0s autopkgtest [01:05:11]: starting date and time: 2024-03-27 01:05:11+0000
  0s autopkgtest [01:05:11]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps
  0s autopkgtest [01:05:11]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.qb5e_30u/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=python3-defaults/3.12.2-0ubuntu1 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-s390x-6.secgroup --name adt-noble-s390x-presto-20240327-010510-juju-7f2275-prod-proposed-migration-environment-2-c1e0497b-3450-4b1d-85c0-0c63de4d2562 --image adt/ubuntu-noble-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/
123s autopkgtest [01:07:14]: testbed dpkg architecture: s390x
124s autopkgtest [01:07:15]: testbed apt version: 2.7.12
124s autopkgtest [01:07:15]: @@@@@@@@@@@@@@@@@@@@ test bed setup
125s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB]
125s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [497 kB]
125s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3985 kB]
127s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [55.4 kB]
127s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [8504 B]
127s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main s390x Packages [694 kB]
127s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main s390x c-n-f Metadata [3032 B]
127s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x Packages [1372 B]
127s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x c-n-f Metadata [116 B]
127s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x Packages [4152 kB]
129s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x c-n-f Metadata [7292 B]
129s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x Packages [48.3 kB]
129s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x c-n-f Metadata [116 B]
131s Fetched 9569 kB in 5s (1808 kB/s)
131s Reading package lists...
134s Reading package lists...
134s Building dependency tree...
134s Reading state information...
134s Calculating upgrade...
134s The following packages will be upgraded:
134s   psmisc
135s 1 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
135s Need to get 178 kB of archives.
135s After this operation, 28.7 kB disk space will be freed.
135s Get:1 http://ftpmaster.internal/ubuntu noble/main s390x psmisc s390x 23.7-1 [178 kB]
136s Fetched 178 kB in 1s (203 kB/s)
136s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52170 files and directories currently installed.)
136s Preparing to unpack .../psmisc_23.7-1_s390x.deb ...
136s Unpacking psmisc (23.7-1) over (23.6-2) ...
136s Setting up psmisc (23.7-1) ...
136s Processing triggers for man-db (2.12.0-3) ...
137s Reading package lists...
137s Building dependency tree...
137s Reading state information...
138s 0 upgraded, 0 newly installed, 0 to remove and 244 not upgraded.
138s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease
138s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease
138s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease
138s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease
140s Reading package lists...
140s Reading package lists...
140s Building dependency tree...
140s Reading state information...
141s Calculating upgrade...
141s The following packages were automatically installed and are no longer required:
141s   libaio1 libnetplan0 python3-distutils python3-lib2to3
141s Use 'sudo apt autoremove' to remove them.
141s The following packages will be REMOVED:
141s   libapt-pkg6.0 libarchive13 libatm1 libcurl3-gnutls libcurl4 libdb5.3 libelf1
141s   libext2fs2 libgdbm-compat4 libgdbm6 libglib2.0-0 libgnutls30 libgpgme11
141s   libhogweed6 libmagic1 libnettle8 libnpth0 libnvme1 libparted2 libperl5.38
141s   libpng16-16 libpsl5 libreadline8 libreiserfscore0 libssl3 libtirpc3 liburcu8
141s   libuv1
141s The following NEW packages will be installed:
141s   bpfcc-tools bpftrace fontconfig-config fonts-dejavu-core fonts-dejavu-mono
141s   hwdata ieee-data libaio1t64 libapt-pkg6.0t64 libarchive13t64 libatm1t64
141s   libbpfcc libc-dev-bin libc-devtools libc6-dev libclang-cpp18 libclang1-18
141s   libcrypt-dev libcurl3t64-gnutls libcurl4t64 libdb5.3t64 libdeflate0
141s   libdw1t64 libelf1t64 libext2fs2t64 libfontconfig1 libfreetype6 libgd3
141s   libgdbm-compat4t64 libgdbm6t64 libglib2.0-0t64 libgnutls30t64 libgpgme11t64
141s   libhogweed6t64 libjbig0 libjpeg-turbo8 libjpeg8 libllvm18 libmagic1t64
141s   libnetplan1 libnettle8t64 libnpth0t64 libnvme1t64 libparted2t64
141s   libperl5.38t64 libpng16-16t64 libpsl5t64 libreadline8t64 libreiserfscore0t64
141s   libsharpyuv0 libssl3t64 libtiff6 libtirpc3t64 liburcu8t64 libuv1t64 libwebp7
141s   libxpm4 linux-headers-6.8.0-20 linux-headers-6.8.0-20-generic
141s   linux-image-6.8.0-20-generic linux-libc-dev linux-modules-6.8.0-20-generic
141s   linux-modules-extra-6.8.0-20-generic linux-tools-6.8.0-20
141s   linux-tools-6.8.0-20-generic linux-tools-common manpages manpages-dev
141s   python3-bpfcc python3-netaddr rpcsvc-proto ubuntu-kernel-accessories
141s   xdg-user-dirs
141s The following packages have been kept back:
141s   s390-tools
141s The following packages will be upgraded:
141s   apparmor apt apt-utils base-files bash bind9-dnsutils bind9-host bind9-libs
141s   binutils binutils-common binutils-s390x-linux-gnu bolt bsdextrautils
141s   bsdutils btrfs-progs coreutils cryptsetup-bin curl dbus dbus-bin dbus-daemon
141s   dbus-session-bus-common dbus-system-bus-common dbus-user-session dhcpcd-base
141s   dirmngr dmsetup dpkg dpkg-dev e2fsprogs e2fsprogs-l10n eject fdisk file ftp
141s   fwupd gawk gcc-13-base gcc-14-base gir1.2-girepository-2.0 gir1.2-glib-2.0
141s   gnupg gnupg-l10n gnupg-utils gpg gpg-agent gpg-wks-client gpgconf gpgsm gpgv
141s   groff-base ibverbs-providers inetutils-telnet info initramfs-tools
141s   initramfs-tools-bin initramfs-tools-core install-info iproute2 jq keyboxd
141s   kmod kpartx krb5-locales libapparmor1 libaudit-common libaudit1 libbinutils
141s   libblkid1 libblockdev-crypto3 libblockdev-fs3 libblockdev-loop3
141s   libblockdev-mdraid3 libblockdev-nvme3 libblockdev-part3 libblockdev-swap3
141s   libblockdev-utils3 libblockdev3 libbpf1 libbrotli1 libcap-ng0 libcom-err2
141s   libcryptsetup12 libctf-nobfd0 libctf0 libdbus-1-3 libdebconfclient0
141s   libdevmapper1.02.1 libdpkg-perl libevent-core-2.1-7 libexpat1 libfdisk1
141s   libfido2-1 libftdi1-2 libfwupd2 libgcc-s1 libgirepository-1.0-1
141s   libglib2.0-data libgssapi-krb5-2 libgudev-1.0-0 libgusb2 libibverbs1
141s   libjcat1 libjq1 libjson-glib-1.0-0 libjson-glib-1.0-common libk5crypto3
141s   libkmod2 libkrb5-3 libkrb5support0 libldap-common libldap2
141s   liblocale-gettext-perl liblzma5 libmagic-mgc libmbim-glib4 libmbim-proxy
141s   libmm-glib0 libmount1 libnghttp2-14 libnsl2 libnss-systemd libpam-modules
141s   libpam-modules-bin libpam-runtime libpam-systemd libpam0g libplymouth5
141s   libpolkit-agent-1-0 libpolkit-gobject-1-0 libproc2-0 libprotobuf-c1
141s   libpython3-stdlib libpython3.11-minimal libpython3.11-stdlib
141s   libpython3.12-minimal libpython3.12-stdlib libqmi-glib5 libqmi-proxy
141s   libqrtr-glib0 librtmp1 libsasl2-2 libsasl2-modules libsasl2-modules-db
141s   libseccomp2 libselinux1 libsemanage-common libsemanage2 libsframe1 libslang2
141s   libsmartcols1 libsqlite3-0 libss2 libssh-4 libstdc++6 libsystemd-shared
141s   libsystemd0 libtext-charwidth-perl libtext-iconv-perl libtirpc-common
141s   libudev1 libudisks2-0 libusb-1.0-0 libuuid1 libvolume-key1 libxml2 libxmlb2
141s   libxmuu1 linux-generic linux-headers-generic linux-headers-virtual
141s   linux-image-generic linux-image-virtual linux-virtual logsave lshw lsof
141s   man-db motd-news-config mount mtr-tiny multipath-tools netplan-generator
141s   netplan.io openssh-client openssh-server openssh-sftp-server openssl parted
141s   perl perl-base perl-modules-5.38 pinentry-curses plymouth
141s   plymouth-theme-ubuntu-text procps python-apt-common python3 python3-apt
141s   python3-cryptography python3-dbus python3-distutils python3-gdbm python3-gi
141s   python3-lib2to3 python3-minimal python3-netplan python3-pkg-resources
141s   python3-pyrsistent python3-setuptools python3-typing-extensions python3-yaml
141s   python3.11 python3.11-minimal python3.12 python3.12-minimal readline-common
141s   rsync rsyslog s390-tools-data shared-mime-info sudo systemd systemd-dev
141s   systemd-resolved systemd-sysv systemd-timesyncd tcpdump telnet tnftp
141s   ubuntu-pro-client ubuntu-pro-client-l10n udev udisks2 usb.ids util-linux
141s   uuid-runtime vim-common vim-tiny wget xxd xz-utils zlib1g
141s 243 upgraded, 73 newly installed, 28 to remove and 1 not upgraded.
141s Need to get 228 MB of archives.
141s After this operation, 524 MB of additional disk space will be used.
141s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main s390x motd-news-config all 13ubuntu8 [5098 B]
141s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main s390x base-files s390x 13ubuntu8 [74.2 kB]
141s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bash s390x 5.2.21-2ubuntu3 [845 kB]
142s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bsdutils s390x 1:2.39.3-9ubuntu2 [96.1 kB]
142s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libbrotli1 s390x 1.1.0-2build1 [375 kB]
142s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgssapi-krb5-2 s390x 1.20.1-6ubuntu1 [149 kB]
142s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libkrb5-3 s390x 1.20.1-6ubuntu1 [360 kB]
142s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libkrb5support0 s390x 1.20.1-6ubuntu1 [34.6 kB]
142s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libk5crypto3 s390x 1.20.1-6ubuntu1 [90.3 kB]
142s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcom-err2 s390x 1.47.0-2.4~exp1ubuntu2 [22.9 kB]
142s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main s390x zlib1g s390x 1:1.3.dfsg-3.1ubuntu1 [75.7 kB]
142s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/main s390x librtmp1 s390x 2.4+20151223.gitfa8646d.1-2build6 [58.4 kB]
143s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main s390x udisks2 s390x 2.10.1-6 [298 kB]
143s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libudisks2-0 s390x 2.10.1-6 [179 kB]
143s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblkid1 s390x 2.39.3-9ubuntu2 [128 kB]
143s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main s390x liblzma5 s390x 5.6.0-0.2 [137 kB]
143s Get:17 http://ftpmaster.internal/ubuntu noble-proposed/main s390x kmod s390x 31+20240202-2ubuntu4 [107 kB]
143s Get:18 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libkmod2 s390x 31+20240202-2ubuntu4 [56.3 kB]
143s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main s390x systemd-dev all 255.4-1ubuntu5 [103 kB]
143s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main s390x systemd-timesyncd s390x 255.4-1ubuntu5 [35.3 kB]
143s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus-session-bus-common all 1.14.10-4ubuntu2 [80.3 kB]
143s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libaudit-common all 1:3.1.2-2.1 [5674 B]
143s Get:23 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcap-ng0 s390x 0.8.4-2build1 [15.7 kB]
143s Get:24 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libaudit1 s390x 1:3.1.2-2.1 [48.9 kB]
143s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpam0g s390x 1.5.3-5ubuntu3 [69.8 kB]
143s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libselinux1 s390x 3.5-2ubuntu1 [84.7 kB]
143s Get:27 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcurl4t64 s390x 8.5.0-2ubuntu8 [363 kB]
143s Get:28 http://ftpmaster.internal/ubuntu noble-proposed/main s390x curl s390x 8.5.0-2ubuntu8 [227 kB]
143s Get:29 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpsl5t64 s390x 0.21.2-1.1 [57.6 kB]
143s Get:30 http://ftpmaster.internal/ubuntu noble-proposed/main s390x wget s390x 1.21.4-1ubuntu2 [351 kB]
143s Get:31 http://ftpmaster.internal/ubuntu noble-proposed/main s390x tnftp s390x 20230507-2build1 [107 kB]
143s Get:32 http://ftpmaster.internal/ubuntu noble-proposed/main s390x tcpdump s390x 4.99.4-3ubuntu2 [490 kB]
143s Get:33 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsystemd-shared s390x 255.4-1ubuntu5 [2131 kB]
144s Get:34 http://ftpmaster.internal/ubuntu noble-proposed/main s390x systemd-resolved s390x 255.4-1ubuntu5 [304 kB]
144s Get:35 http://ftpmaster.internal/ubuntu noble-proposed/main s390x sudo s390x 1.9.15p5-3ubuntu3 [968 kB]
144s Get:36 http://ftpmaster.internal/ubuntu noble-proposed/main s390x rsync s390x 3.2.7-1build1 [446 kB]
144s Get:37 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-cryptography s390x 41.0.7-4build2 [918 kB]
144s Get:38 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssl s390x 3.0.13-0ubuntu2 [1010 kB]
145s Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssh-sftp-server s390x 1:9.6p1-3ubuntu11 [39.0 kB]
145s Get:40 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssh-client s390x 1:9.6p1-3ubuntu11 [935 kB]
145s Get:41 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssh-server s390x 1:9.6p1-3ubuntu11 [529 kB]
145s Get:42 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libssh-4 s390x 0.10.6-2build1 [189 kB]
145s Get:43 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsasl2-modules s390x 2.1.28+dfsg1-5ubuntu1 [76.6 kB]
145s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3.12 s390x 3.12.2-4build3 [645 kB]
145s Get:45 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3.12-minimal s390x 3.12.2-4build3 [2419 kB]
145s Get:46 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpython3.12-minimal s390x 3.12.2-4build3 [829 kB]
145s Get:47 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libparted2t64 s390x 3.6-3.1build2 [172 kB]
145s Get:48 http://ftpmaster.internal/ubuntu noble-proposed/main s390x parted s390x 3.6-3.1build2 [44.6 kB]
145s Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3.11 s390x 3.11.8-1build4 [589 kB]
145s Get:50 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3.11-minimal s390x 3.11.8-1build4 [2280 kB]
145s Get:51 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpython3.11-minimal s390x 3.11.8-1build4 [838 kB]
146s Get:52 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpython3.11-stdlib s390x 3.11.8-1build4 [1944 kB]
146s Get:53 http://ftpmaster.internal/ubuntu noble-proposed/main s390x shared-mime-info s390x 2.4-1build1 [474 kB]
146s Get:54 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gir1.2-girepository-2.0 s390x 1.79.1-1ubuntu6 [24.5 kB]
146s Get:55 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gir1.2-glib-2.0 s390x 2.79.3-3ubuntu5 [180 kB]
146s Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgirepository-1.0-1 s390x 1.79.1-1ubuntu6 [84.0 kB]
146s Get:57 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-gi s390x 3.47.0-3build1 [236 kB]
146s Get:58 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-dbus s390x 1.3.2-5build2 [100 kB]
146s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnetplan1 s390x 1.0-1 [123 kB]
146s Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-netplan s390x 1.0-1 [23.0 kB]
146s Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main s390x netplan-generator s390x 1.0-1 [59.1 kB]
146s Get:62 http://ftpmaster.internal/ubuntu noble-proposed/main s390x initramfs-tools-bin s390x 0.142ubuntu23 [20.5 kB]
146s Get:63 http://ftpmaster.internal/ubuntu noble-proposed/main s390x initramfs-tools-core all 0.142ubuntu23 [50.1 kB]
146s Get:64 http://ftpmaster.internal/ubuntu noble-proposed/main s390x initramfs-tools all 0.142ubuntu23 [9058 B]
146s Get:65 http://ftpmaster.internal/ubuntu noble-proposed/main s390x netplan.io s390x 1.0-1 [65.4 kB]
146s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libxmlb2 s390x 0.3.15-1build1 [70.6 kB]
146s Get:67 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgpgme11t64 s390x 1.18.0-4.1ubuntu3 [150 kB]
