0s autopkgtest [10:06:34]: starting date and time: 2024-11-13 10:06:34+0000 1s autopkgtest [10:06:35]: git checkout: 0acbae0a WIP show VirtSubproc stderr in real-time 1s autopkgtest [10:06:35]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.a3m1hqru/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:python3-defaults,src:python3-stdlib-extensions --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=python3-defaults/3.12.7-1 python3-stdlib-extensions/3.12.7-1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@lcy02-10.secgroup --name adt-plucky-amd64-presto-20241113-092229-juju-7f2275-prod-proposed-migration-environment-2-9d427c20-d0f6-460a-a33a-b7c55a5b2208 --image adt/ubuntu-plucky-amd64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,keyserver.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 330s autopkgtest [10:12:04]: testbed dpkg architecture: amd64 330s autopkgtest [10:12:04]: testbed apt version: 2.9.8 330s autopkgtest [10:12:04]: @@@@@@@@@@@@@@@@@@@@ test bed setup 331s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease [73.9 kB] 331s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/universe Sources [849 kB] 331s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main Sources [76.4 kB] 331s Get:4 http://ftpmaster.internal/ubuntu plucky-proposed/restricted Sources [7016 B] 331s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse Sources [15.3 kB] 331s Get:6 http://ftpmaster.internal/ubuntu plucky-proposed/main i386 Packages [65.2 kB] 331s Get:7 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 Packages [111 kB] 331s Get:8 http://ftpmaster.internal/ubuntu plucky-proposed/restricted amd64 Packages [32.6 kB] 331s Get:9 http://ftpmaster.internal/ubuntu plucky-proposed/universe amd64 Packages [639 kB] 331s Get:10 http://ftpmaster.internal/ubuntu plucky-proposed/universe i386 Packages [255 kB] 331s Get:11 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse amd64 Packages [37.7 kB] 331s Get:12 http://ftpmaster.internal/ubuntu plucky-proposed/multiverse i386 Packages [13.0 kB] 331s Fetched 2175 kB in 0s (7261 kB/s) 331s Reading package lists... 333s Reading package lists... 333s Building dependency tree... 333s Reading state information... 334s Calculating upgrade... 334s The following NEW packages will be installed: 334s python3.13-gdbm 334s The following packages will be upgraded: 334s libgpgme11t64 libpython3-stdlib python3 python3-gdbm python3-minimal 334s 5 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 334s Need to get 253 kB of archives. 334s After this operation, 147 kB of additional disk space will be used. 334s Get:1 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 python3-minimal amd64 3.12.7-1 [27.4 kB] 334s Get:2 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 python3 amd64 3.12.7-1 [24.0 kB] 334s Get:3 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 libpython3-stdlib amd64 3.12.7-1 [10.0 kB] 334s Get:4 http://ftpmaster.internal/ubuntu plucky/main amd64 python3.13-gdbm amd64 3.13.0-2 [31.3 kB] 334s Get:5 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 python3-gdbm amd64 3.12.7-1 [8642 B] 334s Get:6 http://ftpmaster.internal/ubuntu plucky/main amd64 libgpgme11t64 amd64 1.23.2-5ubuntu4 [152 kB] 335s Fetched 253 kB in 0s (9095 kB/s) 335s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75541 files and directories currently installed.) 335s Preparing to unpack .../python3-minimal_3.12.7-1_amd64.deb ... 335s Unpacking python3-minimal (3.12.7-1) over (3.12.6-0ubuntu1) ... 335s Setting up python3-minimal (3.12.7-1) ... 335s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75541 files and directories currently installed.) 335s Preparing to unpack .../python3_3.12.7-1_amd64.deb ... 335s Unpacking python3 (3.12.7-1) over (3.12.6-0ubuntu1) ... 335s Preparing to unpack .../libpython3-stdlib_3.12.7-1_amd64.deb ... 335s Unpacking libpython3-stdlib:amd64 (3.12.7-1) over (3.12.6-0ubuntu1) ... 335s Selecting previously unselected package python3.13-gdbm. 335s Preparing to unpack .../python3.13-gdbm_3.13.0-2_amd64.deb ... 335s Unpacking python3.13-gdbm (3.13.0-2) ... 335s Preparing to unpack .../python3-gdbm_3.12.7-1_amd64.deb ... 335s Unpacking python3-gdbm:amd64 (3.12.7-1) over (3.12.6-1ubuntu1) ... 335s Preparing to unpack .../libgpgme11t64_1.23.2-5ubuntu4_amd64.deb ... 335s Unpacking libgpgme11t64:amd64 (1.23.2-5ubuntu4) over (1.18.0-4.1ubuntu4) ... 335s Setting up libgpgme11t64:amd64 (1.23.2-5ubuntu4) ... 335s Setting up python3.13-gdbm (3.13.0-2) ... 335s Setting up libpython3-stdlib:amd64 (3.12.7-1) ... 335s Setting up python3 (3.12.7-1) ... 336s Setting up python3-gdbm:amd64 (3.12.7-1) ... 336s Processing triggers for man-db (2.12.1-3) ... 336s Processing triggers for libc-bin (2.40-1ubuntu3) ... 337s Reading package lists... 337s Building dependency tree... 337s Reading state information... 337s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 338s Hit:1 http://ftpmaster.internal/ubuntu plucky-proposed InRelease 338s Hit:2 http://ftpmaster.internal/ubuntu plucky InRelease 338s Hit:3 http://ftpmaster.internal/ubuntu plucky-updates InRelease 338s Hit:4 http://ftpmaster.internal/ubuntu plucky-security InRelease 339s Reading package lists... 339s Reading package lists... 339s Building dependency tree... 339s Reading state information... 340s Calculating upgrade... 340s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 340s Reading package lists... 340s Building dependency tree... 340s Reading state information... 341s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 342s autopkgtest [10:12:16]: testbed running kernel: Linux 6.11.0-8-generic #8-Ubuntu SMP PREEMPT_DYNAMIC Mon Sep 16 13:41:20 UTC 2024 342s autopkgtest [10:12:16]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 343s Get:1 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (dsc) [2233 B] 343s Get:2 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (tar) [362 kB] 343s Get:3 http://ftpmaster.internal/ubuntu plucky/universe presto 0.7.2-1 (diff) [20.8 kB] 344s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC 344s gpgv: using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7 344s gpgv: Can't check signature: No public key 344s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found 344s autopkgtest [10:12:18]: testing package presto version 0.7.2-1 345s autopkgtest [10:12:19]: build not needed 346s autopkgtest [10:12:20]: test pybuild-autopkgtest: preparing testbed 347s Reading package lists... 347s Building dependency tree... 347s Reading state information... 348s Starting pkgProblemResolver with broken count: 0 348s Starting 2 pkgProblemResolver with broken count: 0 348s Done 348s The following additional packages will be installed: 348s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-14 348s cpp-14-x86-64-linux-gnu cpp-x86-64-linux-gnu debhelper debugedit 348s dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config 348s fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ g++-14 348s g++-14-x86-64-linux-gnu g++-x86-64-linux-gnu gcc gcc-14 348s gcc-14-x86-64-linux-gnu gcc-x86-64-linux-gnu gettext intltool-debian 348s libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 libdebhelper-perl 348s libdeflate0 libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 348s libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b libhwasan0 348s libimagequant0 libisl23 libitm1 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 348s liblbfgsb0 liblcms2-2 liblerc4 liblsan0 libmbedcrypto7t64 libmbedtls14t64 348s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal 348s libpython3.13-stdlib libquadmath0 libraqm0 libsharpyuv0 libstdc++-14-dev 348s libtiff6 libtool libtsan2 libubsan1 libwebp7 libwebpdemux2 libwebpmux3 348s libxcb-render0 libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data po-debconf 348s presto pybuild-plugin-autopkgtest python3-all python3-biopython 348s python3-cairo python3-dateutil python3-decorator python3-freetype 348s python3-numpy python3-packaging python3-pandas python3-pandas-lib 348s python3-pil python3-presto python3-reportlab python3-rlpycairo python3-scipy 348s python3-six python3-tz python3.13 python3.13-minimal sgml-base vsearch 348s w3c-sgml-lib x11-common xfonts-encodings xfonts-utils xml-core 348s Suggested packages: 348s autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-14-locales 348s cpp-14-doc dh-make flit python3-build python3-installer python3-wheel 348s fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre g++-multilib 348s g++-14-multilib gcc-14-doc gcc-multilib manpages-dev flex bison gdb gcc-doc 348s gcc-14-multilib gdb-x86-64-linux-gnu gettext-doc libasprintf-dev 348s libgettextpo-dev liblcms2-utils libstdc++-14-doc libtool-doc gfortran 348s | fortran95-compiler gcj-jdk m4-doc libmail-box-perl python3-tk bwa clustalo 348s clustalw dialign dssp emboss fasttree mafft muscle3 phylip phyml prank 348s probcons python3-mysqldb python3-matplotlib python3-mmtf python3-rdflib 348s python3-psycopg2 raxml samtools t-coffee wise gfortran python-numpy-doc 348s python3-dev python3-pytest python-pandas-doc python3-statsmodels 348s python-pil-doc pdf-viewer python3-egenix-mxtexttools python-reportlab-doc 348s rl-accel rl-renderpm python-scipy-doc python3.13-venv python3.13-doc 348s binfmt-support sgml-base-doc 348s Recommended packages: 348s libarchive-cpio-perl libltdl-dev libmail-sendmail-perl python-biopython-doc 348s python3-matplotlib python3-bottleneck python3-numexpr python3-odf 348s python3-openpyxl python3-bs4 python3-html5lib python3-lxml python3-tables 348s python3-numba python3-olefile fonts-dejavu-extra 348s The following NEW packages will be installed: 348s autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential 348s cd-hit cpp cpp-14 cpp-14-x86-64-linux-gnu cpp-x86-64-linux-gnu debhelper 348s debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz 348s fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ 348s g++-14 g++-14-x86-64-linux-gnu g++-x86-64-linux-gnu gcc gcc-14 348s gcc-14-x86-64-linux-gnu gcc-x86-64-linux-gnu gettext intltool-debian 348s libarchive-zip-perl libasan8 libblas3 libcairo2 libcc1-0 libdebhelper-perl 348s libdeflate0 libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 348s libgcc-14-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b libhwasan0 348s libimagequant0 libisl23 libitm1 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 348s liblbfgsb0 liblcms2-2 liblerc4 liblsan0 libmbedcrypto7t64 libmbedtls14t64 348s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libpython3.13-minimal 348s libpython3.13-stdlib libquadmath0 libraqm0 libsharpyuv0 libstdc++-14-dev 348s libtiff6 libtool libtsan2 libubsan1 libwebp7 libwebpdemux2 libwebpmux3 348s libxcb-render0 libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data po-debconf 348s presto pybuild-plugin-autopkgtest python3-all python3-biopython 348s python3-cairo python3-dateutil python3-decorator python3-freetype 348s python3-numpy python3-packaging python3-pandas python3-pandas-lib 348s python3-pil python3-presto python3-reportlab python3-rlpycairo python3-scipy 348s python3-six python3-tz python3.13 python3.13-minimal sgml-base vsearch 348s w3c-sgml-lib x11-common xfonts-encodings xfonts-utils xml-core 348s 0 upgraded, 112 newly installed, 0 to remove and 0 not upgraded. 348s Need to get 152 MB/152 MB of archives. 