1+g*E1 135s - linear (set O1 as 0): g*E1 135s -s --amb-strand ambiguous strand mode [False] 135s for each input sequence, try the reverse complement if the current 135s alignment score is too low, and pick the strand with a higher score 135s Adaptive banded DP: 135s -b --extra-b INT first adaptive banding parameter [10] 135s set b as < 0 to disable adaptive banded DP 135s -f --extra-f FLOAT second adaptive banding parameter [0.01] 135s the number of extra bases added on both sites of the band is 135s b+f*L, where L is the length of the aligned sequence 135s Minimizer-based seeding and partition (only effective in global alignment mode): 135s -S --seeding enable minimizer-based seeding and anchoring [False] 135s -k --k-mer INT minimizer k-mer size [19] 135s -w --window INT minimizer window size [10] 135s -n --min-poa-win INT min. size of window to perform POA [500] 135s -p --progressive build guide tree and perform progressive partial order alignment [False] 135s Input/Output: 135s -Q --use-qual-weight take base quality score from FASTQ input file as graph edge weight for consensus calling [False] 135s effective only when input sequences are in FASTQ format and consensus calling with heaviest bundling 135s -c --amino-acid input sequences are amino acid (default is nucleotide) [False] 135s -l --in-list input file is a list of sequence file names [False] 135s each line is one sequence file containing a set of sequences 135s which will be aligned by abPOA to generate a consensus sequence 135s -i --incrmnt FILE incrementally align sequences to an existing graph/MSA [Null] 135s graph could be in GFA or MSA format generated by abPOA 135s -o --output FILE output to FILE [stdout] 135s -r --result INT output result mode [0] 135s - 0: consensus in FASTA format 135s - 1: MSA in PIR format 135s - 2: both 0 & 1 135s - 3: graph in GFA format 135s - 4: graph with consensus path in GFA format 135s - 5: consensus in FASTQ format 135s -a --cons-algrm INT consensus algorithm [0] 135s - 0: heaviest bundling path in partial order graph 135s - 1: most frequent bases at each position 135s -d --maxnum-cons INT max. number of consensus sequence to generate [1] 135s -q --min-freq FLOAT min. frequency of each consensus sequence (only effective when -d/--num-cons > 1) [0.25] 135s -g --out-pog FILE dump final alignment graph to FILE (.pdf/.png) [Null] 135s 135s -h --help print this help usage information 135s -v --version show version number 135s -V --verbose INT verbose level (0-2). 0: none, 1: information, 2: debug [0] 135s 135s + test 1 = 1 135s + abpoa ./test_data/seq.fa 135s [main] CMD: /usr/bin/abpoa.generic ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - cons.fa 135s + abpoa ./test_data/heter.fa 135s [main] CMD: /usr/bin/abpoa.generic ./test_data/heter.fa 135s [abpoa_main] Real time: 0.032 sec; CPU: 0.034 sec; Peak RSS: 0.008 GB. 135s + abpoa -r1 ./test_data/seq.fa 135s [main] CMD: /usr/bin/abpoa.generic -r1 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - out.msa 135s + abpoa -r2 ./test_data/seq.fa 135s [main] CMD: /usr/bin/abpoa.generic -r2 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - out_cons.msa 135s + abpoa -r3 ./test_data/seq.fa 135s [main] CMD: /usr/bin/abpoa.generic -r3 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - out.gfa 135s + abpoa -r4 ./test_data/seq.fa 135s [main] CMD: /usr/bin/abpoa.generic -r4 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - out4.gfa 135s + cp out.gfa in.gfa 135s + cp out.msa in.msa 135s + abpoa -i in.gfa ./test_data/seq.fa -r3 135s [main] CMD: /usr/bin/abpoa.generic -i in.gfa -r3 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.002 sec; CPU: 0.005 sec; Peak RSS: 0.002 GB. 135s + diff - out.gfa 135s + abpoa -i in.msa ./test_data/seq.fa -r1 135s [main] CMD: /usr/bin/abpoa.generic -i in.msa -r1 ./test_data/seq.fa 135s [abpoa_main] Real time: 0.001 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 135s + diff - out.msa 135s + abpoa ./test_data/seq.fa -g poa.png 135s [main] CMD: /usr/bin/abpoa.generic -g poa.png ./test_data/seq.fa 136s [abpoa_main] Real time: 0.474 sec; CPU: 0.004 sec; Peak RSS: 0.002 GB. 136s + diff - cons.fa 136s + abpoa ./test_data/heter.fa -d2 136s [main] CMD: /usr/bin/abpoa.generic -d2 ./test_data/heter.fa 136s >Consensus_sequence_1 0,2,3,4,10,13,14 136s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 136s >Consensus_sequence_2 1,5,6,7,8,9,11,12 136s