146s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libvolume-key1 s390x 0.3.12-7build1 [40.8 kB]
146s Get:69 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libqrtr-glib0 s390x 1.2.2-1ubuntu3 [17.5 kB]
146s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libqmi-glib5 s390x 1.35.2-0ubuntu1 [918 kB]
146s Get:71 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libqmi-proxy s390x 1.35.2-0ubuntu1 [6122 B]
146s Get:72 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpolkit-agent-1-0 s390x 124-1ubuntu1 [17.8 kB]
146s Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpolkit-gobject-1-0 s390x 124-1ubuntu1 [48.3 kB]
146s Get:74 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmm-glib0 s390x 1.23.4-0ubuntu1 [251 kB]
146s Get:75 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmbim-glib4 s390x 1.31.2-0ubuntu2 [238 kB]
146s Get:76 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmbim-proxy s390x 1.31.2-0ubuntu2 [6154 B]
146s Get:77 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libjson-glib-1.0-common all 1.8.0-2build1 [4210 B]
146s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libjson-glib-1.0-0 s390x 1.8.0-2build1 [68.4 kB]
146s Get:79 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgusb2 s390x 0.4.8-1build1 [39.0 kB]
146s Get:80 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgudev-1.0-0 s390x 1:238-3ubuntu2 [15.7 kB]
146s Get:81 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libarchive13t64 s390x 3.7.2-1.1ubuntu2 [419 kB]
146s Get:82 http://ftpmaster.internal/ubuntu noble-proposed/main s390x fwupd s390x 1.9.15-2 [4435 kB]
147s Get:83 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcurl3t64-gnutls s390x 8.5.0-2ubuntu8 [356 kB]
147s Get:84 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libfwupd2 s390x 1.9.15-2 [136 kB]
147s Get:85 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev3 s390x 3.1.0-1build1 [52.3 kB]
147s Get:86 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-utils3 s390x 3.1.0-1build1 [19.2 kB]
147s Get:87 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-swap3 s390x 3.1.0-1build1 [7778 B]
147s Get:88 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-part3 s390x 3.1.0-1build1 [15.4 kB]
147s Get:89 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnvme1t64 s390x 1.8-3 [78.7 kB]
147s Get:90 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-nvme3 s390x 3.1.0-1build1 [18.3 kB]
147s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-mdraid3 s390x 3.1.0-1build1 [13.2 kB]
147s Get:92 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-loop3 s390x 3.1.0-1build1 [7138 B]
147s Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main s390x e2fsprogs-l10n all 1.47.0-2.4~exp1ubuntu2 [5996 B]
147s Get:94 http://ftpmaster.internal/ubuntu noble-proposed/main s390x logsave s390x 1.47.0-2.4~exp1ubuntu2 [22.5 kB]
147s Get:95 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libext2fs2t64 s390x 1.47.0-2.4~exp1ubuntu2 [235 kB]
147s Get:96 http://ftpmaster.internal/ubuntu noble-proposed/main s390x e2fsprogs s390x 1.47.0-2.4~exp1ubuntu2 [615 kB]
147s Get:97 http://ftpmaster.internal/ubuntu noble/main s390x libreiserfscore0t64 s390x 1:3.6.27-7.1 [85.5 kB]
147s Get:98 http://ftpmaster.internal/ubuntu noble-proposed/main s390x btrfs-progs s390x 6.6.3-1.1build1 [959 kB]
147s Get:99 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-fs3 s390x 3.1.0-1build1 [36.5 kB]
147s Get:100 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libblockdev-crypto3 s390x 3.1.0-1build1 [21.6 kB]
147s Get:101 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bolt s390x 0.9.6-2build1 [142 kB]
147s Get:102 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libglib2.0-0t64 s390x 2.79.3-3ubuntu5 [1566 kB]
148s Get:103 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libjcat1 s390x 0.2.0-2build2 [34.4 kB]
148s Get:104 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libldap2 s390x 2.6.7+dfsg-1~exp1ubuntu6 [202 kB]
148s Get:105 http://ftpmaster.internal/ubuntu noble-proposed/main s390x ubuntu-pro-client-l10n s390x 31.2.2 [19.4 kB]
148s Get:106 http://ftpmaster.internal/ubuntu noble-proposed/main s390x ubuntu-pro-client s390x 31.2.2 [214 kB]
148s Get:107 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gnupg-utils s390x 2.4.4-2ubuntu15 [116 kB]
148s Get:108 http://ftpmaster.internal/ubuntu noble-proposed/main s390x keyboxd s390x 2.4.4-2ubuntu15 [83.1 kB]
148s Get:109 http://ftpmaster.internal/ubuntu noble/main s390x libnpth0t64 s390x 1.6-3.1 [8148 B]
148s Get:110 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpgv s390x 2.4.4-2ubuntu15 [165 kB]
148s Get:111 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpg-wks-client s390x 2.4.4-2ubuntu15 [76.8 kB]
148s Get:112 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpg-agent s390x 2.4.4-2ubuntu15 [240 kB]
148s Get:113 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpg s390x 2.4.4-2ubuntu15 [589 kB]
148s Get:114 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dirmngr s390x 2.4.4-2ubuntu15 [340 kB]
148s Get:115 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gnupg all 2.4.4-2ubuntu15 [359 kB]
148s Get:116 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-apt s390x 2.7.7 [171 kB]
148s Get:117 http://ftpmaster.internal/ubuntu noble-proposed/main s390x apt-utils s390x 2.7.14 [214 kB]
148s Get:118 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libapt-pkg6.0t64 s390x 2.7.14 [1014 kB]
149s Get:119 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnettle8t64 s390x 3.9.1-2.2 [210 kB]
149s Get:120 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libhogweed6t64 s390x 3.9.1-2.2 [204 kB]
149s Get:121 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgnutls30t64 s390x 3.8.3-1.1ubuntu2 [1044 kB]
149s Get:122 http://ftpmaster.internal/ubuntu noble-proposed/main s390x apt s390x 2.7.14 [1390 kB]
149s Get:123 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpgconf s390x 2.4.4-2ubuntu15 [111 kB]
149s Get:124 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gpgsm s390x 2.4.4-2ubuntu15 [244 kB]
149s Get:125 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libreadline8t64 s390x 8.2-4 [170 kB]
149s Get:126 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gawk s390x 1:5.2.1-2build2 [496 kB]
149s Get:127 http://ftpmaster.internal/ubuntu noble-proposed/main s390x fdisk s390x 2.39.3-9ubuntu2 [124 kB]
149s Get:128 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpython3.12-stdlib s390x 3.12.2-4build3 [2046 kB]
149s Get:129 http://ftpmaster.internal/ubuntu noble-proposed/main s390x perl-base s390x 5.38.2-3.2 [1961 kB]
149s Get:130 http://ftpmaster.internal/ubuntu noble-proposed/main s390x perl-modules-5.38 all 5.38.2-3.2 [3110 kB]
149s Get:131 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-gdbm s390x 3.12.2-3ubuntu1.1 [19.0 kB]
149s Get:132 http://ftpmaster.internal/ubuntu noble-proposed/main s390x man-db s390x 2.12.0-3build4 [1246 kB]
149s Get:133 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgdbm6t64 s390x 1.23-5.1 [36.4 kB]
149s Get:134 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgdbm-compat4t64 s390x 1.23-5.1 [6880 B]
149s Get:135 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libperl5.38t64 s390x 5.38.2-3.2 [5007 kB]
150s Get:136 http://ftpmaster.internal/ubuntu noble-proposed/main s390x perl s390x 5.38.2-3.2 [231 kB]
150s Get:137 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdb5.3t64 s390x 5.3.28+dfsg2-6 [763 kB]
150s Get:138 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsasl2-modules-db s390x 2.1.28+dfsg1-5ubuntu1 [21.1 kB]
150s Get:139 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsasl2-2 s390x 2.1.28+dfsg1-5ubuntu1 [57.8 kB]
150s Get:140 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libfido2-1 s390x 1.14.0-1build1 [81.0 kB]
150s Get:141 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcryptsetup12 s390x 2:2.7.0-1ubuntu2 [264 kB]
150s Get:142 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dhcpcd-base s390x 1:10.0.6-1ubuntu2 [217 kB]
150s Get:143 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libuv1t64 s390x 1.48.0-1.1 [101 kB]
150s Get:144 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bind9-host s390x 1:9.18.24-0ubuntu3 [50.5 kB]
150s Get:145 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bind9-dnsutils s390x 1:9.18.24-0ubuntu3 [162 kB]
150s Get:146 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bind9-libs s390x 1:9.18.24-0ubuntu3 [1243 kB]
150s Get:147 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libssl3t64 s390x 3.0.13-0ubuntu2 [1675 kB]
150s Get:148 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnss-systemd s390x 255.4-1ubuntu5 [166 kB]
150s Get:149 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libudev1 s390x 255.4-1ubuntu5 [178 kB]
150s Get:150 http://ftpmaster.internal/ubuntu noble-proposed/main s390x systemd s390x 255.4-1ubuntu5 [3533 kB]
150s Get:151 http://ftpmaster.internal/ubuntu noble-proposed/main s390x udev s390x 255.4-1ubuntu5 [1887 kB]
150s Get:152 http://ftpmaster.internal/ubuntu noble-proposed/main s390x systemd-sysv s390x 255.4-1ubuntu5 [11.9 kB]
150s Get:153 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpam-systemd s390x 255.4-1ubuntu5 [242 kB]
150s Get:154 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsystemd0 s390x 255.4-1ubuntu5 [443 kB]
150s Get:155 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpam-modules-bin s390x 1.5.3-5ubuntu3 [57.4 kB]
150s Get:156 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpam-modules s390x 1.5.3-5ubuntu3 [289 kB]
150s Get:157 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpam-runtime all 1.5.3-5ubuntu3 [40.8 kB]
150s Get:158 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus-user-session s390x 1.14.10-4ubuntu2 [9960 B]
150s Get:159 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libapparmor1 s390x 4.0.0-beta3-0ubuntu2 [50.8 kB]
150s Get:160 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libexpat1 s390x 2.6.1-2 [94.8 kB]
150s Get:161 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus-system-bus-common all 1.14.10-4ubuntu2 [81.5 kB]
150s Get:162 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus-bin s390x 1.14.10-4ubuntu2 [41.4 kB]
150s Get:163 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus s390x 1.14.10-4ubuntu2 [24.3 kB]
150s Get:164 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dbus-daemon s390x 1.14.10-4ubuntu2 [118 kB]
150s Get:165 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdbus-1-3 s390x 1.14.10-4ubuntu2 [213 kB]
151s Get:166 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmount1 s390x 2.39.3-9ubuntu2 [138 kB]
151s Get:167 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libseccomp2 s390x 2.5.5-1ubuntu2 [53.4 kB]
151s Get:168 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdevmapper1.02.1 s390x 2:1.02.185-3ubuntu2 [142 kB]
151s Get:169 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libuuid1 s390x 2.39.3-9ubuntu2 [35.6 kB]
151s Get:170 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libfdisk1 s390x 2.39.3-9ubuntu2 [151 kB]
151s Get:171 http://ftpmaster.internal/ubuntu noble-proposed/main s390x mount s390x 2.39.3-9ubuntu2 [119 kB]
151s Get:172 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsqlite3-0 s390x 3.45.1-1ubuntu1 [747 kB]
151s Get:173 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gcc-14-base s390x 14-20240315-1ubuntu1 [47.0 kB]
151s Get:174 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgcc-s1 s390x 14-20240315-1ubuntu1 [35.9 kB]
151s Get:175 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libstdc++6 s390x 14-20240315-1ubuntu1 [908 kB]
151s Get:176 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dpkg s390x 1.22.6ubuntu5 [1278 kB]
151s Get:177 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-minimal s390x 3.12.2-0ubuntu1 [27.1 kB]
151s Get:178 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3 s390x 3.12.2-0ubuntu1 [24.1 kB]
151s Get:179 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpython3-stdlib s390x 3.12.2-0ubuntu1 [9804 B]
151s Get:180 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsmartcols1 s390x 2.39.3-9ubuntu2 [67.9 kB]
151s Get:181 http://ftpmaster.internal/ubuntu noble-proposed/main s390x bsdextrautils s390x 2.39.3-9ubuntu2 [76.3 kB]
151s Get:182 http://ftpmaster.internal/ubuntu noble-proposed/main s390x groff-base s390x 1.23.0-3build1 [1049 kB]
151s Get:183 http://ftpmaster.internal/ubuntu noble-proposed/main s390x pinentry-curses s390x 1.2.1-3ubuntu4 [37.6 kB]
151s Get:184 http://ftpmaster.internal/ubuntu noble-proposed/main s390x readline-common all 8.2-4 [56.4 kB]
151s Get:185 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libxml2 s390x 2.9.14+dfsg-1.3ubuntu2 [818 kB]
151s Get:186 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libbpf1 s390x 1:1.3.0-2build1 [176 kB]
151s Get:187 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libelf1t64 s390x 0.190-1.1build2 [69.7 kB]
151s Get:188 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libtirpc-common all 1.3.4+ds-1.1 [8018 B]
151s Get:189 http://ftpmaster.internal/ubuntu noble-proposed/main s390x lsof s390x 4.95.0-1build2 [248 kB]
151s Get:190 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnsl2 s390x 1.3.0-3build2 [44.1 kB]
151s Get:191 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libtirpc3t64 s390x 1.3.4+ds-1.1 [85.8 kB]
151s Get:192 http://ftpmaster.internal/ubuntu noble-proposed/main s390x iproute2 s390x 6.1.0-1ubuntu5 [1156 kB]
151s Get:193 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-yaml s390x 6.0.1-2build1 [121 kB]
151s Get:194 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libusb-1.0-0 s390x 2:1.0.27-1 [54.8 kB]
151s Get:195 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libprotobuf-c1 s390x 1.4.1-1ubuntu3 [23.4 kB]
151s Get:196 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libnghttp2-14 s390x 1.59.0-1build1 [77.8 kB]
151s Get:197 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libproc2-0 s390x 2:4.0.4-4ubuntu2 [60.1 kB]
151s Get:198 http://ftpmaster.internal/ubuntu noble-proposed/main s390x procps s390x 2:4.0.4-4ubuntu2 [724 kB]
151s Get:199 http://ftpmaster.internal/ubuntu noble-proposed/main s390x coreutils s390x 9.4-3ubuntu3 [1482 kB]
151s Get:200 http://ftpmaster.internal/ubuntu noble-proposed/main s390x util-linux s390x 2.39.3-9ubuntu2 [1143 kB]
151s Get:201 http://ftpmaster.internal/ubuntu noble-proposed/main s390x file s390x 1:5.45-3 [22.2 kB]
151s Get:202 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmagic-mgc s390x 1:5.45-3 [305 kB]
152s Get:203 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libmagic1t64 s390x 1:5.45-3 [93.1 kB]
152s Get:204 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libplymouth5 s390x 24.004.60-1ubuntu6 [151 kB]
152s Get:205 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libpng16-16t64 s390x 1.6.43-3 [200 kB]
152s Get:206 http://ftpmaster.internal/ubuntu noble-proposed/main s390x multipath-tools s390x 0.9.4-5ubuntu6 [318 kB]
152s Get:207 http://ftpmaster.internal/ubuntu noble/main s390x liburcu8t64 s390x 0.14.0-3.1 [67.3 kB]
152s Get:208 http://ftpmaster.internal/ubuntu noble-proposed/main s390x liblocale-gettext-perl s390x 1.07-6ubuntu4 [15.8 kB]
152s Get:209 http://ftpmaster.internal/ubuntu noble-proposed/main s390x uuid-runtime s390x 2.39.3-9ubuntu2 [33.4 kB]
152s Get:210 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdebconfclient0 s390x 0.271ubuntu2 [11.4 kB]
152s Get:211 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsemanage-common all 3.5-1build4 [10.1 kB]
152s Get:212 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsemanage2 s390x 3.5-1build4 [96.7 kB]
152s Get:213 http://ftpmaster.internal/ubuntu noble-proposed/main s390x install-info s390x 7.1-3build1 [64.5 kB]
152s Get:214 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gcc-13-base s390x 13.2.0-21ubuntu1 [48.3 kB]
