0s autopkgtest [15:19:38]: starting date and time: 2024-03-21 15:19:38+0000 0s autopkgtest [15:19:38]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [15:19:38]: host juju-7f2275-prod-proposed-migration-environment-3; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.w_uiuy_p/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.0.13-0ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-3@bos02-s390x-9.secgroup --name adt-noble-s390x-seqkit-20240321-151938-juju-7f2275-prod-proposed-migration-environment-3 --image adt/ubuntu-noble-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-3 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 178s autopkgtest [15:22:36]: testbed dpkg architecture: s390x 179s autopkgtest [15:22:37]: testbed apt version: 2.7.12 179s autopkgtest [15:22:37]: @@@@@@@@@@@@@@@@@@@@ test bed setup 179s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 180s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3775 kB] 181s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 181s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [53.9 kB] 181s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [495 kB] 181s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main s390x Packages [662 kB] 181s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main s390x c-n-f Metadata [3032 B] 181s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x Packages [1372 B] 181s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x c-n-f Metadata [116 B] 181s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x Packages [3985 kB] 181s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x c-n-f Metadata [7292 B] 181s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x Packages [45.1 kB] 181s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x c-n-f Metadata [116 B] 183s Fetched 9151 kB in 3s (3274 kB/s) 183s Reading package lists... 186s Reading package lists... 186s Building dependency tree... 186s Reading state information... 186s Calculating upgrade... 186s The following packages will be REMOVED: 186s libssl3 186s The following NEW packages will be installed: 186s libssl3t64 186s The following packages will be upgraded: 186s debianutils openssl 186s 2 upgraded, 1 newly installed, 1 to remove and 0 not upgraded. 186s Need to get 2775 kB of archives. 186s After this operation, 240 kB of additional disk space will be used. 186s Get:1 http://ftpmaster.internal/ubuntu noble/main s390x debianutils s390x 5.17 [90.1 kB] 187s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssl s390x 3.0.13-0ubuntu2 [1010 kB] 187s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libssl3t64 s390x 3.0.13-0ubuntu2 [1675 kB] 187s Fetched 2775 kB in 1s (3574 kB/s) 188s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52171 files and directories currently installed.) 188s Preparing to unpack .../debianutils_5.17_s390x.deb ... 188s Unpacking debianutils (5.17) over (5.16) ... 188s Setting up debianutils (5.17) ... 188s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52171 files and directories currently installed.) 188s Preparing to unpack .../openssl_3.0.13-0ubuntu2_s390x.deb ... 188s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 188s dpkg: libssl3:s390x: dependency problems, but removing anyway as you requested: 188s wget depends on libssl3 (>= 3.0.0). 188s tnftp depends on libssl3 (>= 3.0.0). 188s tcpdump depends on libssl3 (>= 3.0.0). 188s systemd-resolved depends on libssl3 (>= 3.0.0). 188s systemd depends on libssl3 (>= 3.0.0). 188s sudo depends on libssl3 (>= 3.0.0). 188s s390-tools depends on libssl3 (>= 3.0.0). 188s rsync depends on libssl3 (>= 3.0.0). 188s python3-cryptography depends on libssl3 (>= 3.0.0). 188s openssh-server depends on libssl3 (>= 3.0.10). 188s openssh-client depends on libssl3 (>= 3.0.10). 188s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 188s libsystemd-shared:s390x depends on libssl3 (>= 3.0.0). 188s libssh-4:s390x depends on libssl3 (>= 3.0.0). 188s libsasl2-modules:s390x depends on libssl3 (>= 3.0.0). 188s libsasl2-2:s390x depends on libssl3 (>= 3.0.0). 188s libpython3.12-minimal:s390x depends on libssl3 (>= 3.0.0). 188s libpython3.11-minimal:s390x depends on libssl3 (>= 3.0.0). 188s libnvme1 depends on libssl3 (>= 3.0.0). 188s libkrb5-3:s390x depends on libssl3 (>= 3.0.0). 188s libkmod2:s390x depends on libssl3 (>= 3.0.0). 188s libfido2-1:s390x depends on libssl3 (>= 3.0.0). 188s libcurl4:s390x depends on libssl3 (>= 3.0.0). 188s libcryptsetup12:s390x depends on libssl3 (>= 3.0.0). 188s kmod depends on libssl3 (>= 3.0.0). 188s dhcpcd-base depends on libssl3 (>= 3.0.0). 188s bind9-libs:s390x depends on libssl3 (>= 3.0.0). 188s 188s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52171 files and directories currently installed.) 188s Removing libssl3:s390x (3.0.10-1ubuntu4) ... 188s Selecting previously unselected package libssl3t64:s390x. 188s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52160 files and directories currently installed.) 