348s After this operation, 559 MB of additional disk space will be used. 348s Get:1 /tmp/autopkgtest.Ym1phs/1-autopkgtest-satdep.deb autopkgtest-satdep amd64 0 [820 B] 348s Get:2 http://ftpmaster.internal/ubuntu plucky/main amd64 libpython3.13-minimal amd64 3.13.0-2 [879 kB] 348s Get:3 http://ftpmaster.internal/ubuntu plucky/main amd64 python3.13-minimal amd64 3.13.0-2 [2188 kB] 349s Get:4 http://ftpmaster.internal/ubuntu plucky/main amd64 sgml-base all 1.31 [11.4 kB] 349s Get:5 http://ftpmaster.internal/ubuntu plucky/main amd64 m4 amd64 1.4.19-4build1 [244 kB] 349s Get:6 http://ftpmaster.internal/ubuntu plucky/main amd64 autoconf all 2.72-3 [382 kB] 349s Get:7 http://ftpmaster.internal/ubuntu plucky/main amd64 autotools-dev all 20220109.1 [44.9 kB] 349s Get:8 http://ftpmaster.internal/ubuntu plucky/main amd64 automake all 1:1.16.5-1.3ubuntu1 [558 kB] 349s Get:9 http://ftpmaster.internal/ubuntu plucky/main amd64 autopoint all 0.22.5-2 [616 kB] 349s Get:10 http://ftpmaster.internal/ubuntu plucky/main amd64 libisl23 amd64 0.27-1 [685 kB] 349s Get:11 http://ftpmaster.internal/ubuntu plucky/main amd64 libmpc3 amd64 1.3.1-1build2 [55.3 kB] 349s Get:12 http://ftpmaster.internal/ubuntu plucky/main amd64 cpp-14-x86-64-linux-gnu amd64 14.2.0-8ubuntu1 [11.9 MB] 349s Get:13 http://ftpmaster.internal/ubuntu plucky/main amd64 cpp-14 amd64 14.2.0-8ubuntu1 [1030 B] 349s Get:14 http://ftpmaster.internal/ubuntu plucky/main amd64 cpp-x86-64-linux-gnu amd64 4:14.1.0-2ubuntu1 [5452 B] 349s Get:15 http://ftpmaster.internal/ubuntu plucky/main amd64 cpp amd64 4:14.1.0-2ubuntu1 [22.4 kB] 349s Get:16 http://ftpmaster.internal/ubuntu plucky/main amd64 libcc1-0 amd64 14.2.0-8ubuntu1 [47.6 kB] 349s Get:17 http://ftpmaster.internal/ubuntu plucky/main amd64 libgomp1 amd64 14.2.0-8ubuntu1 [148 kB] 349s Get:18 http://ftpmaster.internal/ubuntu plucky/main amd64 libitm1 amd64 14.2.0-8ubuntu1 [29.1 kB] 349s Get:19 http://ftpmaster.internal/ubuntu plucky/main amd64 libasan8 amd64 14.2.0-8ubuntu1 [2998 kB] 349s Get:20 http://ftpmaster.internal/ubuntu plucky/main amd64 liblsan0 amd64 14.2.0-8ubuntu1 [1317 kB] 349s Get:21 http://ftpmaster.internal/ubuntu plucky/main amd64 libtsan2 amd64 14.2.0-8ubuntu1 [2732 kB] 349s Get:22 http://ftpmaster.internal/ubuntu plucky/main amd64 libubsan1 amd64 14.2.0-8ubuntu1 [1177 kB] 349s Get:23 http://ftpmaster.internal/ubuntu plucky/main amd64 libhwasan0 amd64 14.2.0-8ubuntu1 [1634 kB] 349s Get:24 http://ftpmaster.internal/ubuntu plucky/main amd64 libquadmath0 amd64 14.2.0-8ubuntu1 [153 kB] 349s Get:25 http://ftpmaster.internal/ubuntu plucky/main amd64 libgcc-14-dev amd64 14.2.0-8ubuntu1 [2814 kB] 349s Get:26 http://ftpmaster.internal/ubuntu plucky/main amd64 gcc-14-x86-64-linux-gnu amd64 14.2.0-8ubuntu1 [23.3 MB] 349s Get:27 http://ftpmaster.internal/ubuntu plucky/main amd64 gcc-14 amd64 14.2.0-8ubuntu1 [528 kB] 349s Get:28 http://ftpmaster.internal/ubuntu plucky/main amd64 gcc-x86-64-linux-gnu amd64 4:14.1.0-2ubuntu1 [1214 B] 349s Get:29 http://ftpmaster.internal/ubuntu plucky/main amd64 gcc amd64 4:14.1.0-2ubuntu1 [5000 B] 349s Get:30 http://ftpmaster.internal/ubuntu plucky/main amd64 libstdc++-14-dev amd64 14.2.0-8ubuntu1 [2504 kB] 349s Get:31 http://ftpmaster.internal/ubuntu plucky/main amd64 g++-14-x86-64-linux-gnu amd64 14.2.0-8ubuntu1 [13.3 MB] 349s Get:32 http://ftpmaster.internal/ubuntu plucky/main amd64 g++-14 amd64 14.2.0-8ubuntu1 [19.9 kB] 349s Get:33 http://ftpmaster.internal/ubuntu plucky/main amd64 g++-x86-64-linux-gnu amd64 4:14.1.0-2ubuntu1 [966 B] 349s Get:34 http://ftpmaster.internal/ubuntu plucky/main amd64 g++ amd64 4:14.1.0-2ubuntu1 [1100 B] 349s Get:35 http://ftpmaster.internal/ubuntu plucky/main amd64 build-essential amd64 12.10ubuntu1 [4928 B] 349s Get:36 http://ftpmaster.internal/ubuntu plucky/universe amd64 cd-hit amd64 4.8.1-4 [521 kB] 349s Get:37 http://ftpmaster.internal/ubuntu plucky/main amd64 libdebhelper-perl all 13.20ubuntu1 [94.2 kB] 349s Get:38 http://ftpmaster.internal/ubuntu plucky/main amd64 libtool all 2.4.7-7build1 [166 kB] 349s Get:39 http://ftpmaster.internal/ubuntu plucky/main amd64 dh-autoreconf all 20 [16.1 kB] 349s Get:40 http://ftpmaster.internal/ubuntu plucky/main amd64 libarchive-zip-perl all 1.68-1 [90.2 kB] 349s Get:41 http://ftpmaster.internal/ubuntu plucky/main amd64 libfile-stripnondeterminism-perl all 1.14.0-1 [20.1 kB] 349s Get:42 http://ftpmaster.internal/ubuntu plucky/main amd64 dh-strip-nondeterminism all 1.14.0-1 [5058 B] 349s Get:43 http://ftpmaster.internal/ubuntu plucky/main amd64 debugedit amd64 1:5.1-1 [46.9 kB] 349s Get:44 http://ftpmaster.internal/ubuntu plucky/main amd64 dwz amd64 0.15-1build6 [115 kB] 349s Get:45 http://ftpmaster.internal/ubuntu plucky/main amd64 gettext amd64 0.22.5-2 [948 kB] 349s Get:46 http://ftpmaster.internal/ubuntu plucky/main amd64 intltool-debian all 0.35.0+20060710.6 [23.2 kB] 349s Get:47 http://ftpmaster.internal/ubuntu plucky/main amd64 po-debconf all 1.0.21+nmu1 [233 kB] 349s Get:48 http://ftpmaster.internal/ubuntu plucky/main amd64 debhelper all 13.20ubuntu1 [893 kB] 349s Get:49 http://ftpmaster.internal/ubuntu plucky/universe amd64 dh-python all 6.20241024 [112 kB] 349s Get:50 http://ftpmaster.internal/ubuntu plucky/main amd64 fonts-dejavu-mono all 2.37-8 [502 kB] 349s Get:51 http://ftpmaster.internal/ubuntu plucky/main amd64 fonts-dejavu-core all 2.37-8 [835 kB] 349s Get:52 http://ftpmaster.internal/ubuntu plucky/main amd64 libfontenc1 amd64 1:1.1.8-1build1 [14.0 kB] 349s Get:53 http://ftpmaster.internal/ubuntu plucky/main amd64 x11-common all 1:7.7+23ubuntu3 [21.7 kB] 349s Get:54 http://ftpmaster.internal/ubuntu plucky/main amd64 xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 349s Get:55 http://ftpmaster.internal/ubuntu plucky/main amd64 xfonts-utils amd64 1:7.7+7 [97.1 kB] 349s Get:56 http://ftpmaster.internal/ubuntu plucky/main amd64 fonts-urw-base35 all 20200910-8 [11.0 MB] 349s Get:57 http://ftpmaster.internal/ubuntu plucky/main amd64 fontconfig-config amd64 2.15.0-1.1ubuntu2 [37.3 kB] 349s Get:58 http://ftpmaster.internal/ubuntu plucky/main amd64 libblas3 amd64 3.12.0-3build2 [247 kB] 349s Get:59 http://ftpmaster.internal/ubuntu plucky/main amd64 libfontconfig1 amd64 2.15.0-1.1ubuntu2 [139 kB] 349s Get:60 http://ftpmaster.internal/ubuntu plucky/main amd64 libpixman-1-0 amd64 0.44.0-3 [427 kB] 349s Get:61 http://ftpmaster.internal/ubuntu plucky/main amd64 libxcb-render0 amd64 1.17.0-2 [16.2 kB] 349s Get:62 http://ftpmaster.internal/ubuntu plucky/main amd64 libxcb-shm0 amd64 1.17.0-2 [5758 B] 349s Get:63 http://ftpmaster.internal/ubuntu plucky/main amd64 libxrender1 amd64 1:0.9.10-1.1build1 [19.0 kB] 349s Get:64 http://ftpmaster.internal/ubuntu plucky/main amd64 libcairo2 amd64 1.18.2-2 [569 kB] 349s Get:65 http://ftpmaster.internal/ubuntu plucky/main amd64 libdeflate0 amd64 1.22-1 [64.5 kB] 349s Get:66 http://ftpmaster.internal/ubuntu plucky/main amd64 libgfortran5 amd64 14.2.0-8ubuntu1 [909 kB] 349s Get:67 http://ftpmaster.internal/ubuntu plucky/main amd64 libgraphite2-3 amd64 1.3.14-2ubuntu1 [73.1 kB] 349s Get:68 http://ftpmaster.internal/ubuntu plucky/main amd64 libharfbuzz0b amd64 10.0.1-1 [540 kB] 349s Get:69 http://ftpmaster.internal/ubuntu plucky/main amd64 libimagequant0 amd64 2.18.0-1build1 [36.3 kB] 349s Get:70 http://ftpmaster.internal/ubuntu plucky/main amd64 libjpeg-turbo8 amd64 2.1.5-2ubuntu2 [150 kB] 349s Get:71 http://ftpmaster.internal/ubuntu plucky/main amd64 libjpeg8 amd64 8c-2ubuntu11 [2148 B] 349s Get:72 http://ftpmaster.internal/ubuntu plucky/main amd64 liblapack3 amd64 3.12.0-3build2 [2668 kB] 349s Get:73 http://ftpmaster.internal/ubuntu plucky/universe amd64 liblbfgsb0 amd64 3.0+dfsg.4-1build1 [29.9 kB] 349s Get:74 http://ftpmaster.internal/ubuntu plucky/main amd64 liblcms2-2 amd64 2.16-2 [212 kB] 349s Get:75 http://ftpmaster.internal/ubuntu plucky/main amd64 liblerc4 amd64 4.0.0+ds-4ubuntu2 [179 kB] 350s Get:76 http://ftpmaster.internal/ubuntu plucky/universe amd64 libmbedcrypto7t64 amd64 2.28.8-1 [209 kB] 350s Get:77 http://ftpmaster.internal/ubuntu plucky/universe amd64 libmbedx509-1t64 amd64 2.28.8-1 [46.6 kB] 350s Get:78 http://ftpmaster.internal/ubuntu plucky/universe amd64 libmbedtls14t64 amd64 2.28.8-1 [82.2 kB] 350s Get:79 http://ftpmaster.internal/ubuntu plucky/main amd64 libpython3.13-stdlib amd64 3.13.0-2 [2107 kB] 350s Get:80 http://ftpmaster.internal/ubuntu plucky/main amd64 libraqm0 amd64 0.10.1-1build1 [15.0 kB] 350s Get:81 http://ftpmaster.internal/ubuntu plucky/main amd64 libsharpyuv0 amd64 1.4.0-0.1 [17.5 kB] 350s Get:82 http://ftpmaster.internal/ubuntu plucky/main amd64 libjbig0 amd64 2.1-6.1ubuntu2 [29.7 kB] 350s Get:83 http://ftpmaster.internal/ubuntu plucky/main amd64 libwebp7 amd64 1.4.0-0.1 [231 kB] 350s Get:84 http://ftpmaster.internal/ubuntu plucky/main amd64 libtiff6 amd64 4.5.1+git230720-4ubuntu4 [200 kB] 350s Get:85 http://ftpmaster.internal/ubuntu plucky/main amd64 libwebpdemux2 amd64 1.4.0-0.1 [12.4 kB] 350s Get:86 http://ftpmaster.internal/ubuntu plucky/main amd64 libwebpmux3 amd64 1.4.0-0.1 [25.8 kB] 350s Get:87 http://ftpmaster.internal/ubuntu plucky/universe amd64 ncbi-data all 6.1.20170106+dfsg2-5 [3966 kB] 350s Get:88 http://ftpmaster.internal/ubuntu plucky/universe amd64 ncbi-blast+ amd64 2.16.0+ds-6 [15.2 MB] 350s Get:89 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-numpy amd64 1:1.26.4+ds-11build1 [4479 kB] 350s Get:90 http://ftpmaster.internal/ubuntu plucky/main amd64 libopenjp2-7 amd64 2.5.0-2ubuntu1 [184 kB] 350s Get:91 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-pil amd64 10.4.0-1ubuntu1 [463 kB] 350s Get:92 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-cairo amd64 1.26.1-2 [119 kB] 350s Get:93 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-freetype all 2.5.1-1 [92.3 kB] 350s Get:94 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-rlpycairo all 0.3.0-3 [9130 B] 350s Get:95 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-reportlab all 4.2.5-1 [1107 kB] 350s Get:96 http://ftpmaster.internal/ubuntu plucky/main amd64 xml-core all 0.19 [20.3 kB] 350s Get:97 http://ftpmaster.internal/ubuntu plucky/universe amd64 w3c-sgml-lib all 1.3-3 [280 kB] 350s Get:98 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-biopython amd64 1.84+dfsg-4 [1714 kB] 350s Get:99 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-six all 1.16.0-7 [13.1 kB] 350s Get:100 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-dateutil all 2.9.0-2 [80.3 kB] 350s Get:101 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-tz all 2024.1-2 [31.4 kB] 350s Get:102 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-pandas-lib amd64 2.2.3+dfsg-5 [5087 kB] 350s Get:103 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-pandas all 2.2.3+dfsg-5 [3112 kB] 350s Get:104 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-decorator all 5.1.1-5 [10.1 kB] 350s Get:105 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-scipy amd64 1.13.1-5 [18.2 MB] 351s Get:106 http://ftpmaster.internal/ubuntu plucky/main amd64 python3-packaging all 24.1-1 [41.4 kB] 351s Get:107 http://ftpmaster.internal/ubuntu plucky/universe amd64 vsearch amd64 2.29.1-1 [463 kB] 351s Get:108 http://ftpmaster.internal/ubuntu plucky/universe amd64 python3-presto amd64 0.7.2-1 [80.7 kB] 351s Get:109 http://ftpmaster.internal/ubuntu plucky/universe amd64 presto all 0.7.2-1 [240 kB] 351s Get:110 http://ftpmaster.internal/ubuntu plucky/universe amd64 pybuild-plugin-autopkgtest all 6.20241024 [1746 B] 351s Get:111 http://ftpmaster.internal/ubuntu plucky/main amd64 python3.13 amd64 3.13.0-2 [719 kB] 351s Get:112 http://ftpmaster.internal/ubuntu plucky-proposed/main amd64 python3-all amd64 3.12.7-1 [890 B] 351s Fetched 152 MB in 2s (61.0 MB/s) 351s Selecting previously unselected package libpython3.13-minimal:amd64. 351s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75548 files and directories currently installed.) 