152s Get:215 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libss2 s390x 1.47.0-2.4~exp1ubuntu2 [17.2 kB]
152s Get:216 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dmsetup s390x 2:1.02.185-3ubuntu2 [80.4 kB]
152s Get:217 http://ftpmaster.internal/ubuntu noble-proposed/main s390x eject s390x 2.39.3-9ubuntu2 [26.2 kB]
152s Get:218 http://ftpmaster.internal/ubuntu noble-proposed/main s390x krb5-locales all 1.20.1-6ubuntu1 [13.8 kB]
152s Get:219 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libglib2.0-data all 2.79.3-3ubuntu5 [46.6 kB]
152s Get:220 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libslang2 s390x 2.3.3-3build1 [501 kB]
152s Get:221 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libtext-charwidth-perl s390x 0.04-11build2 [9484 B]
152s Get:222 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libtext-iconv-perl s390x 1.7-8build2 [13.8 kB]
152s Get:223 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python-apt-common all 2.7.7 [19.8 kB]
152s Get:224 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-setuptools all 68.1.2-2ubuntu1 [396 kB]
152s Get:225 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-pkg-resources all 68.1.2-2ubuntu1 [168 kB]
152s Get:226 http://ftpmaster.internal/ubuntu noble-proposed/main s390x rsyslog s390x 8.2312.0-3ubuntu7 [536 kB]
152s Get:227 http://ftpmaster.internal/ubuntu noble-proposed/main s390x vim-tiny s390x 2:9.1.0016-1ubuntu6 [879 kB]
153s Get:228 http://ftpmaster.internal/ubuntu noble-proposed/main s390x vim-common all 2:9.1.0016-1ubuntu6 [385 kB]
153s Get:229 http://ftpmaster.internal/ubuntu noble/main s390x xdg-user-dirs s390x 0.18-1 [18.5 kB]
153s Get:230 http://ftpmaster.internal/ubuntu noble-proposed/main s390x xxd s390x 2:9.1.0016-1ubuntu6 [63.5 kB]
153s Get:231 http://ftpmaster.internal/ubuntu noble-proposed/main s390x apparmor s390x 4.0.0-beta3-0ubuntu2 [710 kB]
153s Get:232 http://ftpmaster.internal/ubuntu noble-proposed/main s390x ftp all 20230507-2build1 [4724 B]
153s Get:233 http://ftpmaster.internal/ubuntu noble-proposed/main s390x inetutils-telnet s390x 2:2.5-3ubuntu3 [105 kB]
153s Get:234 http://ftpmaster.internal/ubuntu noble-proposed/main s390x info s390x 7.1-3build1 [152 kB]
153s Get:235 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libxmuu1 s390x 2:1.1.3-3build1 [8860 B]
153s Get:236 http://ftpmaster.internal/ubuntu noble-proposed/main s390x lshw s390x 02.19.git.2021.06.19.996aaad9c7-2build2 [346 kB]
153s Get:237 http://ftpmaster.internal/ubuntu noble/main s390x manpages all 6.05.01-1 [1340 kB]
153s Get:238 http://ftpmaster.internal/ubuntu noble-proposed/main s390x mtr-tiny s390x 0.95-1.1build1 [57.0 kB]
153s Get:239 http://ftpmaster.internal/ubuntu noble-proposed/main s390x plymouth-theme-ubuntu-text s390x 24.004.60-1ubuntu6 [10.2 kB]
153s Get:240 http://ftpmaster.internal/ubuntu noble-proposed/main s390x plymouth s390x 24.004.60-1ubuntu6 [147 kB]
153s Get:241 http://ftpmaster.internal/ubuntu noble-proposed/main s390x telnet all 0.17+2.5-3ubuntu3 [3682 B]
153s Get:242 http://ftpmaster.internal/ubuntu noble-proposed/main s390x usb.ids all 2024.03.18-1 [223 kB]
153s Get:243 http://ftpmaster.internal/ubuntu noble-proposed/main s390x xz-utils s390x 5.6.0-0.2 [274 kB]
153s Get:244 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libctf0 s390x 2.42-4ubuntu1 [98.4 kB]
153s Get:245 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libctf-nobfd0 s390x 2.42-4ubuntu1 [100 kB]
153s Get:246 http://ftpmaster.internal/ubuntu noble-proposed/main s390x binutils-s390x-linux-gnu s390x 2.42-4ubuntu1 [2270 kB]
153s Get:247 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libbinutils s390x 2.42-4ubuntu1 [477 kB]
153s Get:248 http://ftpmaster.internal/ubuntu noble-proposed/main s390x binutils s390x 2.42-4ubuntu1 [3056 B]
153s Get:249 http://ftpmaster.internal/ubuntu noble-proposed/main s390x binutils-common s390x 2.42-4ubuntu1 [217 kB]
153s Get:250 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsframe1 s390x 2.42-4ubuntu1 [14.2 kB]
153s Get:251 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libllvm18 s390x 1:18.1.2-1ubuntu2 [33.4 MB]
158s Get:252 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libclang-cpp18 s390x 1:18.1.2-1ubuntu2 [16.1 MB]
161s Get:253 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libbpfcc s390x 0.29.1+ds-1ubuntu4 [697 kB]
161s Get:254 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x python3-bpfcc all 0.29.1+ds-1ubuntu4 [40.2 kB]
161s Get:255 http://ftpmaster.internal/ubuntu noble/main s390x ieee-data all 20220827.1 [2113 kB]
162s Get:256 http://ftpmaster.internal/ubuntu noble/main s390x python3-netaddr all 0.8.0-2ubuntu1 [319 kB]
162s Get:257 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x bpfcc-tools all 0.29.1+ds-1ubuntu4 [687 kB]
162s Get:258 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libclang1-18 s390x 1:18.1.2-1ubuntu2 [9349 kB]
165s Get:259 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdw1t64 s390x 0.190-1.1build2 [286 kB]
165s Get:260 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x bpftrace s390x 0.20.2-1ubuntu1 [1139 kB]
167s Get:261 http://ftpmaster.internal/ubuntu noble-proposed/main s390x cryptsetup-bin s390x 2:2.7.0-1ubuntu2 [211 kB]
167s Get:262 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dpkg-dev all 1.22.6ubuntu5 [1074 kB]
167s Get:263 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdpkg-perl all 1.22.6ubuntu5 [269 kB]
167s Get:264 http://ftpmaster.internal/ubuntu noble/main s390x fonts-dejavu-mono all 2.37-8 [502 kB]
167s Get:265 http://ftpmaster.internal/ubuntu noble/main s390x fonts-dejavu-core all 2.37-8 [835 kB]
167s Get:266 http://ftpmaster.internal/ubuntu noble-proposed/main s390x fontconfig-config s390x 2.15.0-1.1ubuntu1 [37.4 kB]
167s Get:267 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gnupg-l10n all 2.4.4-2ubuntu15 [65.8 kB]
167s Get:268 http://ftpmaster.internal/ubuntu noble/main s390x hwdata all 0.379-1 [29.1 kB]
167s Get:269 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libibverbs1 s390x 50.0-2build1 [70.0 kB]
167s Get:270 http://ftpmaster.internal/ubuntu noble-proposed/main s390x ibverbs-providers s390x 50.0-2build1 [408 kB]
167s Get:271 http://ftpmaster.internal/ubuntu noble-proposed/main s390x jq s390x 1.7.1-3 [66.5 kB]
167s Get:272 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libjq1 s390x 1.7.1-3 [168 kB]
167s Get:273 http://ftpmaster.internal/ubuntu noble/main s390x libaio1t64 s390x 0.3.113-6 [7290 B]
167s Get:274 http://ftpmaster.internal/ubuntu noble/main s390x libatm1t64 s390x 1:2.5.1-5.1 [24.5 kB]
167s Get:275 http://ftpmaster.internal/ubuntu noble/main s390x libc-dev-bin s390x 2.39-0ubuntu6 [20.2 kB]
167s Get:276 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libfreetype6 s390x 2.13.2+dfsg-1build2 [437 kB]
168s Get:277 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libfontconfig1 s390x 2.15.0-1.1ubuntu1 [150 kB]
168s Get:278 http://ftpmaster.internal/ubuntu noble/main s390x libjpeg-turbo8 s390x 2.1.5-2ubuntu1 [128 kB]
168s Get:279 http://ftpmaster.internal/ubuntu noble/main s390x libjpeg8 s390x 8c-2ubuntu11 [2146 B]
168s Get:280 http://ftpmaster.internal/ubuntu noble/main s390x libdeflate0 s390x 1.19-1 [46.0 kB]
168s Get:281 http://ftpmaster.internal/ubuntu noble/main s390x libjbig0 s390x 2.1-6.1ubuntu1 [29.8 kB]
168s Get:282 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libsharpyuv0 s390x 1.3.2-0.4build2 [14.9 kB]
168s Get:283 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libwebp7 s390x 1.3.2-0.4build2 [207 kB]
168s Get:284 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libtiff6 s390x 4.5.1+git230720-4ubuntu1 [218 kB]
168s Get:285 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libxpm4 s390x 1:3.5.17-1build1 [41.4 kB]
168s Get:286 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgd3 s390x 2.3.3-9ubuntu3 [141 kB]
168s Get:287 http://ftpmaster.internal/ubuntu noble/main s390x libc-devtools s390x 2.39-0ubuntu6 [30.6 kB]
168s Get:288 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-libc-dev s390x 6.8.0-20.20 [1592 kB]
169s Get:289 http://ftpmaster.internal/ubuntu noble/main s390x libcrypt-dev s390x 1:4.4.36-4 [135 kB]
169s Get:290 http://ftpmaster.internal/ubuntu noble/main s390x rpcsvc-proto s390x 1.4.2-0ubuntu6 [64.7 kB]
169s Get:291 http://ftpmaster.internal/ubuntu noble/main s390x libc6-dev s390x 2.39-0ubuntu6 [1629 kB]
169s Get:292 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libevent-core-2.1-7 s390x 2.1.12-stable-9build1 [94.3 kB]
169s Get:293 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libftdi1-2 s390x 1.5-6build4 [29.3 kB]
169s Get:294 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libldap-common all 2.6.7+dfsg-1~exp1ubuntu6 [31.3 kB]
169s Get:295 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-modules-6.8.0-20-generic s390x 6.8.0-20.20 [21.0 MB]
177s Get:296 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-image-6.8.0-20-generic s390x 6.8.0-20.20 [9872 kB]
184s Get:297 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-modules-extra-6.8.0-20-generic s390x 6.8.0-20.20 [11.7 MB]
191s Get:298 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-generic s390x 6.8.0-20.20+1 [1734 B]
191s Get:299 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-image-generic s390x 6.8.0-20.20+1 [9688 B]
191s Get:300 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-virtual s390x 6.8.0-20.20+1 [1682 B]
191s Get:301 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-image-virtual s390x 6.8.0-20.20+1 [9700 B]
191s Get:302 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-headers-virtual s390x 6.8.0-20.20+1 [1642 B]
191s Get:303 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-headers-6.8.0-20 all 6.8.0-20.20 [13.6 MB]
196s Get:304 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-headers-6.8.0-20-generic s390x 6.8.0-20.20 [2579 kB]
198s Get:305 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-headers-generic s390x 6.8.0-20.20+1 [9608 B]
198s Get:306 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-tools-common all 6.8.0-20.20 [437 kB]
198s Get:307 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-tools-6.8.0-20 s390x 6.8.0-20.20 [2674 kB]
199s Get:308 http://ftpmaster.internal/ubuntu noble-proposed/main s390x linux-tools-6.8.0-20-generic s390x 6.8.0-20.20 [1724 B]
199s Get:309 http://ftpmaster.internal/ubuntu noble/main s390x manpages-dev all 6.05.01-1 [2018 kB]
199s Get:310 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-distutils all 3.12.2-3ubuntu1.1 [133 kB]
199s Get:311 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-lib2to3 all 3.12.2-3ubuntu1.1 [79.1 kB]
199s Get:312 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-pyrsistent s390x 0.20.0-1build1 [55.8 kB]
199s Get:313 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-typing-extensions all 4.10.0-1 [60.7 kB]
199s Get:314 http://ftpmaster.internal/ubuntu noble-proposed/main s390x s390-tools-data all 2.31.0-0ubuntu3 [17.8 kB]
199s Get:315 http://ftpmaster.internal/ubuntu noble/main s390x ubuntu-kernel-accessories s390x 1.536build1 [10.5 kB]
199s Get:316 http://ftpmaster.internal/ubuntu noble-proposed/main s390x kpartx s390x 0.9.4-5ubuntu6 [32.8 kB]
200s Preconfiguring packages ...
200s Fetched 228 MB in 58s (3921 kB/s)
201s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
201s Preparing to unpack .../motd-news-config_13ubuntu8_all.deb ...
201s Unpacking motd-news-config (13ubuntu8) over (13ubuntu7) ...
201s Preparing to unpack .../base-files_13ubuntu8_s390x.deb ...
201s Unpacking base-files (13ubuntu8) over (13ubuntu7) ...
201s Setting up base-files (13ubuntu8) ...
202s motd-news.service is a disabled or a static unit not running, not starting it.
202s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
202s Preparing to unpack .../bash_5.2.21-2ubuntu3_s390x.deb ...
202s Unpacking bash (5.2.21-2ubuntu3) over (5.2.21-2ubuntu2) ...
202s Setting up bash (5.2.21-2ubuntu3) ...
202s update-alternatives: using /usr/share/man/man7/bash-builtins.7.gz to provide /usr/share/man/man7/builtins.7.gz (builtins.7.gz) in auto mode
202s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
202s Preparing to unpack .../bsdutils_1%3a2.39.3-9ubuntu2_s390x.deb ...
202s Unpacking bsdutils (1:2.39.3-9ubuntu2) over (1:2.39.3-6ubuntu2) ...
202s Setting up bsdutils (1:2.39.3-9ubuntu2) ...
202s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
202s Preparing to unpack .../0-libbrotli1_1.1.0-2build1_s390x.deb ...
202s Unpacking libbrotli1:s390x (1.1.0-2build1) over (1.1.0-2) ...
202s Preparing to unpack .../1-libgssapi-krb5-2_1.20.1-6ubuntu1_s390x.deb ...
202s Unpacking libgssapi-krb5-2:s390x (1.20.1-6ubuntu1) over (1.20.1-5build1) ...
202s Preparing to unpack .../2-libkrb5-3_1.20.1-6ubuntu1_s390x.deb ...
202s Unpacking libkrb5-3:s390x (1.20.1-6ubuntu1) over (1.20.1-5build1) ...
202s Preparing to unpack .../3-libkrb5support0_1.20.1-6ubuntu1_s390x.deb ...
202s Unpacking libkrb5support0:s390x (1.20.1-6ubuntu1) over (1.20.1-5build1) ...
202s Preparing to unpack .../4-libk5crypto3_1.20.1-6ubuntu1_s390x.deb ...
202s Unpacking libk5crypto3:s390x (1.20.1-6ubuntu1) over (1.20.1-5build1) ...
202s Preparing to unpack .../5-libcom-err2_1.47.0-2.4~exp1ubuntu2_s390x.deb ...
202s Unpacking libcom-err2:s390x (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ...
202s Preparing to unpack .../6-zlib1g_1%3a1.3.dfsg-3.1ubuntu1_s390x.deb ...
202s Unpacking zlib1g:s390x (1:1.3.dfsg-3.1ubuntu1) over (1:1.3.dfsg-3ubuntu1) ...
202s Setting up zlib1g:s390x (1:1.3.dfsg-3.1ubuntu1) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../librtmp1_2.4+20151223.gitfa8646d.1-2build6_s390x.deb ...
203s Unpacking librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build6) over (2.4+20151223.gitfa8646d.1-2build4) ...
203s Preparing to unpack .../udisks2_2.10.1-6_s390x.deb ...
203s Unpacking udisks2 (2.10.1-6) over (2.10.1-1ubuntu2) ...
203s Preparing to unpack .../libudisks2-0_2.10.1-6_s390x.deb ...
203s Unpacking libudisks2-0:s390x (2.10.1-6) over (2.10.1-1ubuntu2) ...
203s Preparing to unpack .../libblkid1_2.39.3-9ubuntu2_s390x.deb ...
203s Unpacking libblkid1:s390x (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
203s Setting up libblkid1:s390x (2.39.3-9ubuntu2) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../liblzma5_5.6.0-0.2_s390x.deb ...
203s Unpacking liblzma5:s390x (5.6.0-0.2) over (5.4.5-0.3) ...
203s Setting up liblzma5:s390x (5.6.0-0.2) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../0-kmod_31+20240202-2ubuntu4_s390x.deb ...
203s Unpacking kmod (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ...
203s Preparing to unpack .../1-libkmod2_31+20240202-2ubuntu4_s390x.deb ...
203s Unpacking libkmod2:s390x (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ...
203s Preparing to unpack .../2-systemd-dev_255.4-1ubuntu5_all.deb ...
203s Unpacking systemd-dev (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
203s Preparing to unpack .../3-systemd-timesyncd_255.4-1ubuntu5_s390x.deb ...
203s Unpacking systemd-timesyncd (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
203s Preparing to unpack .../4-dbus-session-bus-common_1.14.10-4ubuntu2_all.deb ...
203s Unpacking dbus-session-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
203s Preparing to unpack .../5-libaudit-common_1%3a3.1.2-2.1_all.deb ...
203s Unpacking libaudit-common (1:3.1.2-2.1) over (1:3.1.2-2) ...
203s Setting up libaudit-common (1:3.1.2-2.1) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../libcap-ng0_0.8.4-2build1_s390x.deb ...
203s Unpacking libcap-ng0:s390x (0.8.4-2build1) over (0.8.4-2) ...
203s Setting up libcap-ng0:s390x (0.8.4-2build1) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../libaudit1_1%3a3.1.2-2.1_s390x.deb ...
203s Unpacking libaudit1:s390x (1:3.1.2-2.1) over (1:3.1.2-2) ...