188s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_s390x.deb ... 188s Unpacking libssl3t64:s390x (3.0.13-0ubuntu2) ... 188s Setting up libssl3t64:s390x (3.0.13-0ubuntu2) ... 188s Setting up openssl (3.0.13-0ubuntu2) ... 188s Processing triggers for man-db (2.12.0-3) ... 189s Processing triggers for libc-bin (2.39-0ubuntu2) ... 189s Reading package lists... 189s Building dependency tree... 189s Reading state information... 189s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 190s Unknown architecture, assuming PC-style ttyS0 190s sh: Attempting to set up Debian/Ubuntu apt sources automatically 190s sh: Distribution appears to be Ubuntu 191s Reading package lists... 191s Building dependency tree... 191s Reading state information... 191s eatmydata is already the newest version (131-1). 191s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 191s Reading package lists... 191s Building dependency tree... 191s Reading state information... 191s dbus is already the newest version (1.14.10-4ubuntu1). 191s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 191s Reading package lists... 191s Building dependency tree... 191s Reading state information... 192s rng-tools-debian is already the newest version (2.4). 192s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 192s Reading package lists... 192s Building dependency tree... 192s Reading state information... 192s The following packages will be REMOVED: 192s cloud-init* python3-configobj* python3-debconf* 192s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 192s After this operation, 3252 kB disk space will be freed. 192s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52173 files and directories currently installed.) 192s Removing cloud-init (24.1.1-0ubuntu1) ... 193s Removing python3-configobj (5.0.8-3) ... 193s Removing python3-debconf (1.5.86) ... 193s Processing triggers for man-db (2.12.0-3) ... 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 51784 files and directories currently installed.) 193s Purging configuration files for cloud-init (24.1.1-0ubuntu1) ... 194s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 194s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 194s invoke-rc.d: policy-rc.d denied execution of try-restart. 194s Reading package lists... 194s Building dependency tree... 194s Reading state information... 194s linux-generic is already the newest version (6.8.0-11.11+1). 194s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 195s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 195s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 195s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 196s Reading package lists... 196s Reading package lists... 197s Building dependency tree... 197s Reading state information... 197s Calculating upgrade... 197s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 197s Reading package lists... 197s Building dependency tree... 197s Reading state information... 197s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 197s autopkgtest [15:22:55]: rebooting testbed after setup commands that affected boot 215s autopkgtest [15:23:13]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Tue Feb 13 23:45:46 UTC 2024 218s autopkgtest [15:23:16]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 223s Get:1 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (dsc) [2502 B] 223s Get:2 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (tar) [16.4 MB] 223s Get:3 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (diff) [10.8 MB] 224s gpgv: Signature made Mon Dec 25 17:00:09 2023 UTC 224s gpgv: using EDDSA key A095B66EE09024BEE6A2F0722A27904BD7243EDA 224s gpgv: Can't check signature: No public key 224s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.3.1+ds-2.dsc: no acceptable signature found 226s autopkgtest [15:23:24]: testing package seqkit version 2.3.1+ds-2 228s autopkgtest [15:23:26]: build not needed 231s autopkgtest [15:23:29]: test run-unit-test: preparing testbed 236s Reading package lists... 236s Building dependency tree... 236s Reading state information... 237s Starting pkgProblemResolver with broken count: 0 237s Starting 2 pkgProblemResolver with broken count: 0 237s Done 237s The following additional packages will be installed: 237s seqkit seqkit-examples ssshtest 237s The following NEW packages will be installed: 237s autopkgtest-satdep seqkit seqkit-examples ssshtest 237s 0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded. 237s Need to get 47.6 MB/47.6 MB of archives. 237s After this operation, 57.2 MB of additional disk space will be used. 237s Get:1 /tmp/autopkgtest.Y9PgYc/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [728 B] 237s Get:2 http://ftpmaster.internal/ubuntu noble/universe s390x seqkit s390x 2.3.1+ds-2 [7895 kB] 238s Get:3 http://ftpmaster.internal/ubuntu noble/universe s390x seqkit-examples all 2.3.1+ds-2 [39.7 MB] 241s Get:4 http://ftpmaster.internal/ubuntu noble/universe s390x ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 241s Fetched 47.6 MB in 4s (12.9 MB/s) 241s Selecting previously unselected package seqkit. 