0s autopkgtest [20:14:13]: starting date and time: 2024-11-29 20:14:13+0000 0s autopkgtest [20:14:13]: git checkout: be626eda Fix armhf LXD image generation for plucky 0s autopkgtest [20:14:13]: host juju-7f2275-prod-proposed-migration-environment-15; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.vhuxdb_0/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.4.0-1ubuntu1 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor builder-cpu2-ram4-disk20 --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-15@bos03-2.secgroup --name adt-plucky-amd64-seqkit-20241129-201413-juju-7f2275-prod-proposed-migration-environment-15-228e67c2-31f2-42a1-81b6-c8653f19f363 --image adt/ubuntu-plucky-amd64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-15 --net-id=net_prod-proposed-migration-amd64 -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 49s autopkgtest [20:15:02]: testbed dpkg architecture: amd64 49s autopkgtest [20:15:02]: testbed apt version: 2.9.14ubuntu1 49s autopkgtest [20:15:02]: @@@@@@@@@@@@@@@@@@@@ test bed setup 49s autopkgtest [20:15:02]: testbed release detected to be: None 50s autopkgtest [20:15:03]: updating testbed package index (apt update) 50s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 51s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 51s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 51s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 51s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [9708 B] 51s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [62.8 kB] 51s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [14.4 kB] 51s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [837 kB] 51s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/main i386 Packages [82.1 kB] 51s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 Packages [124 kB] 51s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/restricted i386 Packages [2572 B] 51s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/restricted amd64 Packages [40.6 kB] 51s Get:13 http://ftpmaster.internal/ubuntu plucky-proposed/universe i386 Packages [275 kB] 51s Get:14 http://ftpmaster.internal/ubuntu plucky-proposed/universe amd64 Packages [710 kB] 51s Get:15 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse i386 Packages [6036 B] 51s Get:16 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse amd64 Packages [20.8 kB] 51s Fetched 2259 kB in 1s (2541 kB/s) 52s Reading package lists... 53s Reading package lists... 53s Building dependency tree... 53s Reading state information... 53s Calculating upgrade... 53s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 53s Reading package lists... 54s Building dependency tree... 54s Reading state information... 54s 0 upgraded, 0 newly installed, 0 to remove and 2 not upgraded. 54s autopkgtest [20:15:07]: upgrading testbed (apt dist-upgrade and autopurge) 54s Reading package lists... 54s Building dependency tree... 54s Reading state information... 55s Calculating upgrade...Starting pkgProblemResolver with broken count: 0 55s Starting 2 pkgProblemResolver with broken count: 0 55s Done 55s Entering ResolveByKeep 56s 56s The following NEW packages will be installed: 56s openssl-provider-legacy 56s The following packages will be upgraded: 56s libssl3t64 openssl 56s 2 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 56s Need to get 3557 kB of archives. 56s After this operation, 936 kB of additional disk space will be used. 56s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 openssl-provider-legacy amd64 3.4.0-1ubuntu1 [39.0 kB] 56s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 libssl3t64 amd64 3.4.0-1ubuntu1 [2332 kB] 56s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 openssl amd64 3.4.0-1ubuntu1 [1186 kB] 57s Fetched 3557 kB in 1s (5357 kB/s) 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75952 files and directories currently installed.) 57s Preparing to unpack .../libssl3t64_3.4.0-1ubuntu1_amd64.deb ... 57s Unpacking libssl3t64:amd64 (3.4.0-1ubuntu1) over (3.3.1-2ubuntu2) ... 57s Selecting previously unselected package openssl-provider-legacy. 57s Preparing to unpack .../openssl-provider-legacy_3.4.0-1ubuntu1_amd64.deb ... 57s Unpacking openssl-provider-legacy (3.4.0-1ubuntu1) ... 57s Setting up libssl3t64:amd64 (3.4.0-1ubuntu1) ... 57s Setting up openssl-provider-legacy (3.4.0-1ubuntu1) ... 57s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75955 files and directories currently installed.) 57s Preparing to unpack .../openssl_3.4.0-1ubuntu1_amd64.deb ... 57s Unpacking openssl (3.4.0-1ubuntu1) over (3.3.1-2ubuntu2) ... 57s Setting up openssl (3.4.0-1ubuntu1) ... 57s Installing new version of config file /etc/ssl/openssl.cnf ... 57s Processing triggers for man-db (2.13.0-1) ... 58s Processing triggers for libc-bin (2.40-1ubuntu3) ... 58s Reading package lists... 59s Building dependency tree... 59s Reading state information... 59s Starting pkgProblemResolver with broken count: 0 59s Starting 2 pkgProblemResolver with broken count: 0 59s Done 60s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 62s autopkgtest [20:15:15]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP PREEMPT_DYNAMIC Mon Sep 16 13:41:20 UTC 2024 62s autopkgtest [20:15:15]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 65s Get:1 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (dsc) [3274 B] 65s Get:2 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (tar) [16.6 MB] 65s Get:3 http://ftpmaster.internal/ubuntu plucky/universe seqkit 2.8.2+ds-1 (diff) [10.8 MB] 66s gpgv: Signature made Sun Jun 30 04:14:25 2024 UTC 66s gpgv: using RSA key 4A5FD1CD115087CC03DC35C1D597897206C5F07F 66s gpgv: issuer "maytha8thedev@gmail.com" 66s gpgv: Can't check signature: No public key 66s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.8.2+ds-1.dsc: no acceptable signature found 67s autopkgtest [20:15:20]: testing package seqkit version 2.8.2+ds-1 68s autopkgtest [20:15:21]: build not needed 71s autopkgtest [20:15:24]: test run-unit-test: preparing testbed 71s Reading package lists... 