203s Setting up libaudit1:s390x (1:3.1.2-2.1) ...
203s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
203s Preparing to unpack .../libpam0g_1.5.3-5ubuntu3_s390x.deb ...
203s Unpacking libpam0g:s390x (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ...
203s Setting up libpam0g:s390x (1.5.3-5ubuntu3) ...
204s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
204s Preparing to unpack .../libselinux1_3.5-2ubuntu1_s390x.deb ...
204s Unpacking libselinux1:s390x (3.5-2ubuntu1) over (3.5-2build1) ...
204s Setting up libselinux1:s390x (3.5-2ubuntu1) ...
204s dpkg: libcurl4:s390x: dependency problems, but removing anyway as you requested:
204s  s390-tools depends on libcurl4 (>= 7.16.2).
204s  curl depends on libcurl4 (= 8.5.0-2ubuntu2).
204s 
204s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
204s Removing libcurl4:s390x (8.5.0-2ubuntu2) ...
204s Selecting previously unselected package libcurl4t64:s390x.
204s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52162 files and directories currently installed.)
204s Preparing to unpack .../libcurl4t64_8.5.0-2ubuntu8_s390x.deb ...
204s Unpacking libcurl4t64:s390x (8.5.0-2ubuntu8) ...
204s Preparing to unpack .../curl_8.5.0-2ubuntu8_s390x.deb ...
204s Unpacking curl (8.5.0-2ubuntu8) over (8.5.0-2ubuntu2) ...
204s dpkg: libpsl5:s390x: dependency problems, but removing anyway as you requested:
204s  wget depends on libpsl5 (>= 0.16.0).
204s  libcurl3-gnutls:s390x depends on libpsl5 (>= 0.16.0).
204s 
204s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52168 files and directories currently installed.)
204s Removing libpsl5:s390x (0.21.2-1build1) ...
204s Selecting previously unselected package libpsl5t64:s390x.
204s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52163 files and directories currently installed.)
204s Preparing to unpack .../00-libpsl5t64_0.21.2-1.1_s390x.deb ...
204s Unpacking libpsl5t64:s390x (0.21.2-1.1) ...
204s Preparing to unpack .../01-wget_1.21.4-1ubuntu2_s390x.deb ...
204s Unpacking wget (1.21.4-1ubuntu2) over (1.21.4-1ubuntu1) ...
204s Preparing to unpack .../02-tnftp_20230507-2build1_s390x.deb ...
204s Unpacking tnftp (20230507-2build1) over (20230507-2) ...
204s Preparing to unpack .../03-tcpdump_4.99.4-3ubuntu2_s390x.deb ...
204s Unpacking tcpdump (4.99.4-3ubuntu2) over (4.99.4-3ubuntu1) ...
204s Preparing to unpack .../04-libsystemd-shared_255.4-1ubuntu5_s390x.deb ...
204s Unpacking libsystemd-shared:s390x (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
204s Preparing to unpack .../05-systemd-resolved_255.4-1ubuntu5_s390x.deb ...
204s Unpacking systemd-resolved (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
204s Preparing to unpack .../06-sudo_1.9.15p5-3ubuntu3_s390x.deb ...
204s Unpacking sudo (1.9.15p5-3ubuntu3) over (1.9.15p5-3ubuntu1) ...
204s Preparing to unpack .../07-rsync_3.2.7-1build1_s390x.deb ...
204s Unpacking rsync (3.2.7-1build1) over (3.2.7-1) ...
205s Preparing to unpack .../08-python3-cryptography_41.0.7-4build2_s390x.deb ...
205s Unpacking python3-cryptography (41.0.7-4build2) over (41.0.7-3) ...
205s Preparing to unpack .../09-openssl_3.0.13-0ubuntu2_s390x.deb ...
205s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ...
205s Preparing to unpack .../10-openssh-sftp-server_1%3a9.6p1-3ubuntu11_s390x.deb ...
205s Unpacking openssh-sftp-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ...
205s Preparing to unpack .../11-openssh-client_1%3a9.6p1-3ubuntu11_s390x.deb ...
205s Unpacking openssh-client (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ...
205s Preparing to unpack .../12-openssh-server_1%3a9.6p1-3ubuntu11_s390x.deb ...
205s Unpacking openssh-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ...
205s Preparing to unpack .../13-libssh-4_0.10.6-2build1_s390x.deb ...
205s Unpacking libssh-4:s390x (0.10.6-2build1) over (0.10.6-2) ...
205s Preparing to unpack .../14-libsasl2-modules_2.1.28+dfsg1-5ubuntu1_s390x.deb ...
205s Unpacking libsasl2-modules:s390x (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ...
205s Preparing to unpack .../15-python3.12_3.12.2-4build3_s390x.deb ...
205s Unpacking python3.12 (3.12.2-4build3) over (3.12.2-1) ...
205s Preparing to unpack .../16-python3.12-minimal_3.12.2-4build3_s390x.deb ...
205s Unpacking python3.12-minimal (3.12.2-4build3) over (3.12.2-1) ...
205s Preparing to unpack .../17-libpython3.12-minimal_3.12.2-4build3_s390x.deb ...
205s Unpacking libpython3.12-minimal:s390x (3.12.2-4build3) over (3.12.2-1) ...
206s dpkg: libparted2:s390x: dependency problems, but removing anyway as you requested:
206s  parted depends on libparted2 (= 3.6-3).
206s 
206s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52169 files and directories currently installed.)
206s Removing libparted2:s390x (3.6-3) ...
206s Selecting previously unselected package libparted2t64:s390x.
206s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52163 files and directories currently installed.)
206s Preparing to unpack .../00-libparted2t64_3.6-3.1build2_s390x.deb ...
206s Unpacking libparted2t64:s390x (3.6-3.1build2) ...
206s Preparing to unpack .../01-parted_3.6-3.1build2_s390x.deb ...
206s Unpacking parted (3.6-3.1build2) over (3.6-3) ...
206s Preparing to unpack .../02-python3.11_3.11.8-1build4_s390x.deb ...
206s Unpacking python3.11 (3.11.8-1build4) over (3.11.8-1) ...
206s Preparing to unpack .../03-python3.11-minimal_3.11.8-1build4_s390x.deb ...
206s Unpacking python3.11-minimal (3.11.8-1build4) over (3.11.8-1) ...
206s Preparing to unpack .../04-libpython3.11-minimal_3.11.8-1build4_s390x.deb ...
206s Unpacking libpython3.11-minimal:s390x (3.11.8-1build4) over (3.11.8-1) ...
206s Preparing to unpack .../05-libpython3.11-stdlib_3.11.8-1build4_s390x.deb ...
206s Unpacking libpython3.11-stdlib:s390x (3.11.8-1build4) over (3.11.8-1) ...
206s Preparing to unpack .../06-shared-mime-info_2.4-1build1_s390x.deb ...
206s Unpacking shared-mime-info (2.4-1build1) over (2.4-1) ...
206s Preparing to unpack .../07-gir1.2-girepository-2.0_1.79.1-1ubuntu6_s390x.deb ...
206s Unpacking gir1.2-girepository-2.0:s390x (1.79.1-1ubuntu6) over (1.79.1-1) ...
207s Preparing to unpack .../08-gir1.2-glib-2.0_2.79.3-3ubuntu5_s390x.deb ...
207s Unpacking gir1.2-glib-2.0:s390x (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ...
207s Preparing to unpack .../09-libgirepository-1.0-1_1.79.1-1ubuntu6_s390x.deb ...
207s Unpacking libgirepository-1.0-1:s390x (1.79.1-1ubuntu6) over (1.79.1-1) ...
207s Preparing to unpack .../10-python3-gi_3.47.0-3build1_s390x.deb ...
207s Unpacking python3-gi (3.47.0-3build1) over (3.47.0-3) ...
207s Preparing to unpack .../11-python3-dbus_1.3.2-5build2_s390x.deb ...
207s Unpacking python3-dbus (1.3.2-5build2) over (1.3.2-5build1) ...
207s Selecting previously unselected package libnetplan1:s390x.
207s Preparing to unpack .../12-libnetplan1_1.0-1_s390x.deb ...
207s Unpacking libnetplan1:s390x (1.0-1) ...
207s Preparing to unpack .../13-python3-netplan_1.0-1_s390x.deb ...
207s Unpacking python3-netplan (1.0-1) over (0.107.1-3) ...
207s Preparing to unpack .../14-netplan-generator_1.0-1_s390x.deb ...
207s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator'
207s Unpacking netplan-generator (1.0-1) over (0.107.1-3) ...
207s Preparing to unpack .../15-initramfs-tools-bin_0.142ubuntu23_s390x.deb ...
207s Unpacking initramfs-tools-bin (0.142ubuntu23) over (0.142ubuntu20) ...
207s Preparing to unpack .../16-initramfs-tools-core_0.142ubuntu23_all.deb ...
207s Unpacking initramfs-tools-core (0.142ubuntu23) over (0.142ubuntu20) ...
207s Preparing to unpack .../17-initramfs-tools_0.142ubuntu23_all.deb ...
207s Unpacking initramfs-tools (0.142ubuntu23) over (0.142ubuntu20) ...
207s Preparing to unpack .../18-netplan.io_1.0-1_s390x.deb ...
207s Unpacking netplan.io (1.0-1) over (0.107.1-3) ...
207s Preparing to unpack .../19-libxmlb2_0.3.15-1build1_s390x.deb ...
207s Unpacking libxmlb2:s390x (0.3.15-1build1) over (0.3.15-1) ...
208s dpkg: libgpgme11:s390x: dependency problems, but removing anyway as you requested:
208s  libvolume-key1:s390x depends on libgpgme11 (>= 1.4.1).
208s  libjcat1:s390x depends on libgpgme11 (>= 1.2.0).
208s 
208s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52172 files and directories currently installed.)
208s Removing libgpgme11:s390x (1.18.0-4ubuntu1) ...
208s Selecting previously unselected package libgpgme11t64:s390x.
208s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52166 files and directories currently installed.)
208s Preparing to unpack .../00-libgpgme11t64_1.18.0-4.1ubuntu3_s390x.deb ...
208s Unpacking libgpgme11t64:s390x (1.18.0-4.1ubuntu3) ...
208s Preparing to unpack .../01-libvolume-key1_0.3.12-7build1_s390x.deb ...
208s Unpacking libvolume-key1:s390x (0.3.12-7build1) over (0.3.12-5build2) ...
208s Preparing to unpack .../02-libqrtr-glib0_1.2.2-1ubuntu3_s390x.deb ...
208s Unpacking libqrtr-glib0:s390x (1.2.2-1ubuntu3) over (1.2.2-1ubuntu2) ...
208s Preparing to unpack .../03-libqmi-glib5_1.35.2-0ubuntu1_s390x.deb ...
208s Unpacking libqmi-glib5:s390x (1.35.2-0ubuntu1) over (1.34.0-2) ...
208s Preparing to unpack .../04-libqmi-proxy_1.35.2-0ubuntu1_s390x.deb ...
208s Unpacking libqmi-proxy (1.35.2-0ubuntu1) over (1.34.0-2) ...
208s Preparing to unpack .../05-libpolkit-agent-1-0_124-1ubuntu1_s390x.deb ...
208s Unpacking libpolkit-agent-1-0:s390x (124-1ubuntu1) over (124-1) ...
208s Preparing to unpack .../06-libpolkit-gobject-1-0_124-1ubuntu1_s390x.deb ...
208s Unpacking libpolkit-gobject-1-0:s390x (124-1ubuntu1) over (124-1) ...
208s Preparing to unpack .../07-libmm-glib0_1.23.4-0ubuntu1_s390x.deb ...
208s Unpacking libmm-glib0:s390x (1.23.4-0ubuntu1) over (1.22.0-3) ...
208s Preparing to unpack .../08-libmbim-glib4_1.31.2-0ubuntu2_s390x.deb ...
208s Unpacking libmbim-glib4:s390x (1.31.2-0ubuntu2) over (1.30.0-1) ...
208s Preparing to unpack .../09-libmbim-proxy_1.31.2-0ubuntu2_s390x.deb ...
208s Unpacking libmbim-proxy (1.31.2-0ubuntu2) over (1.30.0-1) ...
208s Preparing to unpack .../10-libjson-glib-1.0-common_1.8.0-2build1_all.deb ...
208s Unpacking libjson-glib-1.0-common (1.8.0-2build1) over (1.8.0-2) ...
208s Preparing to unpack .../11-libjson-glib-1.0-0_1.8.0-2build1_s390x.deb ...
208s Unpacking libjson-glib-1.0-0:s390x (1.8.0-2build1) over (1.8.0-2) ...
208s Preparing to unpack .../12-libgusb2_0.4.8-1build1_s390x.deb ...
208s Unpacking libgusb2:s390x (0.4.8-1build1) over (0.4.8-1) ...
208s Preparing to unpack .../13-libgudev-1.0-0_1%3a238-3ubuntu2_s390x.deb ...
208s Unpacking libgudev-1.0-0:s390x (1:238-3ubuntu2) over (1:238-3) ...
208s dpkg: libarchive13:s390x: dependency problems, but removing anyway as you requested:
208s  fwupd depends on libarchive13 (>= 3.2.1).
208s 
208s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52173 files and directories currently installed.)
208s Removing libarchive13:s390x (3.7.2-1ubuntu2) ...
208s Selecting previously unselected package libarchive13t64:s390x.
208s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
208s Preparing to unpack .../libarchive13t64_3.7.2-1.1ubuntu2_s390x.deb ...
208s Unpacking libarchive13t64:s390x (3.7.2-1.1ubuntu2) ...
208s Preparing to unpack .../fwupd_1.9.15-2_s390x.deb ...
208s Unpacking fwupd (1.9.15-2) over (1.9.14-1) ...
209s dpkg: libcurl3-gnutls:s390x: dependency problems, but removing anyway as you requested:
209s  libfwupd2:s390x depends on libcurl3-gnutls (>= 7.63.0).
209s 
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52174 files and directories currently installed.)
209s Removing libcurl3-gnutls:s390x (8.5.0-2ubuntu2) ...
209s Selecting previously unselected package libcurl3t64-gnutls:s390x.
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
209s Preparing to unpack .../0-libcurl3t64-gnutls_8.5.0-2ubuntu8_s390x.deb ...
209s Unpacking libcurl3t64-gnutls:s390x (8.5.0-2ubuntu8) ...
209s Preparing to unpack .../1-libfwupd2_1.9.15-2_s390x.deb ...
209s Unpacking libfwupd2:s390x (1.9.15-2) over (1.9.14-1) ...
209s Preparing to unpack .../2-libblockdev3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../3-libblockdev-utils3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-utils3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../4-libblockdev-swap3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-swap3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../5-libblockdev-part3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-part3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s dpkg: libnvme1: dependency problems, but removing anyway as you requested:
209s  libblockdev-nvme3:s390x depends on libnvme1 (>= 1.7.1).
209s 
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52174 files and directories currently installed.)
209s Removing libnvme1 (1.8-2) ...
209s Selecting previously unselected package libnvme1t64.
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52167 files and directories currently installed.)
209s Preparing to unpack .../0-libnvme1t64_1.8-3_s390x.deb ...
209s Unpacking libnvme1t64 (1.8-3) ...
209s Preparing to unpack .../1-libblockdev-nvme3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-nvme3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../2-libblockdev-mdraid3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-mdraid3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../3-libblockdev-loop3_3.1.0-1build1_s390x.deb ...
209s Unpacking libblockdev-loop3:s390x (3.1.0-1build1) over (3.1.0-1) ...
209s Preparing to unpack .../4-e2fsprogs-l10n_1.47.0-2.4~exp1ubuntu2_all.deb ...
209s Unpacking e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ...
209s Preparing to unpack .../5-logsave_1.47.0-2.4~exp1ubuntu2_s390x.deb ...
209s Unpacking logsave (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ...
209s dpkg: libext2fs2:s390x: dependency problems, but removing anyway as you requested:
209s  libblockdev-fs3:s390x depends on libext2fs2 (>= 1.42.11).
209s  e2fsprogs depends on libext2fs2 (= 1.47.0-2ubuntu1).
209s  btrfs-progs depends on libext2fs2 (>= 1.42).
209s 
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52175 files and directories currently installed.)
209s Removing libext2fs2:s390x (1.47.0-2ubuntu1) ...
209s Selecting previously unselected package libext2fs2t64:s390x.
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52168 files and directories currently installed.)
209s Preparing to unpack .../libext2fs2t64_1.47.0-2.4~exp1ubuntu2_s390x.deb ...