241s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 51729 files and directories currently installed.) 241s Preparing to unpack .../seqkit_2.3.1+ds-2_s390x.deb ... 241s Unpacking seqkit (2.3.1+ds-2) ... 241s Selecting previously unselected package seqkit-examples. 241s Preparing to unpack .../seqkit-examples_2.3.1+ds-2_all.deb ... 241s Unpacking seqkit-examples (2.3.1+ds-2) ... 241s Selecting previously unselected package ssshtest. 241s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 241s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 241s Selecting previously unselected package autopkgtest-satdep. 241s Preparing to unpack .../1-autopkgtest-satdep.deb ... 241s Unpacking autopkgtest-satdep (0) ... 241s Setting up seqkit (2.3.1+ds-2) ... 241s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 241s Setting up seqkit-examples (2.3.1+ds-2) ... 241s Setting up autopkgtest-satdep (0) ... 241s Processing triggers for man-db (2.12.0-3) ... 244s (Reading database ... 51813 files and directories currently installed.) 244s Removing autopkgtest-satdep (0) ... 244s autopkgtest [15:23:42]: test run-unit-test: [----------------------- 245s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 246s 246s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 246s PASS "28645" == "28645" (LINE 28) 246s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 246s 246s seq_type ran in 0 sec with 2/0 lines to STDERR/OUT 246s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 246s 246s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 246s PASS STDOUT CONTAINS "Protein" (LINE 42) 246s 246s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 246s PASS STDOUT CONTAINS "RNA" (LINE 48) 246s 246s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 246s PASS STDOUT CONTAINS "DNA" (LINE 54) 246s 246s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 246s PASS STDOUT CONTAINS "DNA" (LINE 60) 246s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 246s 246s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 246s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 246s 246s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 246s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 247s 247s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 247s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 247s 247s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 247s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 247s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 247s 247s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 247s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 247s 247s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 247s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 247s 247s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 247s PASS "a" == "a" (LINE 117) 247s 247s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 247s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 247s 247s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 247s PASS "gtn" == "gtn" (LINE 129) 247s 247s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 247s PASS "ACG" == "ACG" (LINE 135) 247s 247s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 247s PASS "N" == "N" (LINE 141) 247s 247s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 247s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 247s 247s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 247s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 247s 247s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 247s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 247s 247s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 247s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 247s 247s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 247s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 249s 249s fx2tab_tab2fx ran in 2 sec with 0/92461 lines to STDERR/OUT 249s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 249s 249s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 249s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 249s [ERRO] xopen: no content 249s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 249s 249s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 249s Length correlation: 249s PASS "1" == "1" (LINE 220) 249s Length correlation: 249s PASS "1" == "1" (LINE 224) 249s Qual correlation: 249s PASS "1" == "1" (LINE 228) 249s 249s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 250s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 250s 250s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 250s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 251s 251s grep_by_list_head100 ran in 1 sec with 1/299 lines to STDERR/OUT 251s PASS "100" == "100" (LINE 