351s Preparing to unpack .../000-libpython3.13-minimal_3.13.0-2_amd64.deb ... 351s Unpacking libpython3.13-minimal:amd64 (3.13.0-2) ... 351s Selecting previously unselected package python3.13-minimal. 351s Preparing to unpack .../001-python3.13-minimal_3.13.0-2_amd64.deb ... 351s Unpacking python3.13-minimal (3.13.0-2) ... 352s Selecting previously unselected package sgml-base. 352s Preparing to unpack .../002-sgml-base_1.31_all.deb ... 352s Unpacking sgml-base (1.31) ... 352s Selecting previously unselected package m4. 352s Preparing to unpack .../003-m4_1.4.19-4build1_amd64.deb ... 352s Unpacking m4 (1.4.19-4build1) ... 352s Selecting previously unselected package autoconf. 352s Preparing to unpack .../004-autoconf_2.72-3_all.deb ... 352s Unpacking autoconf (2.72-3) ... 352s Selecting previously unselected package autotools-dev. 352s Preparing to unpack .../005-autotools-dev_20220109.1_all.deb ... 352s Unpacking autotools-dev (20220109.1) ... 352s Selecting previously unselected package automake. 352s Preparing to unpack .../006-automake_1%3a1.16.5-1.3ubuntu1_all.deb ... 352s Unpacking automake (1:1.16.5-1.3ubuntu1) ... 352s Selecting previously unselected package autopoint. 352s Preparing to unpack .../007-autopoint_0.22.5-2_all.deb ... 352s Unpacking autopoint (0.22.5-2) ... 352s Selecting previously unselected package libisl23:amd64. 352s Preparing to unpack .../008-libisl23_0.27-1_amd64.deb ... 352s Unpacking libisl23:amd64 (0.27-1) ... 352s Selecting previously unselected package libmpc3:amd64. 352s Preparing to unpack .../009-libmpc3_1.3.1-1build2_amd64.deb ... 352s Unpacking libmpc3:amd64 (1.3.1-1build2) ... 352s Selecting previously unselected package cpp-14-x86-64-linux-gnu. 352s Preparing to unpack .../010-cpp-14-x86-64-linux-gnu_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking cpp-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package cpp-14. 352s Preparing to unpack .../011-cpp-14_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking cpp-14 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package cpp-x86-64-linux-gnu. 352s Preparing to unpack .../012-cpp-x86-64-linux-gnu_4%3a14.1.0-2ubuntu1_amd64.deb ... 352s Unpacking cpp-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 352s Selecting previously unselected package cpp. 352s Preparing to unpack .../013-cpp_4%3a14.1.0-2ubuntu1_amd64.deb ... 352s Unpacking cpp (4:14.1.0-2ubuntu1) ... 352s Selecting previously unselected package libcc1-0:amd64. 352s Preparing to unpack .../014-libcc1-0_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking libcc1-0:amd64 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package libgomp1:amd64. 352s Preparing to unpack .../015-libgomp1_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking libgomp1:amd64 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package libitm1:amd64. 352s Preparing to unpack .../016-libitm1_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking libitm1:amd64 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package libasan8:amd64. 352s Preparing to unpack .../017-libasan8_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking libasan8:amd64 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package liblsan0:amd64. 352s Preparing to unpack .../018-liblsan0_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking liblsan0:amd64 (14.2.0-8ubuntu1) ... 352s Selecting previously unselected package libtsan2:amd64. 352s Preparing to unpack .../019-libtsan2_14.2.0-8ubuntu1_amd64.deb ... 352s Unpacking libtsan2:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package libubsan1:amd64. 353s Preparing to unpack .../020-libubsan1_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking libubsan1:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package libhwasan0:amd64. 353s Preparing to unpack .../021-libhwasan0_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking libhwasan0:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package libquadmath0:amd64. 353s Preparing to unpack .../022-libquadmath0_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking libquadmath0:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package libgcc-14-dev:amd64. 353s Preparing to unpack .../023-libgcc-14-dev_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking libgcc-14-dev:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package gcc-14-x86-64-linux-gnu. 353s Preparing to unpack .../024-gcc-14-x86-64-linux-gnu_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking gcc-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package gcc-14. 353s Preparing to unpack .../025-gcc-14_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking gcc-14 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package gcc-x86-64-linux-gnu. 353s Preparing to unpack .../026-gcc-x86-64-linux-gnu_4%3a14.1.0-2ubuntu1_amd64.deb ... 353s Unpacking gcc-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 353s Selecting previously unselected package gcc. 353s Preparing to unpack .../027-gcc_4%3a14.1.0-2ubuntu1_amd64.deb ... 353s Unpacking gcc (4:14.1.0-2ubuntu1) ... 353s Selecting previously unselected package libstdc++-14-dev:amd64. 353s Preparing to unpack .../028-libstdc++-14-dev_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking libstdc++-14-dev:amd64 (14.2.0-8ubuntu1) ... 353s Selecting previously unselected package g++-14-x86-64-linux-gnu. 353s Preparing to unpack .../029-g++-14-x86-64-linux-gnu_14.2.0-8ubuntu1_amd64.deb ... 353s Unpacking g++-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 354s Selecting previously unselected package g++-14. 354s Preparing to unpack .../030-g++-14_14.2.0-8ubuntu1_amd64.deb ... 354s Unpacking g++-14 (14.2.0-8ubuntu1) ... 354s Selecting previously unselected package g++-x86-64-linux-gnu. 354s Preparing to unpack .../031-g++-x86-64-linux-gnu_4%3a14.1.0-2ubuntu1_amd64.deb ... 354s Unpacking g++-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 354s Selecting previously unselected package g++. 354s Preparing to unpack .../032-g++_4%3a14.1.0-2ubuntu1_amd64.deb ... 354s Unpacking g++ (4:14.1.0-2ubuntu1) ... 354s Selecting previously unselected package build-essential. 354s Preparing to unpack .../033-build-essential_12.10ubuntu1_amd64.deb ... 354s Unpacking build-essential (12.10ubuntu1) ... 354s Selecting previously unselected package cd-hit. 354s Preparing to unpack .../034-cd-hit_4.8.1-4_amd64.deb ... 354s Unpacking cd-hit (4.8.1-4) ... 354s Selecting previously unselected package libdebhelper-perl. 354s Preparing to unpack .../035-libdebhelper-perl_13.20ubuntu1_all.deb ... 354s Unpacking libdebhelper-perl (13.20ubuntu1) ... 354s Selecting previously unselected package libtool. 354s Preparing to unpack .../036-libtool_2.4.7-7build1_all.deb ... 354s Unpacking libtool (2.4.7-7build1) ... 354s Selecting previously unselected package dh-autoreconf. 354s Preparing to unpack .../037-dh-autoreconf_20_all.deb ... 354s Unpacking dh-autoreconf (20) ... 354s Selecting previously unselected package libarchive-zip-perl. 354s Preparing to unpack .../038-libarchive-zip-perl_1.68-1_all.deb ... 354s Unpacking libarchive-zip-perl (1.68-1) ... 354s Selecting previously unselected package libfile-stripnondeterminism-perl. 354s Preparing to unpack .../039-libfile-stripnondeterminism-perl_1.14.0-1_all.deb ... 354s Unpacking libfile-stripnondeterminism-perl (1.14.0-1) ... 354s Selecting previously unselected package dh-strip-nondeterminism. 354s Preparing to unpack .../040-dh-strip-nondeterminism_1.14.0-1_all.deb ... 354s Unpacking dh-strip-nondeterminism (1.14.0-1) ... 354s Selecting previously unselected package debugedit. 354s Preparing to unpack .../041-debugedit_1%3a5.1-1_amd64.deb ... 354s Unpacking debugedit (1:5.1-1) ... 354s Selecting previously unselected package dwz. 354s Preparing to unpack .../042-dwz_0.15-1build6_amd64.deb ... 354s Unpacking dwz (0.15-1build6) ... 354s Selecting previously unselected package gettext. 354s Preparing to unpack .../043-gettext_0.22.5-2_amd64.deb ... 354s Unpacking gettext (0.22.5-2) ... 354s Selecting previously unselected package intltool-debian. 354s Preparing to unpack .../044-intltool-debian_0.35.0+20060710.6_all.deb ... 354s Unpacking intltool-debian (0.35.0+20060710.6) ... 354s Selecting previously unselected package po-debconf. 354s Preparing to unpack .../045-po-debconf_1.0.21+nmu1_all.deb ... 354s Unpacking po-debconf (1.0.21+nmu1) ... 354s Selecting previously unselected package debhelper. 354s Preparing to unpack .../046-debhelper_13.20ubuntu1_all.deb ... 354s Unpacking debhelper (13.20ubuntu1) ... 354s Selecting previously unselected package dh-python. 354s Preparing to unpack .../047-dh-python_6.20241024_all.deb ... 354s Unpacking dh-python (6.20241024) ... 354s Selecting previously unselected package fonts-dejavu-mono. 354s Preparing to unpack .../048-fonts-dejavu-mono_2.37-8_all.deb ... 354s Unpacking fonts-dejavu-mono (2.37-8) ... 354s Selecting previously unselected package fonts-dejavu-core. 354s Preparing to unpack .../049-fonts-dejavu-core_2.37-8_all.deb ... 354s Unpacking fonts-dejavu-core (2.37-8) ... 354s Selecting previously unselected package libfontenc1:amd64. 354s Preparing to unpack .../050-libfontenc1_1%3a1.1.8-1build1_amd64.deb ... 354s Unpacking libfontenc1:amd64 (1:1.1.8-1build1) ... 354s Selecting previously unselected package x11-common. 354s Preparing to unpack .../051-x11-common_1%3a7.7+23ubuntu3_all.deb ... 354s Unpacking x11-common (1:7.7+23ubuntu3) ... 354s Selecting previously unselected package xfonts-encodings. 354s Preparing to unpack .../052-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 354s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 354s Selecting previously unselected package xfonts-utils. 354s Preparing to unpack .../053-xfonts-utils_1%3a7.7+7_amd64.deb ... 354s Unpacking xfonts-utils (1:7.7+7) ... 355s Selecting previously unselected package fonts-urw-base35. 355s Preparing to unpack .../054-fonts-urw-base35_20200910-8_all.deb ... 355s Unpacking fonts-urw-base35 (20200910-8) ... 355s Selecting previously unselected package fontconfig-config. 355s Preparing to unpack .../055-fontconfig-config_2.15.0-1.1ubuntu2_amd64.deb ... 355s Unpacking fontconfig-config (2.15.0-1.1ubuntu2) ... 355s Selecting previously unselected package libblas3:amd64. 355s Preparing to unpack .../056-libblas3_3.12.0-3build2_amd64.deb ... 355s Unpacking libblas3:amd64 (3.12.0-3build2) ... 355s Selecting previously unselected package libfontconfig1:amd64. 355s Preparing to unpack .../057-libfontconfig1_2.15.0-1.1ubuntu2_amd64.deb ... 355s Unpacking libfontconfig1:amd64 (2.15.0-1.1ubuntu2) ... 355s Selecting previously unselected package libpixman-1-0:amd64. 355s Preparing to unpack .../058-libpixman-1-0_0.44.0-3_amd64.deb ... 355s Unpacking libpixman-1-0:amd64 (0.44.0-3) ... 355s Selecting previously unselected package libxcb-render0:amd64. 355s Preparing to unpack .../059-libxcb-render0_1.17.0-2_amd64.deb ... 355s Unpacking libxcb-render0:amd64 (1.17.0-2) ... 355s Selecting previously unselected package libxcb-shm0:amd64. 355s Preparing to unpack .../060-libxcb-shm0_1.17.0-2_amd64.deb ... 355s Unpacking libxcb-shm0:amd64 (1.17.0-2) ... 355s Selecting previously unselected package libxrender1:amd64. 355s Preparing to unpack .../061-libxrender1_1%3a0.9.10-1.1build1_amd64.deb ... 355s Unpacking libxrender1:amd64 (1:0.9.10-1.1build1) ... 355s Selecting previously unselected package libcairo2:amd64. 355s Preparing to unpack .../062-libcairo2_1.18.2-2_amd64.deb ... 355s Unpacking libcairo2:amd64 (1.18.2-2) ... 355s Selecting previously unselected package libdeflate0:amd64. 355s Preparing to unpack .../063-libdeflate0_1.22-1_amd64.deb ... 