209s Adding 'diversion of /lib/s390x-linux-gnu/libe2p.so.2 to /lib/s390x-linux-gnu/libe2p.so.2.usr-is-merged by libext2fs2t64'
209s Adding 'diversion of /lib/s390x-linux-gnu/libe2p.so.2.3 to /lib/s390x-linux-gnu/libe2p.so.2.3.usr-is-merged by libext2fs2t64'
209s Adding 'diversion of /lib/s390x-linux-gnu/libext2fs.so.2 to /lib/s390x-linux-gnu/libext2fs.so.2.usr-is-merged by libext2fs2t64'
209s Adding 'diversion of /lib/s390x-linux-gnu/libext2fs.so.2.4 to /lib/s390x-linux-gnu/libext2fs.so.2.4.usr-is-merged by libext2fs2t64'
209s Unpacking libext2fs2t64:s390x (1.47.0-2.4~exp1ubuntu2) ...
209s Setting up libcom-err2:s390x (1.47.0-2.4~exp1ubuntu2) ...
209s Setting up libext2fs2t64:s390x (1.47.0-2.4~exp1ubuntu2) ...
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52184 files and directories currently installed.)
209s Preparing to unpack .../e2fsprogs_1.47.0-2.4~exp1ubuntu2_s390x.deb ...
209s Unpacking e2fsprogs (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ...
209s dpkg: libreiserfscore0: dependency problems, but removing anyway as you requested:
209s  btrfs-progs depends on libreiserfscore0 (>= 1:3.6.27).
209s 
209s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52184 files and directories currently installed.)
209s Removing libreiserfscore0 (1:3.6.27-7) ...
210s Selecting previously unselected package libreiserfscore0t64.
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52179 files and directories currently installed.)
210s Preparing to unpack .../libreiserfscore0t64_1%3a3.6.27-7.1_s390x.deb ...
210s Unpacking libreiserfscore0t64 (1:3.6.27-7.1) ...
210s Preparing to unpack .../btrfs-progs_6.6.3-1.1build1_s390x.deb ...
210s Unpacking btrfs-progs (6.6.3-1.1build1) over (6.6.3-1.1) ...
210s Preparing to unpack .../libblockdev-fs3_3.1.0-1build1_s390x.deb ...
210s Unpacking libblockdev-fs3:s390x (3.1.0-1build1) over (3.1.0-1) ...
210s Preparing to unpack .../libblockdev-crypto3_3.1.0-1build1_s390x.deb ...
210s Unpacking libblockdev-crypto3:s390x (3.1.0-1build1) over (3.1.0-1) ...
210s Preparing to unpack .../bolt_0.9.6-2build1_s390x.deb ...
210s Unpacking bolt (0.9.6-2build1) over (0.9.6-2) ...
210s dpkg: libglib2.0-0:s390x: dependency problems, but removing anyway as you requested:
210s  s390-tools depends on libglib2.0-0 (>= 2.77.0).
210s  libnetplan0:s390x depends on libglib2.0-0 (>= 2.75.3).
210s  libjcat1:s390x depends on libglib2.0-0 (>= 2.75.3).
210s 
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52185 files and directories currently installed.)
210s Removing libglib2.0-0:s390x (2.79.2-1~ubuntu1) ...
210s Selecting previously unselected package libglib2.0-0t64:s390x.
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52160 files and directories currently installed.)
210s Preparing to unpack .../0-libglib2.0-0t64_2.79.3-3ubuntu5_s390x.deb ...
210s libglib2.0-0t64.preinst: Removing /var/lib/dpkg/info/libglib2.0-0:s390x.postrm to avoid loss of /usr/share/glib-2.0/schemas/gschemas.compiled...
210s removed '/var/lib/dpkg/info/libglib2.0-0:s390x.postrm'
210s Unpacking libglib2.0-0t64:s390x (2.79.3-3ubuntu5) ...
210s Preparing to unpack .../1-libjcat1_0.2.0-2build2_s390x.deb ...
210s Unpacking libjcat1:s390x (0.2.0-2build2) over (0.2.0-2) ...
210s Preparing to unpack .../2-libldap2_2.6.7+dfsg-1~exp1ubuntu6_s390x.deb ...
210s Unpacking libldap2:s390x (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ...
210s Preparing to unpack .../3-ubuntu-pro-client-l10n_31.2.2_s390x.deb ...
210s Unpacking ubuntu-pro-client-l10n (31.2.2) over (31.1) ...
210s Preparing to unpack .../4-ubuntu-pro-client_31.2.2_s390x.deb ...
210s Unpacking ubuntu-pro-client (31.2.2) over (31.1) ...
210s Preparing to unpack .../5-gnupg-utils_2.4.4-2ubuntu15_s390x.deb ...
210s Unpacking gnupg-utils (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
210s Preparing to unpack .../6-keyboxd_2.4.4-2ubuntu15_s390x.deb ...
210s Unpacking keyboxd (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
210s dpkg: libnpth0:s390x: dependency problems, but removing anyway as you requested:
210s  gpgv depends on libnpth0 (>= 0.90).
210s  gpgsm depends on libnpth0 (>= 0.90).
210s  gpg-agent depends on libnpth0 (>= 0.90).
210s  gpg depends on libnpth0 (>= 0.90).
210s  dirmngr depends on libnpth0 (>= 0.90).
210s 
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52185 files and directories currently installed.)
210s Removing libnpth0:s390x (1.6-3build2) ...
210s Selecting previously unselected package libnpth0t64:s390x.
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52180 files and directories currently installed.)
210s Preparing to unpack .../libnpth0t64_1.6-3.1_s390x.deb ...
210s Unpacking libnpth0t64:s390x (1.6-3.1) ...
210s Setting up libnpth0t64:s390x (1.6-3.1) ...
210s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52186 files and directories currently installed.)
210s Preparing to unpack .../gpgv_2.4.4-2ubuntu15_s390x.deb ...
210s Unpacking gpgv (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
210s Setting up gpgv (2.4.4-2ubuntu15) ...
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52186 files and directories currently installed.)
211s Preparing to unpack .../0-gpg-wks-client_2.4.4-2ubuntu15_s390x.deb ...
211s Unpacking gpg-wks-client (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
211s Preparing to unpack .../1-gpg-agent_2.4.4-2ubuntu15_s390x.deb ...
211s Unpacking gpg-agent (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
211s Preparing to unpack .../2-gpg_2.4.4-2ubuntu15_s390x.deb ...
211s Unpacking gpg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
211s Preparing to unpack .../3-dirmngr_2.4.4-2ubuntu15_s390x.deb ...
211s Unpacking dirmngr (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
211s Preparing to unpack .../4-gnupg_2.4.4-2ubuntu15_all.deb ...
211s Unpacking gnupg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
211s Preparing to unpack .../5-python3-apt_2.7.7_s390x.deb ...
211s Unpacking python3-apt (2.7.7) over (2.7.6) ...
211s Preparing to unpack .../6-apt-utils_2.7.14_s390x.deb ...
211s Unpacking apt-utils (2.7.14) over (2.7.12) ...
211s dpkg: libapt-pkg6.0:s390x: dependency problems, but removing anyway as you requested:
211s  apt depends on libapt-pkg6.0 (>= 2.7.12).
211s 
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52184 files and directories currently installed.)
211s Removing libapt-pkg6.0:s390x (2.7.12) ...
211s dpkg: libnettle8:s390x: dependency problems, but removing anyway as you requested:
211s  libhogweed6:s390x depends on libnettle8.
211s  libgnutls30:s390x depends on libnettle8 (>= 3.9~).
211s 
211s Removing libnettle8:s390x (3.9.1-2) ...
211s Selecting previously unselected package libapt-pkg6.0t64:s390x.
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52128 files and directories currently installed.)
211s Preparing to unpack .../libapt-pkg6.0t64_2.7.14_s390x.deb ...
211s Unpacking libapt-pkg6.0t64:s390x (2.7.14) ...
211s Setting up libapt-pkg6.0t64:s390x (2.7.14) ...
211s Selecting previously unselected package libnettle8t64:s390x.
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52178 files and directories currently installed.)
211s Preparing to unpack .../libnettle8t64_3.9.1-2.2_s390x.deb ...
211s Unpacking libnettle8t64:s390x (3.9.1-2.2) ...
211s Setting up libnettle8t64:s390x (3.9.1-2.2) ...
211s dpkg: libhogweed6:s390x: dependency problems, but removing anyway as you requested:
211s  libgnutls30:s390x depends on libhogweed6 (>= 3.6).
211s 
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52186 files and directories currently installed.)
211s Removing libhogweed6:s390x (3.9.1-2) ...
211s Selecting previously unselected package libhogweed6t64:s390x.
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52181 files and directories currently installed.)
211s Preparing to unpack .../libhogweed6t64_3.9.1-2.2_s390x.deb ...
211s Unpacking libhogweed6t64:s390x (3.9.1-2.2) ...
211s Setting up libhogweed6t64:s390x (3.9.1-2.2) ...
211s dpkg: libgnutls30:s390x: dependency problems, but removing anyway as you requested:
211s  apt depends on libgnutls30 (>= 3.8.1).
211s 
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52187 files and directories currently installed.)
211s Removing libgnutls30:s390x (3.8.3-1ubuntu1) ...
211s Selecting previously unselected package libgnutls30t64:s390x.
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52178 files and directories currently installed.)
211s Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu2_s390x.deb ...
211s Unpacking libgnutls30t64:s390x (3.8.3-1.1ubuntu2) ...
211s Setting up libgnutls30t64:s390x (3.8.3-1.1ubuntu2) ...
211s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52206 files and directories currently installed.)
211s Preparing to unpack .../archives/apt_2.7.14_s390x.deb ...
212s Unpacking apt (2.7.14) over (2.7.12) ...
212s Setting up apt (2.7.14) ...
212s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52206 files and directories currently installed.)
212s Preparing to unpack .../gpgconf_2.4.4-2ubuntu15_s390x.deb ...
212s Unpacking gpgconf (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
212s Preparing to unpack .../gpgsm_2.4.4-2ubuntu15_s390x.deb ...
212s Unpacking gpgsm (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
212s dpkg: libreadline8:s390x: dependency problems, but removing anyway as you requested:
212s  libpython3.12-stdlib:s390x depends on libreadline8 (>= 7.0~beta).
212s  gawk depends on libreadline8 (>= 6.0).
212s  fdisk depends on libreadline8 (>= 6.0).
212s 
212s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52206 files and directories currently installed.)
212s Removing libreadline8:s390x (8.2-3) ...
212s Selecting previously unselected package libreadline8t64:s390x.
212s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52194 files and directories currently installed.)
212s Preparing to unpack .../libreadline8t64_8.2-4_s390x.deb ...
212s Adding 'diversion of /lib/s390x-linux-gnu/libhistory.so.8 to /lib/s390x-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64'
212s Adding 'diversion of /lib/s390x-linux-gnu/libhistory.so.8.2 to /lib/s390x-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64'
212s Adding 'diversion of /lib/s390x-linux-gnu/libreadline.so.8 to /lib/s390x-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64'
212s Adding 'diversion of /lib/s390x-linux-gnu/libreadline.so.8.2 to /lib/s390x-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64'
213s Unpacking libreadline8t64:s390x (8.2-4) ...
213s Setting up libreadline8t64:s390x (8.2-4) ...
213s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52214 files and directories currently installed.)
213s Preparing to unpack .../gawk_1%3a5.2.1-2build2_s390x.deb ...
213s Unpacking gawk (1:5.2.1-2build2) over (1:5.2.1-2) ...
213s Preparing to unpack .../fdisk_2.39.3-9ubuntu2_s390x.deb ...
213s Unpacking fdisk (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
213s Preparing to unpack .../libpython3.12-stdlib_3.12.2-4build3_s390x.deb ...
213s Unpacking libpython3.12-stdlib:s390x (3.12.2-4build3) over (3.12.2-1) ...
213s Preparing to unpack .../perl-base_5.38.2-3.2_s390x.deb ...
213s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ...
213s Setting up perl-base (5.38.2-3.2) ...
213s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52212 files and directories currently installed.)
213s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ...
213s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ...
214s Preparing to unpack .../python3-gdbm_3.12.2-3ubuntu1.1_s390x.deb ...
214s Unpacking python3-gdbm:s390x (3.12.2-3ubuntu1.1) over (3.11.5-1) ...
214s Preparing to unpack .../man-db_2.12.0-3build4_s390x.deb ...
214s Unpacking man-db (2.12.0-3build4) over (2.12.0-3) ...
214s dpkg: libgdbm-compat4:s390x: dependency problems, but removing anyway as you requested:
214s  libperl5.38:s390x depends on libgdbm-compat4 (>= 1.18-3).
214s 
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52212 files and directories currently installed.)
214s Removing libgdbm-compat4:s390x (1.23-5) ...
214s dpkg: libgdbm6:s390x: dependency problems, but removing anyway as you requested:
214s  libperl5.38:s390x depends on libgdbm6 (>= 1.21).
214s 
214s Removing libgdbm6:s390x (1.23-5) ...
214s Selecting previously unselected package libgdbm6t64:s390x.
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52202 files and directories currently installed.)
214s Preparing to unpack .../libgdbm6t64_1.23-5.1_s390x.deb ...
214s Unpacking libgdbm6t64:s390x (1.23-5.1) ...
214s Selecting previously unselected package libgdbm-compat4t64:s390x.
214s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_s390x.deb ...
214s Unpacking libgdbm-compat4t64:s390x (1.23-5.1) ...
214s dpkg: libperl5.38:s390x: dependency problems, but removing anyway as you requested:
214s  perl depends on libperl5.38 (= 5.38.2-3).
214s 
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52214 files and directories currently installed.)
214s Removing libperl5.38:s390x (5.38.2-3) ...
214s Selecting previously unselected package libperl5.38t64:s390x.
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 51692 files and directories currently installed.)
214s Preparing to unpack .../libperl5.38t64_5.38.2-3.2_s390x.deb ...
214s Unpacking libperl5.38t64:s390x (5.38.2-3.2) ...
214s Preparing to unpack .../perl_5.38.2-3.2_s390x.deb ...
214s Unpacking perl (5.38.2-3.2) over (5.38.2-3) ...
214s dpkg: libdb5.3:s390x: dependency problems, but removing anyway as you requested:
214s  libsasl2-modules-db:s390x depends on libdb5.3.
214s  libpam-modules:s390x depends on libdb5.3.
214s  iproute2 depends on libdb5.3.
214s 
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52214 files and directories currently installed.)
214s Removing libdb5.3:s390x (5.3.28+dfsg2-4) ...
214s Selecting previously unselected package libdb5.3t64:s390x.
214s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52208 files and directories currently installed.)
214s Preparing to unpack .../0-libdb5.3t64_5.3.28+dfsg2-6_s390x.deb ...
214s Unpacking libdb5.3t64:s390x (5.3.28+dfsg2-6) ...
215s Preparing to unpack .../1-libsasl2-modules-db_2.1.28+dfsg1-5ubuntu1_s390x.deb ...
215s Unpacking libsasl2-modules-db:s390x (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ...
215s Preparing to unpack .../2-libsasl2-2_2.1.28+dfsg1-5ubuntu1_s390x.deb ...
215s Unpacking libsasl2-2:s390x (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ...
215s Preparing to unpack .../3-libfido2-1_1.14.0-1build1_s390x.deb ...
215s Unpacking libfido2-1:s390x (1.14.0-1build1) over (1.14.0-1) ...
215s Preparing to unpack .../4-libcryptsetup12_2%3a2.7.0-1ubuntu2_s390x.deb ...
215s Unpacking libcryptsetup12:s390x (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ...
215s Preparing to unpack .../5-dhcpcd-base_1%3a10.0.6-1ubuntu2_s390x.deb ...
215s Unpacking dhcpcd-base (1:10.0.6-1ubuntu2) over (1:10.0.6-1ubuntu1) ...
215s dpkg: libuv1:s390x: dependency problems, but removing anyway as you requested:
215s  bind9-libs:s390x depends on libuv1 (>= 1.40.0).
215s 
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52214 files and directories currently installed.)
215s Removing libuv1:s390x (1.48.0-1) ...
215s Selecting previously unselected package libuv1t64:s390x.
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52209 files and directories currently installed.)
215s Preparing to unpack .../libuv1t64_1.48.0-1.1_s390x.deb ...
215s Unpacking libuv1t64:s390x (1.48.0-1.1) ...
215s Preparing to unpack .../bind9-host_1%3a9.18.24-0ubuntu3_s390x.deb ...
215s Unpacking bind9-host (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ...
215s Preparing to unpack .../bind9-dnsutils_1%3a9.18.24-0ubuntu3_s390x.deb ...
215s Unpacking bind9-dnsutils (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ...
215s Preparing to unpack .../bind9-libs_1%3a9.18.24-0ubuntu3_s390x.deb ...
215s Unpacking bind9-libs:s390x (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ...
215s dpkg: libssl3:s390x: dependency problems, but removing anyway as you requested:
215s  systemd depends on libssl3 (>= 3.0.0).
215s  s390-tools depends on libssl3 (>= 3.0.0).
215s  linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0).
215s 
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
215s Removing libssl3:s390x (3.0.10-1ubuntu4) ...