72s Building dependency tree... 72s Reading state information... 72s Starting pkgProblemResolver with broken count: 0 72s Starting 2 pkgProblemResolver with broken count: 0 72s Done 72s The following NEW packages will be installed: 72s seqkit seqkit-examples ssshtest 72s 0 upgraded, 3 newly installed, 0 to remove and 0 not upgraded. 72s Need to get 46.9 MB of archives. 72s After this operation, 57.4 MB of additional disk space will be used. 72s Get:1 http://ftpmaster.internal/ubuntu plucky/universe amd64 seqkit amd64 2.8.2+ds-1 [7297 kB] 73s Get:2 http://ftpmaster.internal/ubuntu plucky/universe amd64 seqkit-examples all 2.8.2+ds-1 [39.6 MB] 74s Get:3 http://ftpmaster.internal/ubuntu plucky/universe amd64 ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 75s Fetched 46.9 MB in 2s (21.0 MB/s) 75s Selecting previously unselected package seqkit. 75s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75957 files and directories currently installed.) 75s Preparing to unpack .../seqkit_2.8.2+ds-1_amd64.deb ... 75s Unpacking seqkit (2.8.2+ds-1) ... 75s Selecting previously unselected package seqkit-examples. 75s Preparing to unpack .../seqkit-examples_2.8.2+ds-1_all.deb ... 75s Unpacking seqkit-examples (2.8.2+ds-1) ... 75s Selecting previously unselected package ssshtest. 75s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 75s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 75s Setting up seqkit (2.8.2+ds-1) ... 75s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 75s Setting up seqkit-examples (2.8.2+ds-1) ... 75s Processing triggers for man-db (2.13.0-1) ... 77s autopkgtest [20:15:30]: test run-unit-test: [----------------------- 77s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 78s 78s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 78s PASS "28645" == "28645" (LINE 28) 78s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 78s 78s seq_type ran in 0 sec with 2/92423 lines to STDERR/OUT 78s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 78s 78s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 78s PASS STDOUT CONTAINS "Protein" (LINE 42) 78s 78s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 78s PASS STDOUT CONTAINS "RNA" (LINE 48) 78s 78s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 78s PASS STDOUT CONTAINS "DNA" (LINE 54) 78s 78s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 78s PASS STDOUT CONTAINS "DNA" (LINE 60) 78s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 78s 78s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 78s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 78s 78s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 78s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 79s 79s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 79s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 79s 79s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 79s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 79s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 79s 79s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 79s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 79s 79s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 79s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 79s 79s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 79s PASS "a" == "a" (LINE 117) 80s 80s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 80s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 80s 80s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 80s PASS "gtn" == "gtn" (LINE 129) 80s 80s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 80s PASS "ACG" == "ACG" (LINE 135) 80s 80s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 80s PASS "N" == "N" (LINE 141) 80s 80s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 80s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 80s 80s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 80s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 80s 80s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 80s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 80s 80s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 80s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 80s 80s sliding ran in 1 sec with 0/2 lines to STDERR/OUT 80s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 80s 80s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 81s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 81s 81s fq2fa ran in 1 sec with 1/0 lines to STDERR/OUT 81s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 81s [ERRO] xopen: no content 81s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 81s 81s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 81s Length correlation: 81s PASS "1" == "1" (LINE 220) 81s Length correlation: 81s PASS "1" == "1" (LINE 224) 81s Qual correlation: 81s PASS "1" == "1" (LINE 228) 82s 82s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 82s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 82s 82s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 82s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 83s 83s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT 83s PASS "100" == "100" (LINE 