355s Unpacking libdeflate0:amd64 (1.22-1) ... 355s Selecting previously unselected package libgfortran5:amd64. 355s Preparing to unpack .../064-libgfortran5_14.2.0-8ubuntu1_amd64.deb ... 355s Unpacking libgfortran5:amd64 (14.2.0-8ubuntu1) ... 355s Selecting previously unselected package libgraphite2-3:amd64. 355s Preparing to unpack .../065-libgraphite2-3_1.3.14-2ubuntu1_amd64.deb ... 355s Unpacking libgraphite2-3:amd64 (1.3.14-2ubuntu1) ... 355s Selecting previously unselected package libharfbuzz0b:amd64. 355s Preparing to unpack .../066-libharfbuzz0b_10.0.1-1_amd64.deb ... 355s Unpacking libharfbuzz0b:amd64 (10.0.1-1) ... 355s Selecting previously unselected package libimagequant0:amd64. 355s Preparing to unpack .../067-libimagequant0_2.18.0-1build1_amd64.deb ... 355s Unpacking libimagequant0:amd64 (2.18.0-1build1) ... 355s Selecting previously unselected package libjpeg-turbo8:amd64. 355s Preparing to unpack .../068-libjpeg-turbo8_2.1.5-2ubuntu2_amd64.deb ... 355s Unpacking libjpeg-turbo8:amd64 (2.1.5-2ubuntu2) ... 355s Selecting previously unselected package libjpeg8:amd64. 355s Preparing to unpack .../069-libjpeg8_8c-2ubuntu11_amd64.deb ... 355s Unpacking libjpeg8:amd64 (8c-2ubuntu11) ... 355s Selecting previously unselected package liblapack3:amd64. 355s Preparing to unpack .../070-liblapack3_3.12.0-3build2_amd64.deb ... 355s Unpacking liblapack3:amd64 (3.12.0-3build2) ... 355s Selecting previously unselected package liblbfgsb0:amd64. 355s Preparing to unpack .../071-liblbfgsb0_3.0+dfsg.4-1build1_amd64.deb ... 355s Unpacking liblbfgsb0:amd64 (3.0+dfsg.4-1build1) ... 355s Selecting previously unselected package liblcms2-2:amd64. 355s Preparing to unpack .../072-liblcms2-2_2.16-2_amd64.deb ... 355s Unpacking liblcms2-2:amd64 (2.16-2) ... 355s Selecting previously unselected package liblerc4:amd64. 355s Preparing to unpack .../073-liblerc4_4.0.0+ds-4ubuntu2_amd64.deb ... 355s Unpacking liblerc4:amd64 (4.0.0+ds-4ubuntu2) ... 356s Selecting previously unselected package libmbedcrypto7t64:amd64. 356s Preparing to unpack .../074-libmbedcrypto7t64_2.28.8-1_amd64.deb ... 356s Unpacking libmbedcrypto7t64:amd64 (2.28.8-1) ... 356s Selecting previously unselected package libmbedx509-1t64:amd64. 356s Preparing to unpack .../075-libmbedx509-1t64_2.28.8-1_amd64.deb ... 356s Unpacking libmbedx509-1t64:amd64 (2.28.8-1) ... 356s Selecting previously unselected package libmbedtls14t64:amd64. 356s Preparing to unpack .../076-libmbedtls14t64_2.28.8-1_amd64.deb ... 356s Unpacking libmbedtls14t64:amd64 (2.28.8-1) ... 356s Selecting previously unselected package libpython3.13-stdlib:amd64. 356s Preparing to unpack .../077-libpython3.13-stdlib_3.13.0-2_amd64.deb ... 356s Unpacking libpython3.13-stdlib:amd64 (3.13.0-2) ... 356s Selecting previously unselected package libraqm0:amd64. 356s Preparing to unpack .../078-libraqm0_0.10.1-1build1_amd64.deb ... 356s Unpacking libraqm0:amd64 (0.10.1-1build1) ... 356s Selecting previously unselected package libsharpyuv0:amd64. 356s Preparing to unpack .../079-libsharpyuv0_1.4.0-0.1_amd64.deb ... 356s Unpacking libsharpyuv0:amd64 (1.4.0-0.1) ... 356s Selecting previously unselected package libjbig0:amd64. 356s Preparing to unpack .../080-libjbig0_2.1-6.1ubuntu2_amd64.deb ... 356s Unpacking libjbig0:amd64 (2.1-6.1ubuntu2) ... 356s Selecting previously unselected package libwebp7:amd64. 356s Preparing to unpack .../081-libwebp7_1.4.0-0.1_amd64.deb ... 356s Unpacking libwebp7:amd64 (1.4.0-0.1) ... 356s Selecting previously unselected package libtiff6:amd64. 356s Preparing to unpack .../082-libtiff6_4.5.1+git230720-4ubuntu4_amd64.deb ... 356s Unpacking libtiff6:amd64 (4.5.1+git230720-4ubuntu4) ... 356s Selecting previously unselected package libwebpdemux2:amd64. 356s Preparing to unpack .../083-libwebpdemux2_1.4.0-0.1_amd64.deb ... 356s Unpacking libwebpdemux2:amd64 (1.4.0-0.1) ... 356s Selecting previously unselected package libwebpmux3:amd64. 356s Preparing to unpack .../084-libwebpmux3_1.4.0-0.1_amd64.deb ... 356s Unpacking libwebpmux3:amd64 (1.4.0-0.1) ... 356s Selecting previously unselected package ncbi-data. 356s Preparing to unpack .../085-ncbi-data_6.1.20170106+dfsg2-5_all.deb ... 356s Unpacking ncbi-data (6.1.20170106+dfsg2-5) ... 356s Selecting previously unselected package ncbi-blast+. 356s Preparing to unpack .../086-ncbi-blast+_2.16.0+ds-6_amd64.deb ... 356s Unpacking ncbi-blast+ (2.16.0+ds-6) ... 356s Selecting previously unselected package python3-numpy. 356s Preparing to unpack .../087-python3-numpy_1%3a1.26.4+ds-11build1_amd64.deb ... 356s Unpacking python3-numpy (1:1.26.4+ds-11build1) ... 357s Selecting previously unselected package libopenjp2-7:amd64. 357s Preparing to unpack .../088-libopenjp2-7_2.5.0-2ubuntu1_amd64.deb ... 357s Unpacking libopenjp2-7:amd64 (2.5.0-2ubuntu1) ... 357s Selecting previously unselected package python3-pil:amd64. 357s Preparing to unpack .../089-python3-pil_10.4.0-1ubuntu1_amd64.deb ... 357s Unpacking python3-pil:amd64 (10.4.0-1ubuntu1) ... 357s Selecting previously unselected package python3-cairo. 357s Preparing to unpack .../090-python3-cairo_1.26.1-2_amd64.deb ... 357s Unpacking python3-cairo (1.26.1-2) ... 357s Selecting previously unselected package python3-freetype. 357s Preparing to unpack .../091-python3-freetype_2.5.1-1_all.deb ... 357s Unpacking python3-freetype (2.5.1-1) ... 357s Selecting previously unselected package python3-rlpycairo. 357s Preparing to unpack .../092-python3-rlpycairo_0.3.0-3_all.deb ... 357s Unpacking python3-rlpycairo (0.3.0-3) ... 357s Selecting previously unselected package python3-reportlab. 357s Preparing to unpack .../093-python3-reportlab_4.2.5-1_all.deb ... 357s Unpacking python3-reportlab (4.2.5-1) ... 357s Selecting previously unselected package xml-core. 357s Preparing to unpack .../094-xml-core_0.19_all.deb ... 357s Unpacking xml-core (0.19) ... 357s Selecting previously unselected package w3c-sgml-lib. 357s Preparing to unpack .../095-w3c-sgml-lib_1.3-3_all.deb ... 357s Unpacking w3c-sgml-lib (1.3-3) ... 357s Selecting previously unselected package python3-biopython. 357s Preparing to unpack .../096-python3-biopython_1.84+dfsg-4_amd64.deb ... 357s Unpacking python3-biopython (1.84+dfsg-4) ... 357s Selecting previously unselected package python3-six. 357s Preparing to unpack .../097-python3-six_1.16.0-7_all.deb ... 357s Unpacking python3-six (1.16.0-7) ... 357s Selecting previously unselected package python3-dateutil. 357s Preparing to unpack .../098-python3-dateutil_2.9.0-2_all.deb ... 357s Unpacking python3-dateutil (2.9.0-2) ... 357s Selecting previously unselected package python3-tz. 357s Preparing to unpack .../099-python3-tz_2024.1-2_all.deb ... 357s Unpacking python3-tz (2024.1-2) ... 357s Selecting previously unselected package python3-pandas-lib:amd64. 357s Preparing to unpack .../100-python3-pandas-lib_2.2.3+dfsg-5_amd64.deb ... 357s Unpacking python3-pandas-lib:amd64 (2.2.3+dfsg-5) ... 358s Selecting previously unselected package python3-pandas. 358s Preparing to unpack .../101-python3-pandas_2.2.3+dfsg-5_all.deb ... 358s Unpacking python3-pandas (2.2.3+dfsg-5) ... 358s Selecting previously unselected package python3-decorator. 358s Preparing to unpack .../102-python3-decorator_5.1.1-5_all.deb ... 358s Unpacking python3-decorator (5.1.1-5) ... 358s Selecting previously unselected package python3-scipy. 358s Preparing to unpack .../103-python3-scipy_1.13.1-5_amd64.deb ... 358s Unpacking python3-scipy (1.13.1-5) ... 358s Selecting previously unselected package python3-packaging. 358s Preparing to unpack .../104-python3-packaging_24.1-1_all.deb ... 358s Unpacking python3-packaging (24.1-1) ... 358s Selecting previously unselected package vsearch. 358s Preparing to unpack .../105-vsearch_2.29.1-1_amd64.deb ... 358s Unpacking vsearch (2.29.1-1) ... 358s Selecting previously unselected package python3-presto. 358s Preparing to unpack .../106-python3-presto_0.7.2-1_amd64.deb ... 358s Unpacking python3-presto (0.7.2-1) ... 359s Selecting previously unselected package presto. 359s Preparing to unpack .../107-presto_0.7.2-1_all.deb ... 359s Unpacking presto (0.7.2-1) ... 359s Selecting previously unselected package pybuild-plugin-autopkgtest. 359s Preparing to unpack .../108-pybuild-plugin-autopkgtest_6.20241024_all.deb ... 359s Unpacking pybuild-plugin-autopkgtest (6.20241024) ... 359s Selecting previously unselected package python3.13. 359s Preparing to unpack .../109-python3.13_3.13.0-2_amd64.deb ... 359s Unpacking python3.13 (3.13.0-2) ... 359s Selecting previously unselected package python3-all. 359s Preparing to unpack .../110-python3-all_3.12.7-1_amd64.deb ... 359s Unpacking python3-all (3.12.7-1) ... 359s Selecting previously unselected package autopkgtest-satdep. 359s Preparing to unpack .../111-1-autopkgtest-satdep.deb ... 359s Unpacking autopkgtest-satdep (0) ... 359s Setting up dh-python (6.20241024) ... 359s Setting up libgraphite2-3:amd64 (1.3.14-2ubuntu1) ... 359s Setting up liblcms2-2:amd64 (2.16-2) ... 359s Setting up ncbi-data (6.1.20170106+dfsg2-5) ... 359s Setting up libpixman-1-0:amd64 (0.44.0-3) ... 359s Setting up libsharpyuv0:amd64 (1.4.0-0.1) ... 359s Setting up liblerc4:amd64 (4.0.0+ds-4ubuntu2) ... 359s Setting up libmbedcrypto7t64:amd64 (2.28.8-1) ... 359s Setting up libxrender1:amd64 (1:0.9.10-1.1build1) ... 359s Setting up libxcb-render0:amd64 (1.17.0-2) ... 359s Setting up libarchive-zip-perl (1.68-1) ... 359s Setting up vsearch (2.29.1-1) ... 359s Setting up libdebhelper-perl (13.20ubuntu1) ... 359s Setting up x11-common (1:7.7+23ubuntu3) ... 359s Setting up libdeflate0:amd64 (1.22-1) ... 359s Setting up m4 (1.4.19-4build1) ... 359s Setting up libxcb-shm0:amd64 (1.17.0-2) ... 359s Setting up libgomp1:amd64 (14.2.0-8ubuntu1) ... 359s Setting up python3-freetype (2.5.1-1) ... 360s Setting up libjbig0:amd64 (2.1-6.1ubuntu2) ... 360s Setting up python3-tz (2024.1-2) ... 360s Setting up python3-six (1.16.0-7) ... 360s Setting up libpython3.13-minimal:amd64 (3.13.0-2) ... 360s Setting up python3-decorator (5.1.1-5) ... 360s Setting up libfontenc1:amd64 (1:1.1.8-1build1) ... 360s Setting up autotools-dev (20220109.1) ... 360s Setting up libblas3:amd64 (3.12.0-3build2) ... 360s update-alternatives: using /usr/lib/x86_64-linux-gnu/blas/libblas.so.3 to provide /usr/lib/x86_64-linux-gnu/libblas.so.3 (libblas.so.3-x86_64-linux-gnu) in auto mode 360s Setting up python3-packaging (24.1-1) ... 360s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 360s Setting up libquadmath0:amd64 (14.2.0-8ubuntu1) ... 360s Setting up libimagequant0:amd64 (2.18.0-1build1) ... 360s Setting up fonts-dejavu-mono (2.37-8) ... 360s Setting up libmpc3:amd64 (1.3.1-1build2) ... 360s Setting up autopoint (0.22.5-2) ... 360s Setting up fonts-dejavu-core (2.37-8) ... 360s Setting up libjpeg-turbo8:amd64 (2.1.5-2ubuntu2) ... 360s Setting up libgfortran5:amd64 (14.2.0-8ubuntu1) ... 360s Setting up autoconf (2.72-3) ... 360s Setting up libwebp7:amd64 (1.4.0-0.1) ... 360s Setting up libubsan1:amd64 (14.2.0-8ubuntu1) ... 360s Setting up dwz (0.15-1build6) ... 360s Setting up libhwasan0:amd64 (14.2.0-8ubuntu1) ... 360s Setting up libasan8:amd64 (14.2.0-8ubuntu1) ... 360s Setting up debugedit (1:5.1-1) ... 360s Setting up libopenjp2-7:amd64 (2.5.0-2ubuntu1) ... 360s Setting up python3.13-minimal (3.13.0-2) ... 361s Setting up libharfbuzz0b:amd64 (10.0.1-1) ... 361s Setting up python3-dateutil (2.9.0-2) ... 362s Setting up sgml-base (1.31) ... 362s Setting up libtsan2:amd64 (14.2.0-8ubuntu1) ... 362s Setting up libisl23:amd64 (0.27-1) ... 362s Setting up libwebpmux3:amd64 (1.4.0-0.1) ... 