215s Selecting previously unselected package libssl3t64:s390x.
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52204 files and directories currently installed.)
215s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_s390x.deb ...
215s Unpacking libssl3t64:s390x (3.0.13-0ubuntu2) ...
215s Setting up libssl3t64:s390x (3.0.13-0ubuntu2) ...
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
215s Preparing to unpack .../libnss-systemd_255.4-1ubuntu5_s390x.deb ...
215s Unpacking libnss-systemd:s390x (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
215s Preparing to unpack .../libudev1_255.4-1ubuntu5_s390x.deb ...
215s Unpacking libudev1:s390x (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
215s Setting up libudev1:s390x (255.4-1ubuntu5) ...
215s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
215s Preparing to unpack .../systemd_255.4-1ubuntu5_s390x.deb ...
215s Unpacking systemd (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
216s Preparing to unpack .../udev_255.4-1ubuntu5_s390x.deb ...
216s Unpacking udev (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
216s Preparing to unpack .../libsystemd0_255.4-1ubuntu5_s390x.deb ...
216s Unpacking libsystemd0:s390x (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
216s Setting up libsystemd0:s390x (255.4-1ubuntu5) ...
216s Setting up libcryptsetup12:s390x (2:2.7.0-1ubuntu2) ...
216s Setting up libkmod2:s390x (31+20240202-2ubuntu4) ...
216s Setting up libsystemd-shared:s390x (255.4-1ubuntu5) ...
216s Setting up systemd-dev (255.4-1ubuntu5) ...
216s Setting up systemd (255.4-1ubuntu5) ...
217s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
217s Preparing to unpack .../systemd-sysv_255.4-1ubuntu5_s390x.deb ...
217s Unpacking systemd-sysv (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
217s Preparing to unpack .../libpam-systemd_255.4-1ubuntu5_s390x.deb ...
217s Unpacking libpam-systemd:s390x (255.4-1ubuntu5) over (255.2-3ubuntu2) ...
217s Preparing to unpack .../libpam-modules-bin_1.5.3-5ubuntu3_s390x.deb ...
217s Unpacking libpam-modules-bin (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ...
217s Setting up libpam-modules-bin (1.5.3-5ubuntu3) ...
217s pam_namespace.service is a disabled or a static unit not running, not starting it.
217s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
217s Preparing to unpack .../libpam-modules_1.5.3-5ubuntu3_s390x.deb ...
217s Unpacking libpam-modules:s390x (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ...
218s Setting up libpam-modules:s390x (1.5.3-5ubuntu3) ...
218s Installing new version of config file /etc/security/namespace.init ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../libpam-runtime_1.5.3-5ubuntu3_all.deb ...
218s Unpacking libpam-runtime (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ...
218s Setting up libpam-runtime (1.5.3-5ubuntu3) ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../0-dbus-user-session_1.14.10-4ubuntu2_s390x.deb ...
218s Unpacking dbus-user-session (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../1-libapparmor1_4.0.0-beta3-0ubuntu2_s390x.deb ...
218s Unpacking libapparmor1:s390x (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ...
218s Preparing to unpack .../2-libexpat1_2.6.1-2_s390x.deb ...
218s Unpacking libexpat1:s390x (2.6.1-2) over (2.6.0-1) ...
218s Preparing to unpack .../3-dbus-system-bus-common_1.14.10-4ubuntu2_all.deb ...
218s Unpacking dbus-system-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../4-dbus-bin_1.14.10-4ubuntu2_s390x.deb ...
218s Unpacking dbus-bin (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../5-dbus_1.14.10-4ubuntu2_s390x.deb ...
218s Unpacking dbus (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../6-dbus-daemon_1.14.10-4ubuntu2_s390x.deb ...
218s Unpacking dbus-daemon (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../7-libdbus-1-3_1.14.10-4ubuntu2_s390x.deb ...
218s Unpacking libdbus-1-3:s390x (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ...
218s Preparing to unpack .../8-libmount1_2.39.3-9ubuntu2_s390x.deb ...
218s Unpacking libmount1:s390x (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
218s Setting up libmount1:s390x (2.39.3-9ubuntu2) ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../libseccomp2_2.5.5-1ubuntu2_s390x.deb ...
218s Unpacking libseccomp2:s390x (2.5.5-1ubuntu2) over (2.5.5-1ubuntu1) ...
218s Setting up libseccomp2:s390x (2.5.5-1ubuntu2) ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.185-3ubuntu2_s390x.deb ...
218s Unpacking libdevmapper1.02.1:s390x (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ...
218s Preparing to unpack .../libuuid1_2.39.3-9ubuntu2_s390x.deb ...
218s Unpacking libuuid1:s390x (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
218s Setting up libuuid1:s390x (2.39.3-9ubuntu2) ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../libfdisk1_2.39.3-9ubuntu2_s390x.deb ...
218s Unpacking libfdisk1:s390x (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
218s Preparing to unpack .../mount_2.39.3-9ubuntu2_s390x.deb ...
218s Unpacking mount (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
218s Preparing to unpack .../libsqlite3-0_3.45.1-1ubuntu1_s390x.deb ...
218s Unpacking libsqlite3-0:s390x (3.45.1-1ubuntu1) over (3.45.1-1) ...
218s Preparing to unpack .../gcc-14-base_14-20240315-1ubuntu1_s390x.deb ...
218s Unpacking gcc-14-base:s390x (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ...
218s Setting up gcc-14-base:s390x (14-20240315-1ubuntu1) ...
218s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
218s Preparing to unpack .../libgcc-s1_14-20240315-1ubuntu1_s390x.deb ...
218s Unpacking libgcc-s1:s390x (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ...
219s Setting up libgcc-s1:s390x (14-20240315-1ubuntu1) ...
219s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
219s Preparing to unpack .../libstdc++6_14-20240315-1ubuntu1_s390x.deb ...
219s Unpacking libstdc++6:s390x (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ...
219s Setting up libstdc++6:s390x (14-20240315-1ubuntu1) ...
219s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
219s Preparing to unpack .../dpkg_1.22.6ubuntu5_s390x.deb ...
219s Unpacking dpkg (1.22.6ubuntu5) over (1.22.4ubuntu5) ...
219s Setting up dpkg (1.22.6ubuntu5) ...
219s Setting up libpython3.12-minimal:s390x (3.12.2-4build3) ...
219s Setting up libexpat1:s390x (2.6.1-2) ...
219s Setting up python3.12-minimal (3.12.2-4build3) ...
221s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
221s Preparing to unpack .../python3-minimal_3.12.2-0ubuntu1_s390x.deb ...
221s Unpacking python3-minimal (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ...
221s Setting up python3-minimal (3.12.2-0ubuntu1) ...
221s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
221s Preparing to unpack .../python3_3.12.2-0ubuntu1_s390x.deb ...
221s Unpacking python3 (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ...
221s Preparing to unpack .../libpython3-stdlib_3.12.2-0ubuntu1_s390x.deb ...
221s Unpacking libpython3-stdlib:s390x (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ...
221s Preparing to unpack .../libsmartcols1_2.39.3-9ubuntu2_s390x.deb ...
221s Unpacking libsmartcols1:s390x (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
221s Setting up libsmartcols1:s390x (2.39.3-9ubuntu2) ...
221s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
221s Preparing to unpack .../0-bsdextrautils_2.39.3-9ubuntu2_s390x.deb ...
221s Unpacking bsdextrautils (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
221s Preparing to unpack .../1-groff-base_1.23.0-3build1_s390x.deb ...
221s Unpacking groff-base (1.23.0-3build1) over (1.23.0-3) ...
221s Preparing to unpack .../2-pinentry-curses_1.2.1-3ubuntu4_s390x.deb ...
221s Unpacking pinentry-curses (1.2.1-3ubuntu4) over (1.2.1-3ubuntu1) ...
221s Preparing to unpack .../3-readline-common_8.2-4_all.deb ...
221s Unpacking readline-common (8.2-4) over (8.2-3) ...
221s Preparing to unpack .../4-libxml2_2.9.14+dfsg-1.3ubuntu2_s390x.deb ...
221s Unpacking libxml2:s390x (2.9.14+dfsg-1.3ubuntu2) over (2.9.14+dfsg-1.3ubuntu1) ...
221s Preparing to unpack .../5-libbpf1_1%3a1.3.0-2build1_s390x.deb ...
221s Unpacking libbpf1:s390x (1:1.3.0-2build1) over (1:1.3.0-2) ...
221s dpkg: libelf1:s390x: dependency problems, but removing anyway as you requested:
221s  linux-headers-6.8.0-11-generic depends on libelf1 (>= 0.144).
221s  iproute2 depends on libelf1 (>= 0.131).
221s 
221s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
221s Removing libelf1:s390x (0.190-1) ...
221s Selecting previously unselected package libelf1t64:s390x.
221s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52210 files and directories currently installed.)
221s Preparing to unpack .../libelf1t64_0.190-1.1build2_s390x.deb ...
221s Unpacking libelf1t64:s390x (0.190-1.1build2) ...
221s Preparing to unpack .../libtirpc-common_1.3.4+ds-1.1_all.deb ...
221s Unpacking libtirpc-common (1.3.4+ds-1.1) over (1.3.4+ds-1build1) ...
222s Preparing to unpack .../lsof_4.95.0-1build2_s390x.deb ...
222s Unpacking lsof (4.95.0-1build2) over (4.95.0-1build1) ...
222s Preparing to unpack .../libnsl2_1.3.0-3build2_s390x.deb ...
222s Unpacking libnsl2:s390x (1.3.0-3build2) over (1.3.0-3) ...
222s dpkg: libtirpc3:s390x: dependency problems, but removing anyway as you requested:
222s  iproute2 depends on libtirpc3 (>= 1.0.2).
222s 
222s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
222s Removing libtirpc3:s390x (1.3.4+ds-1build1) ...
222s Selecting previously unselected package libtirpc3t64:s390x.
222s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52209 files and directories currently installed.)
222s Preparing to unpack .../0-libtirpc3t64_1.3.4+ds-1.1_s390x.deb ...
222s Adding 'diversion of /lib/s390x-linux-gnu/libtirpc.so.3 to /lib/s390x-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64'
222s Adding 'diversion of /lib/s390x-linux-gnu/libtirpc.so.3.0.0 to /lib/s390x-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64'
222s Unpacking libtirpc3t64:s390x (1.3.4+ds-1.1) ...
222s Preparing to unpack .../1-iproute2_6.1.0-1ubuntu5_s390x.deb ...
222s Unpacking iproute2 (6.1.0-1ubuntu5) over (6.1.0-1ubuntu2) ...
222s Preparing to unpack .../2-python3-yaml_6.0.1-2build1_s390x.deb ...
222s Unpacking python3-yaml (6.0.1-2build1) over (6.0.1-2) ...
222s Preparing to unpack .../3-libusb-1.0-0_2%3a1.0.27-1_s390x.deb ...
222s Unpacking libusb-1.0-0:s390x (2:1.0.27-1) over (2:1.0.26-1) ...
222s Preparing to unpack .../4-libprotobuf-c1_1.4.1-1ubuntu3_s390x.deb ...
222s Unpacking libprotobuf-c1:s390x (1.4.1-1ubuntu3) over (1.4.1-1ubuntu2) ...
222s Preparing to unpack .../5-libnghttp2-14_1.59.0-1build1_s390x.deb ...
222s Unpacking libnghttp2-14:s390x (1.59.0-1build1) over (1.59.0-1) ...
222s Preparing to unpack .../6-libproc2-0_2%3a4.0.4-4ubuntu2_s390x.deb ...
222s Unpacking libproc2-0:s390x (2:4.0.4-4ubuntu2) over (2:4.0.4-4ubuntu1) ...
222s Preparing to unpack .../7-procps_2%3a4.0.4-4ubuntu2_s390x.deb ...
222s Unpacking procps (2:4.0.4-4ubuntu2) over (2:4.0.4-4ubuntu1) ...
222s Preparing to unpack .../8-coreutils_9.4-3ubuntu3_s390x.deb ...
222s Unpacking coreutils (9.4-3ubuntu3) over (9.4-2ubuntu4) ...
222s Setting up coreutils (9.4-3ubuntu3) ...
222s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52220 files and directories currently installed.)
222s Preparing to unpack .../util-linux_2.39.3-9ubuntu2_s390x.deb ...
222s Unpacking util-linux (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
222s Setting up util-linux (2.39.3-9ubuntu2) ...
223s fstrim.service is a disabled or a static unit not running, not starting it.
223s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52220 files and directories currently installed.)
223s Removing libatm1:s390x (1:2.5.1-5) ...
223s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
223s Preparing to unpack .../file_1%3a5.45-3_s390x.deb ...
223s Unpacking file (1:5.45-3) over (1:5.45-2) ...
223s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52215 files and directories currently installed.)
223s Removing libmagic1:s390x (1:5.45-2) ...
223s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52205 files and directories currently installed.)
223s Preparing to unpack .../libmagic-mgc_1%3a5.45-3_s390x.deb ...
223s Unpacking libmagic-mgc (1:5.45-3) over (1:5.45-2) ...
224s Selecting previously unselected package libmagic1t64:s390x.
224s Preparing to unpack .../libmagic1t64_1%3a5.45-3_s390x.deb ...
224s Unpacking libmagic1t64:s390x (1:5.45-3) ...
224s Preparing to unpack .../libplymouth5_24.004.60-1ubuntu6_s390x.deb ...
224s Unpacking libplymouth5:s390x (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ...
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52216 files and directories currently installed.)
224s Removing libpng16-16:s390x (1.6.43-1) ...
224s Selecting previously unselected package libpng16-16t64:s390x.
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52206 files and directories currently installed.)
224s Preparing to unpack .../libpng16-16t64_1.6.43-3_s390x.deb ...
224s Unpacking libpng16-16t64:s390x (1.6.43-3) ...
224s Preparing to unpack .../multipath-tools_0.9.4-5ubuntu6_s390x.deb ...
224s Unpacking multipath-tools (0.9.4-5ubuntu6) over (0.9.4-5ubuntu3) ...
224s dpkg: liburcu8:s390x: dependency problems, but removing anyway as you requested:
224s  xfsprogs depends on liburcu8 (>= 0.13.0).
224s 
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52216 files and directories currently installed.)
224s Removing liburcu8:s390x (0.14.0-3) ...
224s Selecting previously unselected package liburcu8t64:s390x.
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52197 files and directories currently installed.)
224s Preparing to unpack .../liburcu8t64_0.14.0-3.1_s390x.deb ...
224s Unpacking liburcu8t64:s390x (0.14.0-3.1) ...
224s Preparing to unpack .../liblocale-gettext-perl_1.07-6ubuntu4_s390x.deb ...
224s Unpacking liblocale-gettext-perl (1.07-6ubuntu4) over (1.07-6build1) ...
224s Preparing to unpack .../uuid-runtime_2.39.3-9ubuntu2_s390x.deb ...
224s Unpacking uuid-runtime (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
224s Preparing to unpack .../libdebconfclient0_0.271ubuntu2_s390x.deb ...
224s Unpacking libdebconfclient0:s390x (0.271ubuntu2) over (0.271ubuntu1) ...
224s Setting up libdebconfclient0:s390x (0.271ubuntu2) ...
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
224s Preparing to unpack .../libsemanage-common_3.5-1build4_all.deb ...
224s Unpacking libsemanage-common (3.5-1build4) over (3.5-1build2) ...
224s Setting up libsemanage-common (3.5-1build4) ...
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
224s Preparing to unpack .../libsemanage2_3.5-1build4_s390x.deb ...
224s Unpacking libsemanage2:s390x (3.5-1build4) over (3.5-1build2) ...
224s Setting up libsemanage2:s390x (3.5-1build4) ...
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
224s Preparing to unpack .../install-info_7.1-3build1_s390x.deb ...
224s Unpacking install-info (7.1-3build1) over (7.1-3) ...
224s Setting up install-info (7.1-3build1) ...
224s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 52217 files and directories currently installed.)
224s Preparing to unpack .../000-gcc-13-base_13.2.0-21ubuntu1_s390x.deb ...
224s Unpacking gcc-13-base:s390x (13.2.0-21ubuntu1) over (13.2.0-17ubuntu2) ...
224s Preparing to unpack .../001-libss2_1.47.0-2.4~exp1ubuntu2_s390x.deb ...
224s Unpacking libss2:s390x (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ...
224s Preparing to unpack .../002-dmsetup_2%3a1.02.185-3ubuntu2_s390x.deb ...
224s Unpacking dmsetup (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ...
224s Preparing to unpack .../003-eject_2.39.3-9ubuntu2_s390x.deb ...
224s Unpacking eject (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ...
224s Preparing to unpack .../004-krb5-locales_1.20.1-6ubuntu1_all.deb ...
224s Unpacking krb5-locales (1.20.1-6ubuntu1) over (1.20.1-5build1) ...