CCATTCCCACCATCCTTACCATCAACATCACCATCCCCACCATCCCCAACACCATTCCCACCATCCCTACCATCACCATCACCATCCCCACCAACATCCCCACCACCATCCTCACTACCATCCCCACCACCATTTCCACCATTCCCACCACAGTCACCATCACCCCCACCATCCCCATCATCATCCGCACCATCCCCACCATCCCCACCACCATCTCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCCCATTACCATCCCCACCACCATCCCCATTACCATCCCCACCACCATTTCCACCATTCCCACCATCATCCCCACCACCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCATCCCCACCGCCATCCTCGTTACCATCCCCACCACCTTTTCCACCATTCCCACCATCTCCAACACCTCCCCCACCATCATCCCCACCATCCCCACCACCTTCTCCACCATCATTCTCACCATCCCCACCACCATCTCCACCACCATTCTCACCATCTCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCAACATCCCCACCATCCCCACCCCCATGCCCACCATCATCCCCACCATCC 136s [abpoa_main] Real time: 0.032 sec; CPU: 0.035 sec; Peak RSS: 0.009 GB. 136s autopkgtest [08:48:23]: test run-unit-test: -----------------------] 137s run-unit-test PASS 137s autopkgtest [08:48:24]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 137s autopkgtest [08:48:24]: test autodep8-python3: preparing testbed 231s autopkgtest [08:49:58]: testbed dpkg architecture: arm64 232s autopkgtest [08:49:59]: testbed apt version: 2.9.8 232s autopkgtest [08:49:59]: @@@@@@@@@@@@@@@@@@@@ test bed setup 233s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 233s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 233s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 233s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 233s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 233s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 Packages [104 kB] 233s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/restricted arm64 Packages [50.3 kB] 233s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/universe arm64 Packages [601 kB] 233s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse arm64 Packages [17.1 kB] 234s Fetched 1793 kB in 1s (1720 kB/s) 234s Reading package lists... 237s Reading package lists... 237s Building dependency tree... 237s Reading state information... 238s Calculating upgrade... 240s The following NEW packages will be installed: 240s python3.13-gdbm 240s The following packages will be upgraded: 240s libpython3-stdlib python3 python3-gdbm python3-minimal 240s 4 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 240s Need to get 101 kB of archives. 240s After this operation, 141 kB of additional disk space will be used. 240s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-minimal arm64 3.12.7-1 [27.4 kB] 240s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3 arm64 3.12.7-1 [24.0 kB] 240s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 libpython3-stdlib arm64 3.12.7-1 [10.0 kB] 240s Get:4 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13-gdbm arm64 3.13.0-2 [30.7 kB] 240s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-gdbm arm64 3.12.7-1 [8642 B] 241s Fetched 101 kB in 0s (290 kB/s) 241s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 241s Preparing to unpack .../python3-minimal_3.12.7-1_arm64.deb ... 241s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 241s Setting up python3-minimal (3.12.7-1) ... 241s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79924 files and directories currently installed.) 241s Preparing to unpack .../python3_3.12.7-1_arm64.deb ... 242s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 242s Preparing to unpack .../libpython3-stdlib_3.12.7-1_arm64.deb ... 242s Unpacking libpython3-stdlib:arm64 (3.12.7-1) over (3.12.6-0ubuntu1) ... 242s Selecting previously unselected package python3.13-gdbm. 242s Preparing to unpack .../python3.13-gdbm_3.13.0-2_arm64.deb ... 242s Unpacking python3.13-gdbm (3.13.0-2) ... 242s Preparing to unpack .../python3-gdbm_3.12.7-1_arm64.deb ... 242s Unpacking python3-gdbm:arm64 (3.12.7-1) over (3.12.6-1ubuntu1) ... 242s Setting up python3.13-gdbm (3.13.0-2) ... 242s Setting up libpython3-stdlib:arm64 (3.12.7-1) ... 242s Setting up python3 (3.12.7-1) ... 243s Setting up python3-gdbm:arm64 (3.12.7-1) ... 243s Processing triggers for man-db (2.12.1-3) ... 244s Reading package lists... 244s Building dependency tree... 244s Reading state information... 244s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 245s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 245s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 245s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 245s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 246s Reading package lists... 246s Reading package lists... 247s Building dependency tree... 247s Reading state information... 248s Calculating upgrade... 249s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 249s Reading package lists... 249s Building dependency tree... 249s Reading state information... 250s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 254s Reading package lists... 255s Building dependency tree... 255s Reading state information... 