362s Setting up libpython3.13-stdlib:amd64 (3.13.0-2) ... 362s Setting up libcc1-0:amd64 (14.2.0-8ubuntu1) ... 362s Setting up liblsan0:amd64 (14.2.0-8ubuntu1) ... 362s Setting up libitm1:amd64 (14.2.0-8ubuntu1) ... 362s Setting up cd-hit (4.8.1-4) ... 362s Setting up libjpeg8:amd64 (8c-2ubuntu11) ... 362s Setting up automake (1:1.16.5-1.3ubuntu1) ... 362s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode 362s Setting up libfile-stripnondeterminism-perl (1.14.0-1) ... 362s Setting up liblapack3:amd64 (3.12.0-3build2) ... 362s update-alternatives: using /usr/lib/x86_64-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/x86_64-linux-gnu/liblapack.so.3 (liblapack.so.3-x86_64-linux-gnu) in auto mode 362s Setting up gettext (0.22.5-2) ... 362s Setting up libmbedx509-1t64:amd64 (2.28.8-1) ... 362s Setting up python3.13 (3.13.0-2) ... 363s Setting up fontconfig-config (2.15.0-1.1ubuntu2) ... 363s Setting up libwebpdemux2:amd64 (1.4.0-0.1) ... 363s Setting up python3-all (3.12.7-1) ... 363s Setting up xfonts-utils (1:7.7+7) ... 363s Setting up intltool-debian (0.35.0+20060710.6) ... 363s Setting up libraqm0:amd64 (0.10.1-1build1) ... 363s Setting up cpp-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 363s Setting up python3-numpy (1:1.26.4+ds-11build1) ... 366s Setting up cpp-14 (14.2.0-8ubuntu1) ... 366s Setting up dh-strip-nondeterminism (1.14.0-1) ... 366s Setting up libmbedtls14t64:amd64 (2.28.8-1) ... 366s Setting up libtiff6:amd64 (4.5.1+git230720-4ubuntu4) ... 366s Setting up xml-core (0.19) ... 367s Setting up libfontconfig1:amd64 (2.15.0-1.1ubuntu2) ... 367s Setting up libgcc-14-dev:amd64 (14.2.0-8ubuntu1) ... 367s Setting up libstdc++-14-dev:amd64 (14.2.0-8ubuntu1) ... 367s Setting up liblbfgsb0:amd64 (3.0+dfsg.4-1build1) ... 367s Setting up cpp-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 367s Setting up python3-scipy (1.13.1-5) ... 373s Setting up po-debconf (1.0.21+nmu1) ... 373s Setting up python3-pandas-lib:amd64 (2.2.3+dfsg-5) ... 373s Setting up fonts-urw-base35 (20200910-8) ... 373s Setting up libcairo2:amd64 (1.18.2-2) ... 373s Setting up ncbi-blast+ (2.16.0+ds-6) ... 373s Setting up python3-pil:amd64 (10.4.0-1ubuntu1) ... 374s Setting up python3-pandas (2.2.3+dfsg-5) ... 383s Setting up cpp (4:14.1.0-2ubuntu1) ... 383s Setting up gcc-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 383s Setting up python3-cairo (1.26.1-2) ... 383s Setting up gcc-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 383s Setting up gcc-14 (14.2.0-8ubuntu1) ... 383s Setting up python3-rlpycairo (0.3.0-3) ... 383s Setting up g++-14-x86-64-linux-gnu (14.2.0-8ubuntu1) ... 383s Setting up python3-reportlab (4.2.5-1) ... 385s Setting up g++-x86-64-linux-gnu (4:14.1.0-2ubuntu1) ... 385s Setting up g++-14 (14.2.0-8ubuntu1) ... 385s Setting up libtool (2.4.7-7build1) ... 385s Setting up gcc (4:14.1.0-2ubuntu1) ... 385s Setting up dh-autoreconf (20) ... 385s Setting up g++ (4:14.1.0-2ubuntu1) ... 385s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 385s Setting up build-essential (12.10ubuntu1) ... 385s Setting up debhelper (13.20ubuntu1) ... 385s Setting up pybuild-plugin-autopkgtest (6.20241024) ... 385s Processing triggers for libc-bin (2.40-1ubuntu3) ... 385s Processing triggers for systemd (256.5-2ubuntu4) ... 385s Processing triggers for man-db (2.12.1-3) ... 386s Processing triggers for install-info (7.1.1-1) ... 386s Processing triggers for sgml-base (1.31) ... 386s Setting up w3c-sgml-lib (1.3-3) ... 415s Setting up python3-biopython (1.84+dfsg-4) ... 417s Setting up python3-presto (0.7.2-1) ... 417s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 417s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 417s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 417s header['SPECIES'] = re.sub('\s', '_', fields[2]) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 417s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 417s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 417s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 417s version = re.sub('\.linux.*$','',version) 417s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 417s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 417s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 417s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 417s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 417s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 417s header['SPECIES'] = re.sub('\s', '_', fields[2]) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 417s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 417s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 417s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 417s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 417s version = re.sub('\.linux.*$','',version) 417s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 417s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 417s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 417s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 417s Setting up presto (0.7.2-1) ... 417s Setting up autopkgtest-satdep (0) ... 421s (Reading database ... 85640 files and directories currently installed.) 421s Removing autopkgtest-satdep (0) ... 421s autopkgtest [10:13:35]: test pybuild-autopkgtest: pybuild-autopkgtest 421s autopkgtest [10:13:35]: test pybuild-autopkgtest: [----------------------- 421s pybuild-autopkgtest 422s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Ym1phs/build.hfa/src/bin /tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build; rm /tmp/autopkgtest.Ym1phs/build.hfa/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 422s I: pybuild base:311: cd /tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build; python3.13 -m unittest discover -v 422s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... -> test_collapseAnnotation() 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 422s <- test_collapseAnnotation() 0.000 422s -> test_getCoordKey() 422s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 422s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 422s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 422s <- test_getCoordKey() 0.000 422s -> test_mergeAnnotation() 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 422s <- test_mergeAnnotation() 0.000 422s -> test_renameAnnotation() 422s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 422s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 422s <- test_renameAnnotation() 0.000 422s ok 422s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 422s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 422s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 422s tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) ... ERROR 422s tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) ... ERROR 422s tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) ... ERROR 422s tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) ... ERROR 422s tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) ... ERROR 422s tests.test_IO (unittest.loader._FailedTest.tests.test_IO) ... ERROR 422s tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) ... ERROR 422s tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) ... ERROR 422s tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) ... ERROR 422s 422s ====================================================================== 422s ERROR: tests.test_AssemblePairs (unittest.loader._FailedTest.tests.test_AssemblePairs) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_AssemblePairs 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_AssemblePairs.py", line 12, in 422s import pandas as pd 422s File "/usr/lib/python3/dist-packages/pandas/__init__.py", line 19, in 422s raise ImportError( 422s "Unable to import required dependencies:\n" + "\n".join(_missing_dependencies) 422s ) 422s ImportError: Unable to import required dependencies: 422s numpy: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_BuildConsensus (unittest.loader._FailedTest.tests.test_BuildConsensus) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_BuildConsensus 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 422s from . import multiarray 422s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 422s from . import overrides 422s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 422s from numpy.core._multiarray_umath import ( 422s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 422s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 422s 422s During handling of the above exception, another exception occurred: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 422s from numpy.__config__ import show as show_config 422s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 422s from numpy.core._multiarray_umath import ( 422s ...<3 lines>... 422s ) 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 422s raise ImportError(msg) 422s ImportError: 422s 422s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 422s 422s Importing the numpy C-extensions failed. This error can happen for 422s many reasons, often due to issues with your setup or how NumPy was 422s installed. 422s 422s We have compiled some common reasons and troubleshooting tips at: 422s 422s https://numpy.org/devdocs/user/troubleshooting-importerror.html 422s 422s Please note and check the following: 422s 422s * The Python version is: Python3.13 from "/usr/bin/python3.13" 422s * The NumPy version is: "1.26.4" 422s 422s and make sure that they are the versions you expect. 422s Please carefully study the documentation linked above for further help. 422s 422s Original error was: No module named 'numpy.core._multiarray_umath' 422s 422s 422s The above exception was the direct cause of the following exception: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_BuildConsensus.py", line 16, in 422s from presto.Sequence import calculateSetError, deleteSeqPositions, findGapPositions, \ 422s frequencyConsensus, qualityConsensus 422s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 422s import numpy as np 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 422s raise ImportError(msg) from e 422s ImportError: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_CollapseSeq (unittest.loader._FailedTest.tests.test_CollapseSeq) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_CollapseSeq 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 422s from . import multiarray 422s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 422s from . import overrides 422s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 422s from numpy.core._multiarray_umath import ( 422s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 422s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 422s 422s During handling of the above exception, another exception occurred: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 422s from numpy.__config__ import show as show_config 422s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 422s from numpy.core._multiarray_umath import ( 422s ...<3 lines>... 422s ) 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 422s raise ImportError(msg) 422s ImportError: 422s 422s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 422s 422s Importing the numpy C-extensions failed. This error can happen for 422s many reasons, often due to issues with your setup or how NumPy was 422s installed. 422s 422s We have compiled some common reasons and troubleshooting tips at: 422s 422s https://numpy.org/devdocs/user/troubleshooting-importerror.html 422s 422s Please note and check the following: 422s 422s * The Python version is: Python3.13 from "/usr/bin/python3.13" 422s * The NumPy version is: "1.26.4" 422s 422s and make sure that they are the versions you expect. 