224s Preparing to unpack .../005-libglib2.0-data_2.79.3-3ubuntu5_all.deb ...
224s Unpacking libglib2.0-data (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ...
224s Preparing to unpack .../006-libslang2_2.3.3-3build1_s390x.deb ...
224s Unpacking libslang2:s390x (2.3.3-3build1) over (2.3.3-3) ...
224s Preparing to unpack .../007-libtext-charwidth-perl_0.04-11build2_s390x.deb ...
224s Unpacking libtext-charwidth-perl:s390x (0.04-11build2) over (0.04-11build1) ...
225s Preparing to unpack .../008-libtext-iconv-perl_1.7-8build2_s390x.deb ...
225s Unpacking libtext-iconv-perl:s390x (1.7-8build2) over (1.7-8build1) ...
225s Preparing to unpack .../009-python-apt-common_2.7.7_all.deb ...
225s Unpacking python-apt-common (2.7.7) over (2.7.6) ...
225s Preparing to unpack .../010-python3-setuptools_68.1.2-2ubuntu1_all.deb ...
225s Unpacking python3-setuptools (68.1.2-2ubuntu1) over (68.1.2-2) ...
225s Preparing to unpack .../011-python3-pkg-resources_68.1.2-2ubuntu1_all.deb ...
225s Unpacking python3-pkg-resources (68.1.2-2ubuntu1) over (68.1.2-2) ...
225s Preparing to unpack .../012-rsyslog_8.2312.0-3ubuntu7_s390x.deb ...
225s Unpacking rsyslog (8.2312.0-3ubuntu7) over (8.2312.0-3ubuntu3) ...
225s Preparing to unpack .../013-vim-tiny_2%3a9.1.0016-1ubuntu6_s390x.deb ...
225s Unpacking vim-tiny (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ...
225s Preparing to unpack .../014-vim-common_2%3a9.1.0016-1ubuntu6_all.deb ...
225s Unpacking vim-common (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ...
225s Selecting previously unselected package xdg-user-dirs.
225s Preparing to unpack .../015-xdg-user-dirs_0.18-1_s390x.deb ...
225s Unpacking xdg-user-dirs (0.18-1) ...
225s Preparing to unpack .../016-xxd_2%3a9.1.0016-1ubuntu6_s390x.deb ...
225s Unpacking xxd (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ...
225s Preparing to unpack .../017-apparmor_4.0.0-beta3-0ubuntu2_s390x.deb ...
226s Unpacking apparmor (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ...
226s Preparing to unpack .../018-ftp_20230507-2build1_all.deb ...
226s Unpacking ftp (20230507-2build1) over (20230507-2) ...
226s Preparing to unpack .../019-inetutils-telnet_2%3a2.5-3ubuntu3_s390x.deb ...
226s Unpacking inetutils-telnet (2:2.5-3ubuntu3) over (2:2.5-3ubuntu1) ...
226s Preparing to unpack .../020-info_7.1-3build1_s390x.deb ...
226s Unpacking info (7.1-3build1) over (7.1-3) ...
226s Preparing to unpack .../021-libxmuu1_2%3a1.1.3-3build1_s390x.deb ...
226s Unpacking libxmuu1:s390x (2:1.1.3-3build1) over (2:1.1.3-3) ...
226s Preparing to unpack .../022-lshw_02.19.git.2021.06.19.996aaad9c7-2build2_s390x.deb ...
226s Unpacking lshw (02.19.git.2021.06.19.996aaad9c7-2build2) over (02.19.git.2021.06.19.996aaad9c7-2build1) ...
226s Selecting previously unselected package manpages.
226s Preparing to unpack .../023-manpages_6.05.01-1_all.deb ...
226s Unpacking manpages (6.05.01-1) ...
226s Preparing to unpack .../024-mtr-tiny_0.95-1.1build1_s390x.deb ...
226s Unpacking mtr-tiny (0.95-1.1build1) over (0.95-1.1) ...
226s Preparing to unpack .../025-plymouth-theme-ubuntu-text_24.004.60-1ubuntu6_s390x.deb ...
226s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ...
226s Preparing to unpack .../026-plymouth_24.004.60-1ubuntu6_s390x.deb ...
226s Unpacking plymouth (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ...
226s Preparing to unpack .../027-telnet_0.17+2.5-3ubuntu3_all.deb ...
226s Unpacking telnet (0.17+2.5-3ubuntu3) over (0.17+2.5-3ubuntu1) ...
226s Preparing to unpack .../028-usb.ids_2024.03.18-1_all.deb ...
226s Unpacking usb.ids (2024.03.18-1) over (2024.01.30-1) ...
226s Preparing to unpack .../029-xz-utils_5.6.0-0.2_s390x.deb ...
226s Unpacking xz-utils (5.6.0-0.2) over (5.4.5-0.3) ...
226s Preparing to unpack .../030-libctf0_2.42-4ubuntu1_s390x.deb ...
226s Unpacking libctf0:s390x (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
226s Preparing to unpack .../031-libctf-nobfd0_2.42-4ubuntu1_s390x.deb ...
226s Unpacking libctf-nobfd0:s390x (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
226s Preparing to unpack .../032-binutils-s390x-linux-gnu_2.42-4ubuntu1_s390x.deb ...
226s Unpacking binutils-s390x-linux-gnu (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
227s Preparing to unpack .../033-libbinutils_2.42-4ubuntu1_s390x.deb ...
227s Unpacking libbinutils:s390x (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
227s Preparing to unpack .../034-binutils_2.42-4ubuntu1_s390x.deb ...
227s Unpacking binutils (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
227s Preparing to unpack .../035-binutils-common_2.42-4ubuntu1_s390x.deb ...
227s Unpacking binutils-common:s390x (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
227s Preparing to unpack .../036-libsframe1_2.42-4ubuntu1_s390x.deb ...
227s Unpacking libsframe1:s390x (2.42-4ubuntu1) over (2.42-3ubuntu1) ...
227s Selecting previously unselected package libllvm18:s390x.
227s Preparing to unpack .../037-libllvm18_1%3a18.1.2-1ubuntu2_s390x.deb ...
227s Unpacking libllvm18:s390x (1:18.1.2-1ubuntu2) ...
228s Selecting previously unselected package libclang-cpp18.
228s Preparing to unpack .../038-libclang-cpp18_1%3a18.1.2-1ubuntu2_s390x.deb ...
228s Unpacking libclang-cpp18 (1:18.1.2-1ubuntu2) ...
229s Selecting previously unselected package libbpfcc:s390x.
229s Preparing to unpack .../039-libbpfcc_0.29.1+ds-1ubuntu4_s390x.deb ...
229s Unpacking libbpfcc:s390x (0.29.1+ds-1ubuntu4) ...
229s Selecting previously unselected package python3-bpfcc.
229s Preparing to unpack .../040-python3-bpfcc_0.29.1+ds-1ubuntu4_all.deb ...
229s Unpacking python3-bpfcc (0.29.1+ds-1ubuntu4) ...
229s Selecting previously unselected package ieee-data.
229s Preparing to unpack .../041-ieee-data_20220827.1_all.deb ...
229s Unpacking ieee-data (20220827.1) ...
229s Selecting previously unselected package python3-netaddr.
229s Preparing to unpack .../042-python3-netaddr_0.8.0-2ubuntu1_all.deb ...
229s Unpacking python3-netaddr (0.8.0-2ubuntu1) ...
229s Selecting previously unselected package bpfcc-tools.
229s Preparing to unpack .../043-bpfcc-tools_0.29.1+ds-1ubuntu4_all.deb ...
229s Unpacking bpfcc-tools (0.29.1+ds-1ubuntu4) ...
229s Selecting previously unselected package libclang1-18.
229s Preparing to unpack .../044-libclang1-18_1%3a18.1.2-1ubuntu2_s390x.deb ...
229s Unpacking libclang1-18 (1:18.1.2-1ubuntu2) ...
230s Selecting previously unselected package libdw1t64:s390x.
230s Preparing to unpack .../045-libdw1t64_0.190-1.1build2_s390x.deb ...
230s Unpacking libdw1t64:s390x (0.190-1.1build2) ...
230s Selecting previously unselected package bpftrace.
230s Preparing to unpack .../046-bpftrace_0.20.2-1ubuntu1_s390x.deb ...
230s Unpacking bpftrace (0.20.2-1ubuntu1) ...
230s Preparing to unpack .../047-cryptsetup-bin_2%3a2.7.0-1ubuntu2_s390x.deb ...
230s Unpacking cryptsetup-bin (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ...
230s Preparing to unpack .../048-dpkg-dev_1.22.6ubuntu5_all.deb ...
230s Unpacking dpkg-dev (1.22.6ubuntu5) over (1.22.4ubuntu5) ...
230s Preparing to unpack .../049-libdpkg-perl_1.22.6ubuntu5_all.deb ...
230s Unpacking libdpkg-perl (1.22.6ubuntu5) over (1.22.4ubuntu5) ...
230s Selecting previously unselected package fonts-dejavu-mono.
230s Preparing to unpack .../050-fonts-dejavu-mono_2.37-8_all.deb ...
230s Unpacking fonts-dejavu-mono (2.37-8) ...
230s Selecting previously unselected package fonts-dejavu-core.
230s Preparing to unpack .../051-fonts-dejavu-core_2.37-8_all.deb ...
230s Unpacking fonts-dejavu-core (2.37-8) ...
230s Selecting previously unselected package fontconfig-config.
230s Preparing to unpack .../052-fontconfig-config_2.15.0-1.1ubuntu1_s390x.deb ...
230s Unpacking fontconfig-config (2.15.0-1.1ubuntu1) ...
230s Preparing to unpack .../053-gnupg-l10n_2.4.4-2ubuntu15_all.deb ...
230s Unpacking gnupg-l10n (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ...
230s Selecting previously unselected package hwdata.
230s Preparing to unpack .../054-hwdata_0.379-1_all.deb ...
230s Unpacking hwdata (0.379-1) ...
230s Preparing to unpack .../055-libibverbs1_50.0-2build1_s390x.deb ...
230s Unpacking libibverbs1:s390x (50.0-2build1) over (50.0-2) ...
230s Preparing to unpack .../056-ibverbs-providers_50.0-2build1_s390x.deb ...
231s Unpacking ibverbs-providers:s390x (50.0-2build1) over (50.0-2) ...
231s Preparing to unpack .../057-jq_1.7.1-3_s390x.deb ...
231s Unpacking jq (1.7.1-3) over (1.7.1-2) ...
231s Preparing to unpack .../058-libjq1_1.7.1-3_s390x.deb ...
231s Unpacking libjq1:s390x (1.7.1-3) over (1.7.1-2) ...
231s Selecting previously unselected package libaio1t64:s390x.
231s Preparing to unpack .../059-libaio1t64_0.3.113-6_s390x.deb ...
231s Unpacking libaio1t64:s390x (0.3.113-6) ...
231s Selecting previously unselected package libatm1t64:s390x.
231s Preparing to unpack .../060-libatm1t64_1%3a2.5.1-5.1_s390x.deb ...
231s Unpacking libatm1t64:s390x (1:2.5.1-5.1) ...
231s Selecting previously unselected package libc-dev-bin.
231s Preparing to unpack .../061-libc-dev-bin_2.39-0ubuntu6_s390x.deb ...
231s Unpacking libc-dev-bin (2.39-0ubuntu6) ...
231s Selecting previously unselected package libfreetype6:s390x.
231s Preparing to unpack .../062-libfreetype6_2.13.2+dfsg-1build2_s390x.deb ...
231s Unpacking libfreetype6:s390x (2.13.2+dfsg-1build2) ...
231s Selecting previously unselected package libfontconfig1:s390x.
231s Preparing to unpack .../063-libfontconfig1_2.15.0-1.1ubuntu1_s390x.deb ...
231s Unpacking libfontconfig1:s390x (2.15.0-1.1ubuntu1) ...
231s Selecting previously unselected package libjpeg-turbo8:s390x.
231s Preparing to unpack .../064-libjpeg-turbo8_2.1.5-2ubuntu1_s390x.deb ...
231s Unpacking libjpeg-turbo8:s390x (2.1.5-2ubuntu1) ...
231s Selecting previously unselected package libjpeg8:s390x.
231s Preparing to unpack .../065-libjpeg8_8c-2ubuntu11_s390x.deb ...
231s Unpacking libjpeg8:s390x (8c-2ubuntu11) ...
231s Selecting previously unselected package libdeflate0:s390x.
231s Preparing to unpack .../066-libdeflate0_1.19-1_s390x.deb ...
231s Unpacking libdeflate0:s390x (1.19-1) ...
231s Selecting previously unselected package libjbig0:s390x.
231s Preparing to unpack .../067-libjbig0_2.1-6.1ubuntu1_s390x.deb ...
231s Unpacking libjbig0:s390x (2.1-6.1ubuntu1) ...
231s Selecting previously unselected package libsharpyuv0:s390x.
231s Preparing to unpack .../068-libsharpyuv0_1.3.2-0.4build2_s390x.deb ...
231s Unpacking libsharpyuv0:s390x (1.3.2-0.4build2) ...
231s Selecting previously unselected package libwebp7:s390x.
231s Preparing to unpack .../069-libwebp7_1.3.2-0.4build2_s390x.deb ...
231s Unpacking libwebp7:s390x (1.3.2-0.4build2) ...
231s Selecting previously unselected package libtiff6:s390x.
231s Preparing to unpack .../070-libtiff6_4.5.1+git230720-4ubuntu1_s390x.deb ...
231s Unpacking libtiff6:s390x (4.5.1+git230720-4ubuntu1) ...
231s Selecting previously unselected package libxpm4:s390x.
231s Preparing to unpack .../071-libxpm4_1%3a3.5.17-1build1_s390x.deb ...
231s Unpacking libxpm4:s390x (1:3.5.17-1build1) ...
231s Selecting previously unselected package libgd3:s390x.
231s Preparing to unpack .../072-libgd3_2.3.3-9ubuntu3_s390x.deb ...
231s Unpacking libgd3:s390x (2.3.3-9ubuntu3) ...
231s Selecting previously unselected package libc-devtools.
231s Preparing to unpack .../073-libc-devtools_2.39-0ubuntu6_s390x.deb ...
231s Unpacking libc-devtools (2.39-0ubuntu6) ...
231s Selecting previously unselected package linux-libc-dev:s390x.
231s Preparing to unpack .../074-linux-libc-dev_6.8.0-20.20_s390x.deb ...
231s Unpacking linux-libc-dev:s390x (6.8.0-20.20) ...
231s Selecting previously unselected package libcrypt-dev:s390x.
231s Preparing to unpack .../075-libcrypt-dev_1%3a4.4.36-4_s390x.deb ...
231s Unpacking libcrypt-dev:s390x (1:4.4.36-4) ...
231s Selecting previously unselected package rpcsvc-proto.
231s Preparing to unpack .../076-rpcsvc-proto_1.4.2-0ubuntu6_s390x.deb ...
231s Unpacking rpcsvc-proto (1.4.2-0ubuntu6) ...
231s Selecting previously unselected package libc6-dev:s390x.
231s Preparing to unpack .../077-libc6-dev_2.39-0ubuntu6_s390x.deb ...
231s Unpacking libc6-dev:s390x (2.39-0ubuntu6) ...
231s Preparing to unpack .../078-libevent-core-2.1-7_2.1.12-stable-9build1_s390x.deb ...
231s Unpacking libevent-core-2.1-7:s390x (2.1.12-stable-9build1) over (2.1.12-stable-9) ...
231s Preparing to unpack .../079-libftdi1-2_1.5-6build4_s390x.deb ...
231s Unpacking libftdi1-2:s390x (1.5-6build4) over (1.5-6build3) ...
231s Preparing to unpack .../080-libldap-common_2.6.7+dfsg-1~exp1ubuntu6_all.deb ...
231s Unpacking libldap-common (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ...
231s Selecting previously unselected package linux-modules-6.8.0-20-generic.
231s Preparing to unpack .../081-linux-modules-6.8.0-20-generic_6.8.0-20.20_s390x.deb ...
231s Unpacking linux-modules-6.8.0-20-generic (6.8.0-20.20) ...
232s Selecting previously unselected package linux-image-6.8.0-20-generic.
232s Preparing to unpack .../082-linux-image-6.8.0-20-generic_6.8.0-20.20_s390x.deb ...
232s Unpacking linux-image-6.8.0-20-generic (6.8.0-20.20) ...
232s Selecting previously unselected package linux-modules-extra-6.8.0-20-generic.
232s Preparing to unpack .../083-linux-modules-extra-6.8.0-20-generic_6.8.0-20.20_s390x.deb ...
232s Unpacking linux-modules-extra-6.8.0-20-generic (6.8.0-20.20) ...
232s Preparing to unpack .../084-linux-generic_6.8.0-20.20+1_s390x.deb ...
232s Unpacking linux-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
232s Preparing to unpack .../085-linux-image-generic_6.8.0-20.20+1_s390x.deb ...