249) 251s 251s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 251s PASS "3074" == "3074" (LINE 254) 251s 251s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 251s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 251s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 251s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 251s 251s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 251s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 251s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 251s [INFO] 0 duplicated records removed 251s [INFO] sample by proportion 251s [INFO] 2814 sequences outputted 251s 251s common ran in 0 sec with 5/0 lines to STDERR/OUT 251s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 299) 251s 251s split ran in 0 sec with 104/0 lines to STDERR/OUT 251s [INFO] 0 duplicated records removed 251s PASS "100" == "100" (LINE 316) 252s [INFO] 0 duplicated records removed 252s PASS "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" == "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" (LINE 317) 252s [INFO] sample by proportion 252s [INFO] 2814 sequences outputted 252s [INFO] sample by proportion 252s [INFO] 2814 sequences outputted 252s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 324) 252s 252s head ran in 0 sec with 0/30 lines to STDERR/OUT 252s PASS "10" == "10" (LINE 332) 252s PASS "snq" == "snq" (LINE 341) 252s PASS "seq_2" == "seq_2" (LINE 350) 252s 252s restart ran in 0 sec with 0/2 lines to STDERR/OUT 252s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 252s 252s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 252s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 253s 253s shuffle ran in 1 sec with 20/0 lines to STDERR/OUT 253s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 389) 253s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 253s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 393) 253s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 394) 253s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 395) 254s 254s bam_acc ran in 1 sec with 0/0 lines to STDERR/OUT 254s Correlation: 254s PASS "1" == "1" (LINE 422) 254s 254s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT 254s Correlation: 254s PASS "1" == "1" (LINE 432) 254s 254s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 254s Correlation: 254s PASS "1" == "1" (LINE 442) 254s 254s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 254s Correlation: 254s PASS "1" == "1" (LINE 452) 254s 254s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 254s Correlation: 254s PASS "1" == "1" (LINE 462) 255s 255s bam_left_clip ran in 1 sec with 0/0 lines to STDERR/OUT 255s Correlation: 255s PASS "1" == "1" (LINE 475) 255s 255s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 255s Correlation: 255s PASS "1" == "1" (LINE 488) 256s 256s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 256s PASS "0" == "0" (LINE 498) 256s 256s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 256s PASS EXIT CODE (LINE 516) 256s 256s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 256s PASS "0" == "0" (LINE 530) 256s 256s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 256s PASS "0" == "0" (LINE 541) 256s 256s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 256s PASS "0" == "0" (LINE 549) 256s 256s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 256s PASS "0" == "0" (LINE 557) 259s 259s scat_fasta ran in 3 sec with 239/0 lines to STDERR/OUT 259s tests/sorted_scat_output.fas tests/sorted_scat_test_all.fas differ: byte 904, line 17 259s FAIL "1" != "0" (LINE 606) 259s From file: tests/scat_test_fasta/17065/6471/14214.fas Discarded line: Invalid line structure! 21: >chr11.2373.1.0 259s From file: tests/scat_test_fasta/17065/6471/14214.fas Discarded line: Invalid line structure! 22: CGTCTATGCCACTGTAACACCGGGACCAGTGGTCTTTGACACTTC>GGTGAGGCTGTAGTCACGACAAGGTACGGTGTCAGCATTTCTCAGCGAAGTCCGCCACATGAGGTCGAATCCGGTCGACCGGCCTGTAATTGGATGATTCATATTTAATTAGAAGTCTATCACGGGGGCTGCTGCCCGGCAGGGCAGAATTTTGGGCGCAGTGCCTTGACTAGATGGGCGTGGGGCGGATCTAAGTGCAAGGAAGACAAAAAACTGTTGCGCGGCCACGCATAACTGCAA 259s [INFO] Total stats: Pass records: 108 Discarded lines: 54 259s [INFO] 108 sequences loaded 259s [INFO] sorting ... 259s [INFO] output ... 259s [INFO] read sequences ... 259s [INFO] 48 sequences loaded 259s [INFO] sorting ... 259s [INFO] output ... 259s 259s sshtest v0.1.5 259s 259s TESTING STOPPED ON FIRST FAIL 259s 259s 65 Tests 259s 1 Failures 259s 64 Successes 259s autopkgtest [15:23:57]: test run-unit-test: -----------------------] 260s autopkgtest [15:23:58]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 260s run-unit-test PASS 260s autopkgtest [15:23:58]: @@@@@@@@@@@@@@@@@@@@ summary 260s run-unit-test PASS 272s Creating nova instance adt-noble-s390x-seqkit-20240321-151938-juju-7f2275-prod-proposed-migration-environment-3 from image adt/ubuntu-noble-s390x-server-20240321.img (UUID f7ee8f0f-480f-4014-94f0-3be2a19e259d)...