422s Please carefully study the documentation linked above for further help. 422s 422s Original error was: No module named 'numpy.core._multiarray_umath' 422s 422s 422s The above exception was the direct cause of the following exception: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_CollapseSeq.py", line 17, in 422s from presto.Sequence import checkSeqEqual 422s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 422s import numpy as np 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 422s raise ImportError(msg) from e 422s ImportError: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_ConvertHeaders (unittest.loader._FailedTest.tests.test_ConvertHeaders) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_ConvertHeaders 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_ConvertHeaders.py", line 18, in 422s import ConvertHeaders 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/../bin/ConvertHeaders.py", line 15, in 422s from Bio import SeqIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 422s from Bio.SeqIO import TwoBitIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 422s raise MissingPythonDependencyError( 422s ...<2 lines>... 422s ) from None 422s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 422s 422s 422s ====================================================================== 422s ERROR: tests.test_EstimateError (unittest.loader._FailedTest.tests.test_EstimateError) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_EstimateError 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 422s from . import multiarray 422s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 422s from . import overrides 422s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 422s from numpy.core._multiarray_umath import ( 422s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 422s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 422s 422s During handling of the above exception, another exception occurred: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 422s from numpy.__config__ import show as show_config 422s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 422s from numpy.core._multiarray_umath import ( 422s ...<3 lines>... 422s ) 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 422s raise ImportError(msg) 422s ImportError: 422s 422s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 422s 422s Importing the numpy C-extensions failed. This error can happen for 422s many reasons, often due to issues with your setup or how NumPy was 422s installed. 422s 422s We have compiled some common reasons and troubleshooting tips at: 422s 422s https://numpy.org/devdocs/user/troubleshooting-importerror.html 422s 422s Please note and check the following: 422s 422s * The Python version is: Python3.13 from "/usr/bin/python3.13" 422s * The NumPy version is: "1.26.4" 422s 422s and make sure that they are the versions you expect. 422s Please carefully study the documentation linked above for further help. 422s 422s Original error was: No module named 'numpy.core._multiarray_umath' 422s 422s 422s The above exception was the direct cause of the following exception: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_EstimateError.py", line 11, in 422s import numpy as np 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 422s raise ImportError(msg) from e 422s ImportError: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_IO (unittest.loader._FailedTest.tests.test_IO) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_IO 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_IO.py", line 15, in 422s from presto.IO import getFileType, readSeqFile 422s File "/usr/lib/python3/dist-packages/presto/IO.py", line 15, in 422s from Bio import SeqIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 422s from Bio.SeqIO import TwoBitIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 422s raise MissingPythonDependencyError( 422s ...<2 lines>... 422s ) from None 422s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 422s 422s 422s ====================================================================== 422s ERROR: tests.test_MaskPrimers (unittest.loader._FailedTest.tests.test_MaskPrimers) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_MaskPrimers 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 422s from . import multiarray 422s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 422s from . import overrides 422s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 422s from numpy.core._multiarray_umath import ( 422s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 422s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 422s 422s During handling of the above exception, another exception occurred: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 422s from numpy.__config__ import show as show_config 422s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 422s from numpy.core._multiarray_umath import ( 422s ...<3 lines>... 422s ) 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 422s raise ImportError(msg) 422s ImportError: 422s 422s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 422s 422s Importing the numpy C-extensions failed. This error can happen for 422s many reasons, often due to issues with your setup or how NumPy was 422s installed. 422s 422s We have compiled some common reasons and troubleshooting tips at: 422s 422s https://numpy.org/devdocs/user/troubleshooting-importerror.html 422s 422s Please note and check the following: 422s 422s * The Python version is: Python3.13 from "/usr/bin/python3.13" 422s * The NumPy version is: "1.26.4" 422s 422s and make sure that they are the versions you expect. 422s Please carefully study the documentation linked above for further help. 422s 422s Original error was: No module named 'numpy.core._multiarray_umath' 422s 422s 422s The above exception was the direct cause of the following exception: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_MaskPrimers.py", line 17, in 422s from presto.Sequence import getDNAScoreDict, localAlignment, scoreAlignment, extractAlignment, \ 422s maskSeq, PrimerAlignment 422s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 422s import numpy as np 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 422s raise ImportError(msg) from e 422s ImportError: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_Sequence (unittest.loader._FailedTest.tests.test_Sequence) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_Sequence 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 24, in 422s from . import multiarray 422s File "/usr/lib/python3/dist-packages/numpy/core/multiarray.py", line 10, in 422s from . import overrides 422s File "/usr/lib/python3/dist-packages/numpy/core/overrides.py", line 8, in 422s from numpy.core._multiarray_umath import ( 422s add_docstring, _get_implementing_args, _ArrayFunctionDispatcher) 422s ModuleNotFoundError: No module named 'numpy.core._multiarray_umath' 422s 422s During handling of the above exception, another exception occurred: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 130, in 422s from numpy.__config__ import show as show_config 422s File "/usr/lib/python3/dist-packages/numpy/__config__.py", line 4, in 422s from numpy.core._multiarray_umath import ( 422s ...<3 lines>... 422s ) 422s File "/usr/lib/python3/dist-packages/numpy/core/__init__.py", line 50, in 422s raise ImportError(msg) 422s ImportError: 422s 422s IMPORTANT: PLEASE READ THIS FOR ADVICE ON HOW TO SOLVE THIS ISSUE! 422s 422s Importing the numpy C-extensions failed. This error can happen for 422s many reasons, often due to issues with your setup or how NumPy was 422s installed. 422s 422s We have compiled some common reasons and troubleshooting tips at: 422s 422s https://numpy.org/devdocs/user/troubleshooting-importerror.html 422s 422s Please note and check the following: 422s 422s * The Python version is: Python3.13 from "/usr/bin/python3.13" 422s * The NumPy version is: "1.26.4" 422s 422s and make sure that they are the versions you expect. 422s Please carefully study the documentation linked above for further help. 422s 422s Original error was: No module named 'numpy.core._multiarray_umath' 422s 422s 422s The above exception was the direct cause of the following exception: 422s 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_Sequence.py", line 18, in 422s from presto.Sequence import getDNAScoreDict, scoreDNA, scoreSeqPair, weightSeq, \ 422s calculateSetError, meanQuality, filterQuality 422s File "/usr/lib/python3/dist-packages/presto/Sequence.py", line 11, in 422s import numpy as np 422s File "/usr/lib/python3/dist-packages/numpy/__init__.py", line 135, in 422s raise ImportError(msg) from e 422s ImportError: Error importing numpy: you should not try to import numpy from 422s its source directory; please exit the numpy source tree, and relaunch 422s your python interpreter from there. 422s 422s 422s ====================================================================== 422s ERROR: tests.test_UnifyHeaders (unittest.loader._FailedTest.tests.test_UnifyHeaders) 422s ---------------------------------------------------------------------- 422s ImportError: Failed to import test module: tests.test_UnifyHeaders 422s Traceback (most recent call last): 422s File "/usr/lib/python3.13/unittest/loader.py", line 396, in _find_test_path 422s module = self._get_module_from_name(name) 422s File "/usr/lib/python3.13/unittest/loader.py", line 339, in _get_module_from_name 422s __import__(name) 422s ~~~~~~~~~~^^^^^^ 422s File "/tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build/tests/test_UnifyHeaders.py", line 16, in 422s from presto.Multiprocessing import SeqData 422s File "/usr/lib/python3/dist-packages/presto/Multiprocessing.py", line 16, in 422s from Bio import SeqIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/__init__.py", line 401, in 422s from Bio.SeqIO import TwoBitIO 422s File "/usr/lib/python3/dist-packages/Bio/SeqIO/TwoBitIO.py", line 80, in 422s raise MissingPythonDependencyError( 422s ...<2 lines>... 422s ) from None 422s Bio.MissingPythonDependencyError: Install NumPy if you want to use Bio.SeqIO with TwoBit files.See http://www.numpy.org/ 422s 422s 422s ---------------------------------------------------------------------- 422s Ran 13 tests in 0.001s 422s 422s FAILED (errors=9) 422s E: pybuild pybuild:389: test: plugin distutils failed with: exit code=1: cd /tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build; python3.13 -m unittest discover -v 422s I: pybuild pybuild:308: cp -r /tmp/autopkgtest.Ym1phs/build.hfa/src/bin /tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build; rm /tmp/autopkgtest.Ym1phs/build.hfa/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 422s rm: cannot remove '/tmp/autopkgtest.Ym1phs/build.hfa/src/tests/test_ClusterSets.py': No such file or directory 422s Test file already removed or moved 422s I: pybuild base:311: cd /tmp/autopkgtest.Ym1phs/autopkgtest_tmp/build; python3.12 -m unittest discover -v 423s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 423s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 423s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 423s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 423s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 423s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 423s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 423s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 423s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 423s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 423s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok 423s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 423s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 423s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 423s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 423s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 423s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok 423s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 423s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 423s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 423s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 423s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 423s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... /usr/lib/python3/dist-packages/Bio/SeqRecord.py:228: BiopythonDeprecationWarning: Using a string as the sequence is deprecated and will raise a TypeError in future. It has been converted to a Seq object. 