255s Starting pkgProblemResolver with broken count: 0 256s Starting 2 pkgProblemResolver with broken count: 0 256s Done 256s The following additional packages will be installed: 256s libpython3.13-minimal libpython3.13-stdlib python3-all python3-pyabpoa 256s python3.13 python3.13-minimal 256s Suggested packages: 256s python3.13-venv python3.13-doc binfmt-support 256s The following NEW packages will be installed: 256s autopkgtest-satdep libpython3.13-minimal libpython3.13-stdlib python3-all 256s python3-pyabpoa python3.13 python3.13-minimal 256s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 256s Need to get 5941 kB/5942 kB of archives. 256s After this operation, 24.5 MB of additional disk space will be used. 256s Get:1 /tmp/autopkgtest.Ss1o9C/2-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [712 B] 257s Get:2 http://ftpmaster.internal/ubuntu plucky/main arm64 libpython3.13-minimal arm64 3.13.0-2 [877 kB] 257s Get:3 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13-minimal arm64 3.13.0-2 [2100 kB] 257s Get:4 http://ftpmaster.internal/ubuntu plucky/main arm64 libpython3.13-stdlib arm64 3.13.0-2 [2073 kB] 257s Get:5 http://ftpmaster.internal/ubuntu plucky/main arm64 python3.13 arm64 3.13.0-2 [719 kB] 257s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main arm64 python3-all arm64 3.12.7-1 [890 B] 257s Get:7 http://ftpmaster.internal/ubuntu plucky/universe arm64 python3-pyabpoa arm64 1.5.3-1 [171 kB] 258s Fetched 5941 kB in 1s (6504 kB/s) 258s Selecting previously unselected package libpython3.13-minimal:arm64. 258s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 79931 files and directories currently installed.) 258s Preparing to unpack .../0-libpython3.13-minimal_3.13.0-2_arm64.deb ... 258s Unpacking libpython3.13-minimal:arm64 (3.13.0-2) ... 258s Selecting previously unselected package python3.13-minimal. 258s Preparing to unpack .../1-python3.13-minimal_3.13.0-2_arm64.deb ... 258s Unpacking python3.13-minimal (3.13.0-2) ... 258s Selecting previously unselected package libpython3.13-stdlib:arm64. 258s Preparing to unpack .../2-libpython3.13-stdlib_3.13.0-2_arm64.deb ... 258s Unpacking libpython3.13-stdlib:arm64 (3.13.0-2) ... 258s Selecting previously unselected package python3.13. 258s Preparing to unpack .../3-python3.13_3.13.0-2_arm64.deb ... 258s Unpacking python3.13 (3.13.0-2) ... 258s Selecting previously unselected package python3-all. 258s Preparing to unpack .../4-python3-all_3.12.7-1_arm64.deb ... 258s Unpacking python3-all (3.12.7-1) ... 258s Selecting previously unselected package python3-pyabpoa. 258s Preparing to unpack .../5-python3-pyabpoa_1.5.3-1_arm64.deb ... 258s Unpacking python3-pyabpoa (1.5.3-1) ... 258s Selecting previously unselected package autopkgtest-satdep. 258s Preparing to unpack .../6-2-autopkgtest-satdep.deb ... 258s Unpacking autopkgtest-satdep (0) ... 258s Setting up python3-pyabpoa (1.5.3-1) ... 258s Setting up libpython3.13-minimal:arm64 (3.13.0-2) ... 258s Setting up python3.13-minimal (3.13.0-2) ... 259s Setting up libpython3.13-stdlib:arm64 (3.13.0-2) ... 259s Setting up python3.13 (3.13.0-2) ... 260s Setting up python3-all (3.12.7-1) ... 260s Setting up autopkgtest-satdep (0) ... 260s Processing triggers for man-db (2.12.1-3) ... 261s Processing triggers for systemd (256.5-2ubuntu4) ... 264s (Reading database ... 80674 files and directories currently installed.) 264s Removing autopkgtest-satdep (0) ... 265s autopkgtest [08:50:32]: test autodep8-python3: set -e ; for py in $(py3versions -r 2>/dev/null) ; do cd "$AUTOPKGTEST_TMP" ; echo "Testing with $py:" ; $py -c "import pyabpoa; print(pyabpoa)" ; done 265s autopkgtest [08:50:32]: test autodep8-python3: [----------------------- 266s Testing with python3.13: 266s Traceback (most recent call last): 266s File "", line 1, in 266s import pyabpoa; print(pyabpoa) 266s ^^^^^^^^^^^^^^ 266s ModuleNotFoundError: No module named 'pyabpoa' 266s autopkgtest [08:50:33]: test autodep8-python3: -----------------------] 267s autopkgtest [08:50:34]: test autodep8-python3: - - - - - - - - - - results - - - - - - - - - - 267s autodep8-python3 FAIL non-zero exit status 1 267s autopkgtest [08:50:34]: @@@@@@@@@@@@@@@@@@@@ summary 267s run-unit-test PASS 267s autodep8-python3 FAIL non-zero exit status 1 287s virt: nova [W] Skipping flock in bos03-arm64 287s virt: Creating nova instance adt-plucky-arm64-abpoa-20241113-084607-juju-7f2275-prod-proposed-migration-environment-2-3aec0a0f-843b-43af-8311-17453f57ae12 from image adt/ubuntu-plucky-arm64-server-20241113.img (UUID 2d7760e6-2439-4200-89d6-5ed33e5c6330)... 287s virt: nova [W] Skipping flock in bos03-arm64 287s virt: Creating nova instance adt-plucky-arm64-abpoa-20241113-084607-juju-7f2275-prod-proposed-migration-environment-2-3aec0a0f-843b-43af-8311-17453f57ae12 from image adt/ubuntu-plucky-arm64-server-20241113.img (UUID 2d7760e6-2439-4200-89d6-5ed33e5c6330)...