249) 83s 83s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 83s PASS "3074" == "3074" (LINE 254) 83s 83s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 83s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 83s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 83s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 83s 83s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 83s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 83s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 83s [INFO] 0 duplicated records removed 83s [INFO] sample by proportion 83s [INFO] 2814 sequences outputted 83s 83s common ran in 0 sec with 5/0 lines to STDERR/OUT 83s PASS "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" == "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" (LINE 299) 83s 83s split ran in 0 sec with 104/0 lines to STDERR/OUT 83s [INFO] 0 duplicated records removed 83s PASS "100" == "100" (LINE 316) 83s [INFO] 0 duplicated records removed 83s PASS "bb44753ad4db4d3ea8db3b1eb7fd9d20ee71a245000781a37bdf6a9951bc538d" == "bb44753ad4db4d3ea8db3b1eb7fd9d20ee71a245000781a37bdf6a9951bc538d" (LINE 317) 84s [INFO] sample by proportion 84s [INFO] 2814 sequences outputted 84s [INFO] sample by proportion 84s [INFO] 2814 sequences outputted 84s PASS "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" == "2a0c98e68250d02e7109c4339e0b7863db266d3d41bd137719aabc26333f7c2a" (LINE 324) 84s 84s head ran in 0 sec with 0/30 lines to STDERR/OUT 84s PASS "10" == "10" (LINE 332) 84s PASS "snq" == "snq" (LINE 341) 84s PASS "seq_2" == "seq_2" (LINE 350) 84s 84s restart ran in 0 sec with 0/2 lines to STDERR/OUT 84s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 84s 84s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 84s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 85s 85s shuffle ran in 1 sec with 20/0 lines to STDERR/OUT 85s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 389) 85s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 85s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 393) 85s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 394) 85s PASS "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" == "14572cc12b1cf07fcd5c8a732405e046134a19eea921fe4393294b8ae523502a" (LINE 395) 85s 85s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 85s Correlation: 85s PASS "1" == "1" (LINE 422) 85s 85s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT 85s Correlation: 85s PASS "1" == "1" (LINE 432) 86s 86s bam_map_qual ran in 1 sec with 0/0 lines to STDERR/OUT 86s Correlation: 86s PASS "1" == "1" (LINE 442) 86s 86s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 86s Correlation: 86s PASS "1" == "1" (LINE 452) 86s 86s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 86s Correlation: 86s PASS "1" == "1" (LINE 462) 86s 86s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 86s Correlation: 86s PASS "1" == "1" (LINE 475) 86s 86s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 86s Correlation: 86s PASS "1" == "1" (LINE 488) 86s 86s bam_bundler ran in 0 sec with 13/9 lines to STDERR/OUT 86s PASS "0" == "0" (LINE 498) 87s 87s bam_fish_regression ran in 1 sec with 0/0 lines to STDERR/OUT 87s PASS EXIT CODE (LINE 516) 87s 87s sana_fastq_sep_id ran in 0 sec with 9/0 lines to STDERR/OUT 87s PASS "0" == "0" (LINE 529) 87s 87s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 87s PASS "0" == "0" (LINE 539) 87s 87s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 87s PASS "0" == "0" (LINE 550) 87s 87s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 87s PASS "0" == "0" (LINE 558) 87s 87s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 87s PASS "0" == "0" (LINE 566) 90s 90s scat_fasta ran in 3 sec with 261/0 lines to STDERR/OUT 90s PASS "0" == "0" (LINE 615) 90s PASS "0" == "0" (LINE 617) 92s 92s scat_fastq ran in 2 sec with 531/0 lines to STDERR/OUT 92s PASS "0" == "0" (LINE 661) 92s PASS "0" == "0" (LINE 663) 92s [INFO] sample by number 92s [INFO] loading all sequences into memory... 92s [INFO] 9 sequences outputted 92s 92s faidx_id ran in 0 sec with 3/0 lines to STDERR/OUT 92s [INFO] read sequences ... 92s [INFO] 9 patterns loaded from file 92s [INFO] 9 sequences loaded 92s [INFO] sorting ... 92s [INFO] output ... 92s [INFO] read sequences ... 92s [INFO] 9 sequences loaded 92s [INFO] sorting ... 92s [INFO] output ... 92s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 679) 92s 92s faidx_full_head ran in 0 sec with 3/0 lines to STDERR/OUT 93s [INFO] read sequences ... 93s [INFO] 9 patterns loaded from file 93s [INFO] 9 sequences loaded 93s [INFO] sorting ... 93s [INFO] output ... 93s [INFO] read sequences ... 93s [INFO] 9 sequences loaded 93s [INFO] sorting ... 93s [INFO] output ... 93s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 686) 93s 93s faidx_region ran in 0 sec with 3/0 lines to STDERR/OUT 93s PASS "GACAGGAGAAGGGGGUGAGAGACUCCCUCCUGAACUCUCAGCCUUUAUCUCC" == "GACAGGAGAAGGGGGUGAGAGACUCCCUCCUGAACUCUCAGCCUUUAUCUCC" (LINE 695) 93s 93s sshtest v0.1.5 93s 93s 72 Tests 93s 0 Failures 93s 72 Successes 93s autopkgtest [20:15:46]: test run-unit-test: -----------------------] 94s autopkgtest [20:15:47]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 94s run-unit-test PASS 94s autopkgtest [20:15:47]: @@@@@@@@@@@@@@@@@@@@ summary 94s run-unit-test PASS 106s nova [W] Skipping flock for amd64 106s Creating nova instance adt-plucky-amd64-seqkit-20241129-201413-juju-7f2275-prod-proposed-migration-environment-15-228e67c2-31f2-42a1-81b6-c8653f19f363 from image adt/ubuntu-plucky-amd64-server-20241129.img (UUID c95ff410-802a-49bb-8eba-55253ddf6f2e)...