423s warnings.warn( 423s ok 423s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 423s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 423s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 423s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 423s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... -> test_collapseAnnotation() 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 423s <- test_collapseAnnotation() 0.000 423s -> test_getCoordKey() 423s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 423s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 423s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 423s <- test_getCoordKey() 0.000 423s -> test_mergeAnnotation() 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 423s <- test_mergeAnnotation() 0.000 423s -> test_renameAnnotation() 423s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 423s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 423s <- test_renameAnnotation() 0.000 423s -> test_calculateSetError() 423s Frequency consensus error> 423s REF> CGGCGTAA 423s SEQ1> CGGCGTAA 423s SEQ2> CCNNGTAA 423s SEQ3> CGGC--TA 423s SEQ4> CGNN--TA 423s SEQ5> CGGC--AA 423s ERROR> 0.250000 423s Quality consensus error> 423s REF> CGGCNNAA 423s SEQ1> CGGCGTAA 423s SEQ2> CCNNGTAA 423s SEQ3> CGGC--TA 423s SEQ4> CGNN--TA 423s SEQ5> CGGC--AA 423s ERROR> 0.233333 423s <- test_calculateSetError() 0.000 423s -> test_deleteSeqPositions() 423s MAX_GAP=0.4> CGGCAA 423s MAX_GAP=0.8> CGGCGTAA 423s <- test_deleteSeqPositions() 0.000 423s -> test_findGapPositions() 423s MAX_GAP=0.4> [4, 5] 423s MAX_GAP=0.8> [] 423s <- test_findGapPositions() 0.000 423s -> test_frequencyConsensus() 423s MIN_FREQ=0.2> CGGCGTAA 423s MIN_FREQ=0.8> CGGCGTNA 423s <- test_frequencyConsensus() 0.000 423s -> test_qualityConsensus() 423s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 423s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 423s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 423s <- test_qualityConsensus() 0.000 423s -> test_checkSeqEqual() 423s DNA Equality> 423s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 423s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 423s EQUAL> True 423s 423s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 423s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 423s EQUAL> False 423s 423s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 423s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 423s EQUAL> True 423s 423s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 423s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 423s EQUAL> False 423s 423s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 423s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 423s EQUAL> True 423s 423s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 423s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 423s EQUAL> True 423s 423s <- test_checkSeqEqual() 0.000 423s -> test_convert454Header() 423s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 423s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 423s <- test_convert454Header() 0.000 423s -> test_convertGenbankHeader() 423s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 423s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 423s <- test_convertGenbankHeader() 0.000 423s -> test_convertGenericHeader() 423s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 423s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 423s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 423s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 423s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 423s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 423s <- test_convertGenericHeader() 0.000 423s -> test_convertIMGTHeader() 423s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 423s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 423s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 423s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 423s OrderedDict({'ID': 'IGHV1-18*01'}) 423s OrderedDict({'ID': 'IGHV1-69*07'}) 423s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 423s OrderedDict({'ID': 'TRAV11*01'}) 423s <- test_convertIMGTHeader() 0.000 423s -> test_convertIlluminaHeader() 423s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 423s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 423s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 423s <- test_convertIlluminaHeader() 0.000 423s -> test_convertSRAHeader() 423s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 423s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 423s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 423s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 423s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 423s <- test_convertSRAHeader() 0.000 423s -> test_calculateDistances() 423s <- test_calculateDistances() 0.001 423s -> test_countMismatches() 423s <- test_countMismatches() 0.001 423s -> test_initializeMismatchDictionary() 423s <- test_initializeMismatchDictionary() 0.000 423s -> test_getFileType() 423s <- test_getFileType() 0.000 423s -> test_extractAlignment() 423s SEQ1> 423s SEQ> CCACGTTTTAGTAATTAATA 423s ALN-SEQ> CCACGTTTTAGT 423s ALN-PR> ----GTTTTAGT 423s PRIMER> GTTTTAGT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ2> 423s SEQ> CCNCGTTTTAGTAATTAATA 423s ALN-SEQ> CCNCGTTTTAGT 423s ALN-PR> ----GTTTTAGT 423s PRIMER> GTTTTAGT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ3> 423s SEQ> GGGCGTTTTAGTAATTAATA 423s ALN-SEQ> GGGCGTTTTAGT 423s ALN-PR> ----GTTTTAGT 423s PRIMER> GTTTTAGT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ4> 423s SEQ> GGNNGTTTTACTAATTAATA 423s ALN-SEQ> GGNNGTTTTACT 423s ALN-PR> ----GTTTTACT 423s PRIMER> GTTTTACT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ5> 423s SEQ> NNGCNNNNNACTAATTAATA 423s ALN-SEQ> NNGCNNNNNACT 423s ALN-PR> ----NNNNNACT 423s PRIMER> NNNNNACT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ6> 423s SEQ> GGGATANNNACTAATTAATA 423s ALN-SEQ> GGGATANNNACT 423s ALN-PR> ----TANNNACT 423s PRIMER> TANNNACT 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ7> 423s SEQ> NNNNNNNNNNNNNNNNNNNN 423s ALN-SEQ> NNNNNNNNNNNN 423s ALN-PR> ----NNNNNNNN 423s PRIMER> NNNNNNNN 423s START> 4 423s END> 12 423s GAPS> 0 423s ERROR> 0.000000 423s 423s <- test_extractAlignment() 0.000 423s -> test_localAlignment() 423s TEST Ns> 423s SEQ1> 423s SEQ> CCACGTTTTAGTAATTAATA 423s ALN-SEQ> CCACGTTTTAGTAATTAATA 423s ALN-PR> -CACGTTTT----------- 423s PRIMER> PR1 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ2> 423s SEQ> CCNCGTTTTAGTAATTAATA 423s ALN-SEQ> CCNCGTTTTAGTAATTAATA 423s ALN-PR> -CACGTTTT----------- 423s PRIMER> PR1 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.125000 423s 423s SEQ3> 423s SEQ> GGGCGTTTTAGTAATTAATA 423s ALN-SEQ> GGGCGTTTTAGTAATTAATA 423s ALN-PR> -GGCGTTTT----------- 423s PRIMER> PR2 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ4> 423s SEQ> GGNNGTTTTACTAATTAATA 423s ALN-SEQ> GGNNGTTTTACTAATTAATA 423s ALN-PR> GGC-GTTTT----------- 423s PRIMER> PR2 423s START> 0 423s END> 9 423s GAPS> 1 423s ERROR> 0.250000 423s ok 423s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 423s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 423s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 423s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 423s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 423s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 423s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... 423s SEQ5> 423s SEQ> NNGCNNNNNACTAATTAATA 423s ALN-SEQ> NNGCNNNNNACTAATTAATA 423s ALN-PR> ------------ANATAA-- 423s PRIMER> PR3 423s START> 12 423s END> 18 423s GAPS> 0 423s ERROR> 0.375000 423s 423s SEQ6> 423s SEQ> GGGATANNNACTAATTAATA 423s ALN-SEQ> GGGATANNNACTAATTAATA 423s ALN-PR> -GGANA-------------- 423s PRIMER> PR3 423s START> 1 423s END> 6 423s GAPS> 0 423s ERROR> 0.375000 423s 423s SEQ7> 423s SEQ> NNNNNNNNNNNNNNNNNNNN 423s ALN-SEQ> None 423s ALN-PR> None 423s PRIMER> None 423s START> None 423s END> None 423s GAPS> 0 423s ERROR> 1.000000 423s 423s TEST INDELS> 423s SEQ1> 423s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 423s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 423s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 423s PRIMER> PR1 423s START> 15 423s END> 38 423s GAPS> 0 423s ERROR> 0.083333 423s 423s SEQ2> 423s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 423s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 423s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 423s PRIMER> PR1 423s START> 14 423s END> 38 423s GAPS> 2 423s ERROR> 0.208333 423s 423s SEQ3> 423s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 423s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 423s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 423s PRIMER> PR1 423s START> 15 423s END> 38 423s GAPS> 1 423s ERROR> 0.125000 423s 423s SEQ4> 423s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 423s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 423s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 423s PRIMER> PR2 423s START> 6 423s END> 19 423s GAPS> 1 423s ERROR> 0.250000 423s 423s SEQ5> 423s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 423s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 423s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 423s PRIMER> PR2 423s START> 6 423s END> 18 423s GAPS> 0 423s ERROR> 0.166667 423s 423s SEQ6> 423s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 423s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 423s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 423s PRIMER> PR2 423s START> 0 423s END> 11 423s GAPS> 1 423s ERROR> 0.250000 423s 423s SEQ7> 423s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 423s PRIMER> PR3 423s START> 2 423s END> 15 423s GAPS> 1 423s ERROR> 0.083333 423s 423s SEQ8> 423s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 423s PRIMER> PR3 423s START> 3 423s END> 15 423s GAPS> 1 423s ERROR> 0.166667 423s 423s SEQ9> 423s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 423s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 423s PRIMER> PR3 423s START> 3 423s END> 15 423s GAPS> 1 423s ERROR> 0.333333 423s 423s SEQ10> 423s SEQ> -------------------------------------------------------------- 423s ALN-SEQ> None 423s ALN-PR> None 423s PRIMER> None 423s START> None 423s END> None 423s GAPS> 0 423s ERROR> 1.000000 423s 423s <- test_localAlignment() 0.024 423s -> test_maskSeq() 423s TEST CUT> 423s ID> SEQ|PRIMER=A|BARCODE=CCA 423s SEQ> AGTAATTAATA 423s 423s TEST MASK> 423s ID> SEQ|PRIMER=A|BARCODE=CCA 423s SEQ> NNNNNNAGTAATTAATA 423s 423s TEST TRIM> 423s ID> SEQ|PRIMER=A|BARCODE=CCA 423s SEQ> CGTTTTAGTAATTAATA 423s 423s TEST TAG> 423s ID> SEQ|PRIMER=A|BARCODE=CCA 423s SEQ> CCACGTTTTAGTAATTAATA 423s 423s <- test_maskSeq() 0.001 423s -> test_scoreAlignment() 423s SEQ1> 423s SEQ> CCACGTTTTAGTAATTAATA 423s ALN-SEQ> CCACGTTTT 423s ALN-PR> -CACGTTTT 423s PRIMER> PR1 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ2> 423s SEQ> CCNCGTTTTAGTAATTAATA 423s ALN-SEQ> CCNCGTTTT 423s ALN-PR> -CACGTTTT 423s PRIMER> PR1 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.125000 423s 423s SEQ3> 423s SEQ> GGGCGTTTTAGTAATTAATA 423s ALN-SEQ> GGGCGTTTT 423s ALN-PR> -GGCGTTTT 423s PRIMER> PR2 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.000000 423s 423s SEQ4> 423s SEQ> GGNNGTTTTACTAATTAATA 423s ALN-SEQ> GGNNGTTTT 423s ALN-PR> -GGCGTTTT 423s PRIMER> PR2 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.250000 423s 423s SEQ5> 423s SEQ> NNGCNNNNNACTAATTAATA 423s ALN-SEQ> NNGCNNNNN 423s ALN-PR> -GGCGTTTT 423s PRIMER> PR2 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.750000 423s 423s SEQ6> 423s SEQ> GGGATANNNACTAATTAATA 423s ALN-SEQ> GGGATANNN 423s ALN-PR> -GGANATAA 423s PRIMER> PR3 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 0.375000 423s 423s SEQ7> 423s SEQ> NNNNNNNNNNNNNNNNNNNN 423s ALN-SEQ> NNNNNNNNN 423s ALN-PR> -CACGTTTT 423s PRIMER> None 423s START> 1 423s END> 9 423s GAPS> 0 423s ERROR> 1.000000 423s 423s <- test_scoreAlignment() 0.008 423s -> test_calculateSetError() 423s REF> CGGCGTAA 0.4347826086956522 423s REF> NNNNNNNN 1.0 423s <- test_calculateSetError() 0.000 423s -> test_filterQuality() 423s RESULT> True 25 423s RESULT> False 5 423s RESULT> False 0 423s <- test_filterQuality() 0.000 423s -> test_meanQuality() 423s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 423s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 423s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 423s <- test_meanQuality() 0.000 423s -> test_scoreDNA() 423s Default DNA Scores> 423s A==A> 1 423s A==T> 0 423s A==R> 1 423s U==T> 1 423s A==N> 1 423s N==A> 1 423s A==-> 0 423s -==A> 0 423s Symmetric DNA Scores> 423s A==A> 1 423s A==T> 0 423s A==R> 1 423s U==T> 1 423s A==N> 1 423s N==A> 1 423s A==-> 1 423s -==A> 1 423s Asymmetric DNA Scores> 423s A==A> 1 423s A==T> 0 423s A==R> 1 423s U==T> 1 423s A==N> 1 423s N==A> 0 423s A==-> 1 423s -==A> 0 423s <- test_scoreDNA() 0.000 423s -> test_scoreSeqPair() 423s Default DNA Scores> 423s SEQ1> CGGCGTAA 423s SEQ2> CGNNGTAG 423s SCORE> 7 423s WEIGHT> 8 423s ERROR> 0.125000 423s 423s SEQ1> CGGCGTAA 423s SEQ3> CGGC--AA 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ1> CGGCGTAA 423s SEQ4> CGNN--AG 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ1> CGGCGTAA 423s SEQ5> NNNNNNNN 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ6> NNNNNNAA 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ2> CGNNGTAG 423s SEQ3> CGGC--AA 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ2> CGNNGTAG 423s SEQ4> CGNN--AG 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ2> CGNNGTAG 423s SEQ5> NNNNNNNN 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ2> CGNNGTAG 423s SEQ6> NNNNNNAA 423s SCORE> 7 423s WEIGHT> 8 423s ERROR> 0.125000 423s 423s SEQ2> CGNNGTAG 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ2> CGNNGTAG 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ3> CGGC--AA 423s SEQ4> CGNN--AG 423s SCORE> 7 423s WEIGHT> 8 423s ERROR> 0.125000 423s 423s SEQ3> CGGC--AA 423s SEQ5> NNNNNNNN 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ6> NNNNNNAA 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ7> -------- 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ3> CGGC--AA 423s SEQ8> CG------ 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ4> CGNN--AG 423s SEQ5> NNNNNNNN 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ4> CGNN--AG 423s SEQ6> NNNNNNAA 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ4> CGNN--AG 423s SEQ7> -------- 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ4> CGNN--AG 423s SEQ8> CG------ 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ5> NNNNNNNN 423s SEQ6> NNNNNNAA 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ6> NNNNNNAA 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ6> NNNNNNAA 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ7> -------- 423s SEQ8> CG------ 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s Asymmetric DNA Scores> 423s SEQ1> CGGCGTAA 423s SEQ2> CGNNGTAG 423s SCORE> 7 423s WEIGHT> 8 423s ERROR> 0.125000 423s 423s SEQ1> CGGCGTAA 423s SEQ3> CGGC--AA 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ4> CGNN--AG 423s SCORE> 7 423s WEIGHT> 8 423s ERROR> 0.125000 423s 423s SEQ1> CGGCGTAA 423s SEQ5> NNNNNNNN 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ6> NNNNNNAA 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ7> -------- 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ8> CG------ 423s SCORE> 8 423s WEIGHT> 8 423s ERROR> 0.000000 423s 423s SEQ2> CGNNGTAG 423s SEQ3> CGGC--AA 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ2> CGNNGTAG 423s SEQ4> CGNN--AG 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ2> CGNNGTAG 423s SEQ5> NNNNNNNN 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ2> CGNNGTAG 423s SEQ6> NNNNNNAA 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ2> CGNNGTAG 423s SEQ7> -------- 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ2> CGNNGTAG 423s SEQ8> CG------ 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ4> CGNN--AG 423s SCORE> 5 423s WEIGHT> 8 423s ERROR> 0.375000 423s 423s SEQ3> CGGC--AA 423s SEQ5> NNNNNNNN 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ6> NNNNNNAA 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ7> -------- 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ3> CGGC--AA 423s SEQ8> CG------ 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ4> CGNN--AG 423s SEQ5> NNNNNNNN 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ4> CGNN--AG 423s SEQ6> NNNNNNAA 423s SCORE> 3 423s WEIGHT> 8 423s ERROR> 0.625000 423s 423s SEQ4> CGNN--AG 423s SEQ7> -------- 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ4> CGNN--AG 423s SEQ8> CG------ 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ5> NNNNNNNN 423s SEQ6> NNNNNNAA 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ8> CG------ 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ6> NNNNNNAA 423s SEQ7> -------- 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ6> NNNNNNAA 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ7> -------- 423s SEQ8> CG------ 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s Masked DNA Scores> 423s SEQ1> CGGCGTAA 423s SEQ2> CGNNGTAG 423s SCORE> 5 423s WEIGHT> 6 423s ERROR> 0.166667 423s 423s SEQ1> CGGCGTAA 423s SEQ3> CGGC--AA 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s SEQ1> CGGCGTAA 423s SEQ4> CGNN--AG 423s SCORE> 3 423s WEIGHT> 6 423s ERROR> 0.500000 423s 423s SEQ1> CGGCGTAA 423s SEQ5> NNNNNNNN 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ6> NNNNNNAA 423s SCORE> 2 423s WEIGHT> 2 423s ERROR> 0.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 8 423s ERROR> 1.000000 423s 423s SEQ1> CGGCGTAA 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ2> CGNNGTAG 423s SEQ3> CGGC--AA 423s SCORE> 3 423s WEIGHT> 6 423s ERROR> 0.500000 423s 423s SEQ2> CGNNGTAG 423s SEQ4> CGNN--AG 423s SCORE> 4 423s WEIGHT> 6 423s ERROR> 0.333333 423s 423s SEQ2> CGNNGTAG 423s SEQ5> NNNNNNNN 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ2> CGNNGTAG 423s SEQ6> NNNNNNAA 423s SCORE> 1 423s WEIGHT> 2 423s ERROR> 0.500000 423s 423s SEQ2> CGNNGTAG 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 6 423s ERROR> 1.000000 423s 423s SEQ2> CGNNGTAG 423s SEQ8> CG------ 423s SCORE> 2 423s WEIGHT> 6 423s ERROR> 0.666667 423s 423s SEQ3> CGGC--AA 423s SEQ4> CGNN--AG 423s SCORE> 5 423s WEIGHT> 6 423s ERROR> 0.166667 423s 423s SEQ3> CGGC--AA 423s SEQ5> NNNNNNNN 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ3> CGGC--AA 423s SEQ6> NNNNNNAA 423s SCORE> 2 423s WEIGHT> 2 423s ERROR> 0.000000 423s 423s SEQ3> CGGC--AA 423s SEQ7> -------- 423s SCORE> 2 423s WEIGHT> 8 423s ERROR> 0.750000 423s 423s SEQ3> CGGC--AA 423s SEQ8> CG------ 423s SCORE> 4 423s WEIGHT> 8 423s ERROR> 0.500000 423s 423s SEQ4> CGNN--AG 423s SEQ5> NNNNNNNN 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ4> CGNN--AG 423s SEQ6> NNNNNNAA 423s SCORE> 1 423s WEIGHT> 2 423s ERROR> 0.500000 423s 423s SEQ4> CGNN--AG 423s SEQ7> -------- 423s SCORE> 2 423s WEIGHT> 6 423s ERROR> 0.666667 423s 423s SEQ4> CGNN--AG 423s SEQ8> CG------ 423s SCORE> 4 423s WEIGHT> 6 423s ERROR> 0.333333 423s 423s SEQ5> NNNNNNNN 423s SEQ6> NNNNNNAA 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ5> NNNNNNNN 423s SEQ8> CG------ 423s SCORE> 0 423s WEIGHT> 0 423s ERROR> 1.000000 423s 423s SEQ6> NNNNNNAA 423s SEQ7> -------- 423s SCORE> 0 423s WEIGHT> 2 423s ERROR> 1.000000 423s 423s SEQ6> NNNNNNAA 423s SEQ8> CG------ 423s SCORE> 0 423s WEIGHT> 2 423s ERROR> 1.000000 423s 423s SEQ7> -------- 423s SEQ8> CG------ 423s SCORE> 6 423s WEIGHT> 8 423s ERROR> 0.250000 423s 423s <- test_scoreSeqPair() 0.006 423s -> test_weightDNA() 423s DNA Weight> 423s SEQ1> 8 423s SEQ2> 6 423s SEQ3> 8 423s SEQ4> 6 423s SEQ5> 0 423s SEQ6> 2 423s SEQ7> 8 423s SEQ8> 8 423s AA Weight> 423s SEQ1> 8 423s SEQ2> 6 423s SEQ3> 8 423s SEQ4> 6 423s <- test_weightDNA() 0.000 423s -> test_consensusUnify() 423s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 423s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 423s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 423s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 423s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 423s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 423s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 423s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 423s <- test_consensusUnify() 0.000 423s -> test_deletionUnify() 423s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 423s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 423s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 423s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 423s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 423s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 423s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 423s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 423s <- test_deletionUnify() 0.000 423s ok 423s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok 423s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 423s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 423s 423s ---------------------------------------------------------------------- 423s Ran 38 tests in 0.048s 423s 423s OK (skipped=6) 423s pybuild-autopkgtest: error: pybuild --autopkgtest -i python{version} -p "3.13 3.12" returned exit code 13 423s make: *** [/tmp/lqDsirsmAc/run:4: pybuild-autopkgtest] Error 25 423s pybuild-autopkgtest: error: /tmp/lqDsirsmAc/run pybuild-autopkgtest returned exit code 2 423s autopkgtest [10:13:37]: test pybuild-autopkgtest: -----------------------] 424s autopkgtest [10:13:38]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 424s pybuild-autopkgtest FAIL non-zero exit status 25 424s autopkgtest [10:13:38]: @@@@@@@@@@@@@@@@@@@@ summary 424s pybuild-autopkgtest FAIL non-zero exit status 25 438s virt: nova [W] Skipping flock for amd64 438s virt: Creating nova instance adt-plucky-amd64-presto-20241113-092229-juju-7f2275-prod-proposed-migration-environment-2-9d427c20-d0f6-460a-a33a-b7c55a5b2208 from image adt/ubuntu-plucky-amd64-server-20241113.img (UUID 76b850f9-98f4-4b79-af06-fa11000b95b2)...