232s Unpacking linux-image-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
232s Preparing to unpack .../086-linux-virtual_6.8.0-20.20+1_s390x.deb ...
232s Unpacking linux-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
232s Preparing to unpack .../087-linux-image-virtual_6.8.0-20.20+1_s390x.deb ...
232s Unpacking linux-image-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
232s Preparing to unpack .../088-linux-headers-virtual_6.8.0-20.20+1_s390x.deb ...
232s Unpacking linux-headers-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
232s Selecting previously unselected package linux-headers-6.8.0-20.
232s Preparing to unpack .../089-linux-headers-6.8.0-20_6.8.0-20.20_all.deb ...
232s Unpacking linux-headers-6.8.0-20 (6.8.0-20.20) ...
235s Selecting previously unselected package linux-headers-6.8.0-20-generic.
235s Preparing to unpack .../090-linux-headers-6.8.0-20-generic_6.8.0-20.20_s390x.deb ...
235s Unpacking linux-headers-6.8.0-20-generic (6.8.0-20.20) ...
235s Preparing to unpack .../091-linux-headers-generic_6.8.0-20.20+1_s390x.deb ...
235s Unpacking linux-headers-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ...
235s Selecting previously unselected package linux-tools-common.
235s Preparing to unpack .../092-linux-tools-common_6.8.0-20.20_all.deb ...
235s Unpacking linux-tools-common (6.8.0-20.20) ...
235s Selecting previously unselected package linux-tools-6.8.0-20.
235s Preparing to unpack .../093-linux-tools-6.8.0-20_6.8.0-20.20_s390x.deb ...
235s Unpacking linux-tools-6.8.0-20 (6.8.0-20.20) ...
236s Selecting previously unselected package linux-tools-6.8.0-20-generic.
236s Preparing to unpack .../094-linux-tools-6.8.0-20-generic_6.8.0-20.20_s390x.deb ...
236s Unpacking linux-tools-6.8.0-20-generic (6.8.0-20.20) ...
236s Selecting previously unselected package manpages-dev.
236s Preparing to unpack .../095-manpages-dev_6.05.01-1_all.deb ...
236s Unpacking manpages-dev (6.05.01-1) ...
236s Preparing to unpack .../096-python3-distutils_3.12.2-3ubuntu1.1_all.deb ...
236s Unpacking python3-distutils (3.12.2-3ubuntu1.1) over (3.11.5-1) ...
236s Preparing to unpack .../097-python3-lib2to3_3.12.2-3ubuntu1.1_all.deb ...
236s Unpacking python3-lib2to3 (3.12.2-3ubuntu1.1) over (3.11.5-1) ...
236s Preparing to unpack .../098-python3-pyrsistent_0.20.0-1build1_s390x.deb ...
236s Unpacking python3-pyrsistent:s390x (0.20.0-1build1) over (0.20.0-1) ...
236s Preparing to unpack .../099-python3-typing-extensions_4.10.0-1_all.deb ...
236s Unpacking python3-typing-extensions (4.10.0-1) over (4.9.0-1) ...
236s Preparing to unpack .../100-s390-tools-data_2.31.0-0ubuntu3_all.deb ...
236s Unpacking s390-tools-data (2.31.0-0ubuntu3) over (2.31.0-0ubuntu1) ...
236s Selecting previously unselected package ubuntu-kernel-accessories.
236s Preparing to unpack .../101-ubuntu-kernel-accessories_1.536build1_s390x.deb ...
236s Unpacking ubuntu-kernel-accessories (1.536build1) ...
236s Preparing to unpack .../102-kpartx_0.9.4-5ubuntu6_s390x.deb ...
236s Unpacking kpartx (0.9.4-5ubuntu6) over (0.9.4-5ubuntu3) ...
236s Setting up cryptsetup-bin (2:2.7.0-1ubuntu2) ...
236s Setting up pinentry-curses (1.2.1-3ubuntu4) ...
236s Setting up motd-news-config (13ubuntu8) ...
236s Setting up libtext-iconv-perl:s390x (1.7-8build2) ...
236s Setting up libtext-charwidth-perl:s390x (0.04-11build2) ...
236s Setting up libsharpyuv0:s390x (1.3.2-0.4build2) ...
236s Setting up liburcu8t64:s390x (0.14.0-3.1) ...
236s Setting up tcpdump (4.99.4-3ubuntu2) ...
237s Setting up libibverbs1:s390x (50.0-2build1) ...
237s Setting up systemd-sysv (255.4-1ubuntu5) ...
237s Setting up ubuntu-kernel-accessories (1.536build1) ...
237s Setting up libapparmor1:s390x (4.0.0-beta3-0ubuntu2) ...
237s Setting up libatm1t64:s390x (1:2.5.1-5.1) ...
237s Setting up libgdbm6t64:s390x (1.23-5.1) ...
237s Setting up bsdextrautils (2.39.3-9ubuntu2) ...
237s Setting up libxpm4:s390x (1:3.5.17-1build1) ...
237s Setting up libgdbm-compat4t64:s390x (1.23-5.1) ...
237s Setting up xdg-user-dirs (0.18-1) ...
237s Setting up ibverbs-providers:s390x (50.0-2build1) ...
237s Setting up linux-headers-6.8.0-20 (6.8.0-20.20) ...
237s Setting up libmagic-mgc (1:5.45-3) ...
237s Setting up gawk (1:5.2.1-2build2) ...
237s Setting up libjq1:s390x (1.7.1-3) ...
237s Setting up manpages (6.05.01-1) ...
237s Setting up libtirpc-common (1.3.4+ds-1.1) ...
237s Setting up libbrotli1:s390x (1.1.0-2build1) ...
237s Setting up libsqlite3-0:s390x (3.45.1-1ubuntu1) ...
237s Setting up libsasl2-modules:s390x (2.1.28+dfsg1-5ubuntu1) ...
237s Setting up libuv1t64:s390x (1.48.0-1.1) ...
237s Setting up libmagic1t64:s390x (1:5.45-3) ...
237s Setting up rsyslog (8.2312.0-3ubuntu7) ...
237s info: The user `syslog' is already a member of `adm'.
238s Setting up binutils-common:s390x (2.42-4ubuntu1) ...
238s Setting up libpsl5t64:s390x (0.21.2-1.1) ...
238s Setting up libnghttp2-14:s390x (1.59.0-1build1) ...
238s Setting up libdeflate0:s390x (1.19-1) ...
238s Setting up linux-libc-dev:s390x (6.8.0-20.20) ...
238s Setting up libreiserfscore0t64 (1:3.6.27-7.1) ...
238s Setting up libctf-nobfd0:s390x (2.42-4ubuntu1) ...
238s Setting up libnss-systemd:s390x (255.4-1ubuntu5) ...
238s Setting up krb5-locales (1.20.1-6ubuntu1) ...
238s Setting up file (1:5.45-3) ...
238s Setting up kmod (31+20240202-2ubuntu4) ...
238s Setting up lshw (02.19.git.2021.06.19.996aaad9c7-2build2) ...
238s Setting up libldap-common (2.6.7+dfsg-1~exp1ubuntu6) ...
238s Setting up libprotobuf-c1:s390x (1.4.1-1ubuntu3) ...
238s Setting up libjbig0:s390x (2.1-6.1ubuntu1) ...
238s Setting up xxd (2:9.1.0016-1ubuntu6) ...
238s Setting up libsframe1:s390x (2.42-4ubuntu1) ...
238s Setting up libelf1t64:s390x (0.190-1.1build2) ...
238s Setting up libkrb5support0:s390x (1.20.1-6ubuntu1) ...
238s Setting up libdw1t64:s390x (0.190-1.1build2) ...
238s Setting up linux-headers-6.8.0-20-generic (6.8.0-20.20) ...
238s Setting up eject (2.39.3-9ubuntu2) ...
238s Setting up apparmor (4.0.0-beta3-0ubuntu2) ...
238s Installing new version of config file /etc/apparmor.d/abstractions/authentication ...
238s Installing new version of config file /etc/apparmor.d/abstractions/crypto ...
238s Installing new version of config file /etc/apparmor.d/abstractions/kde-open5 ...
238s Installing new version of config file /etc/apparmor.d/abstractions/openssl ...
238s Installing new version of config file /etc/apparmor.d/code ...
238s Installing new version of config file /etc/apparmor.d/firefox ...
240s Reloading AppArmor profiles 
240s Setting up libglib2.0-0t64:s390x (2.79.3-3ubuntu5) ...
240s No schema files found: doing nothing.
240s Setting up libglib2.0-data (2.79.3-3ubuntu5) ...
240s Setting up rpcsvc-proto (1.4.2-0ubuntu6) ...
240s Setting up vim-common (2:9.1.0016-1ubuntu6) ...
240s Setting up gcc-13-base:s390x (13.2.0-21ubuntu1) ...
240s Setting up libqrtr-glib0:s390x (1.2.2-1ubuntu3) ...
240s Setting up libslang2:s390x (2.3.3-3build1) ...
240s Setting up libnvme1t64 (1.8-3) ...
240s Setting up mtr-tiny (0.95-1.1build1) ...
240s Setting up gnupg-l10n (2.4.4-2ubuntu15) ...
240s Setting up librtmp1:s390x (2.4+20151223.gitfa8646d.1-2build6) ...
240s Setting up libdbus-1-3:s390x (1.14.10-4ubuntu2) ...
240s Setting up xz-utils (5.6.0-0.2) ...
240s Setting up perl-modules-5.38 (5.38.2-3.2) ...
240s Setting up libproc2-0:s390x (2:4.0.4-4ubuntu2) ...
240s Setting up libblockdev-utils3:s390x (3.1.0-1build1) ...
240s Setting up fonts-dejavu-mono (2.37-8) ...
240s Setting up libpng16-16t64:s390x (1.6.43-3) ...
240s Setting up systemd-timesyncd (255.4-1ubuntu5) ...
241s Setting up libevent-core-2.1-7:s390x (2.1.12-stable-9build1) ...
241s Setting up udev (255.4-1ubuntu5) ...
242s Setting up libss2:s390x (1.47.0-2.4~exp1ubuntu2) ...
242s Setting up usb.ids (2024.03.18-1) ...
242s Setting up sudo (1.9.15p5-3ubuntu3) ...
242s Setting up fonts-dejavu-core (2.37-8) ...
242s Setting up dhcpcd-base (1:10.0.6-1ubuntu2) ...
242s Setting up gir1.2-glib-2.0:s390x (2.79.3-3ubuntu5) ...
242s Setting up libk5crypto3:s390x (1.20.1-6ubuntu1) ...
242s Setting up libjpeg-turbo8:s390x (2.1.5-2ubuntu1) ...
242s Setting up logsave (1.47.0-2.4~exp1ubuntu2) ...
242s Setting up libwebp7:s390x (1.3.2-0.4build2) ...
242s Setting up libfdisk1:s390x (2.39.3-9ubuntu2) ...
242s Setting up libdb5.3t64:s390x (5.3.28+dfsg2-6) ...
242s Setting up libblockdev-nvme3:s390x (3.1.0-1build1) ...
242s Setting up libdevmapper1.02.1:s390x (2:1.02.185-3ubuntu2) ...
242s Setting up libblockdev-fs3:s390x (3.1.0-1build1) ...
242s Setting up libaio1t64:s390x (0.3.113-6) ...
242s Setting up python-apt-common (2.7.7) ...
242s Setting up mount (2.39.3-9ubuntu2) ...
242s Setting up dmsetup (2:1.02.185-3ubuntu2) ...
242s Setting up uuid-runtime (2.39.3-9ubuntu2) ...
243s uuidd.service is a disabled or a static unit not running, not starting it.
243s Setting up libmm-glib0:s390x (1.23.4-0ubuntu1) ...
243s Setting up groff-base (1.23.0-3build1) ...
243s Setting up libcrypt-dev:s390x (1:4.4.36-4) ...
243s Setting up libplymouth5:s390x (24.004.60-1ubuntu6) ...
243s Setting up dbus-session-bus-common (1.14.10-4ubuntu2) ...
243s Setting up kpartx (0.9.4-5ubuntu6) ...
243s Setting up jq (1.7.1-3) ...
243s Setting up procps (2:4.0.4-4ubuntu2) ...
243s Setting up gpgconf (2.4.4-2ubuntu15) ...
243s Setting up libgirepository-1.0-1:s390x (1.79.1-1ubuntu6) ...
243s Setting up libjson-glib-1.0-common (1.8.0-2build1) ...
243s Setting up libkrb5-3:s390x (1.20.1-6ubuntu1) ...
243s Setting up libpython3.11-minimal:s390x (3.11.8-1build4) ...
243s Setting up libusb-1.0-0:s390x (2:1.0.27-1) ...
243s Setting up libperl5.38t64:s390x (5.38.2-3.2) ...
243s Setting up tnftp (20230507-2build1) ...
243s Setting up libbinutils:s390x (2.42-4ubuntu1) ...
243s Setting up dbus-system-bus-common (1.14.10-4ubuntu2) ...
243s Setting up libfido2-1:s390x (1.14.0-1build1) ...
243s Setting up libc-dev-bin (2.39-0ubuntu6) ...
243s Setting up openssl (3.0.13-0ubuntu2) ...
243s Setting up linux-modules-6.8.0-20-generic (6.8.0-20.20) ...
244s Setting up readline-common (8.2-4) ...
244s Setting up libxml2:s390x (2.9.14+dfsg-1.3ubuntu2) ...
244s Setting up libxmuu1:s390x (2:1.1.3-3build1) ...
244s Setting up dbus-bin (1.14.10-4ubuntu2) ...
244s Setting up info (7.1-3build1) ...
244s Setting up liblocale-gettext-perl (1.07-6ubuntu4) ...
244s Setting up gpg (2.4.4-2ubuntu15) ...
244s Setting up libgudev-1.0-0:s390x (1:238-3ubuntu2) ...
244s Setting up libpolkit-gobject-1-0:s390x (124-1ubuntu1) ...
244s Setting up libbpf1:s390x (1:1.3.0-2build1) ...
244s Setting up libmbim-glib4:s390x (1.31.2-0ubuntu2) ...
244s Setting up rsync (3.2.7-1build1) ...
245s rsync.service is a disabled or a static unit not running, not starting it.
245s Setting up libudisks2-0:s390x (2.10.1-6) ...
245s Setting up bolt (0.9.6-2build1) ...
245s bolt.service is a disabled or a static unit not running, not starting it.
245s Setting up s390-tools-data (2.31.0-0ubuntu3) ...
245s Setting up libllvm18:s390x (1:18.1.2-1ubuntu2) ...
245s Setting up gnupg-utils (2.4.4-2ubuntu15) ...
245s Setting up initramfs-tools-bin (0.142ubuntu23) ...
245s Setting up libctf0:s390x (2.42-4ubuntu1) ...
245s Setting up libjpeg8:s390x (8c-2ubuntu11) ...
245s Setting up python3.11-minimal (3.11.8-1build4) ...
247s Setting up libclang1-18 (1:18.1.2-1ubuntu2) ...
247s Setting up manpages-dev (6.05.01-1) ...
247s Setting up linux-modules-extra-6.8.0-20-generic (6.8.0-20.20) ...
247s Setting up apt-utils (2.7.14) ...
247s Setting up binutils-s390x-linux-gnu (2.42-4ubuntu1) ...
247s Setting up gpg-agent (2.4.4-2ubuntu15) ...
248s Setting up libpython3.12-stdlib:s390x (3.12.2-4build3) ...
248s Setting up libblockdev-mdraid3:s390x (3.1.0-1build1) ...
248s Setting up wget (1.21.4-1ubuntu2) ...
248s Setting up linux-image-6.8.0-20-generic (6.8.0-20.20) ...
248s I: /boot/vmlinuz is now a symlink to vmlinuz-6.8.0-20-generic
248s I: /boot/initrd.img is now a symlink to initrd.img-6.8.0-20-generic
248s Setting up libblockdev-swap3:s390x (3.1.0-1build1) ...
248s Setting up plymouth (24.004.60-1ubuntu6) ...
248s update-initramfs: Generating /boot/initrd.img-6.8.0-11-generic
248s W: No lz4 in /usr/bin:/sbin:/bin, using gzip
254s Not invoking zipl: initrd doesn't exist yet
254s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
254s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults
255s Setting up fontconfig-config (2.15.0-1.1ubuntu1) ...
255s Setting up libxmlb2:s390x (0.3.15-1build1) ...
255s Setting up btrfs-progs (6.6.3-1.1build1) ...
255s Setting up libpython3.11-stdlib:s390x (3.11.8-1build4) ...
255s Setting up python3.12 (3.12.2-4build3) ...
258s Setting up libblockdev-loop3:s390x (3.1.0-1build1) ...
258s Setting up gpgsm (2.4.4-2ubuntu15) ...
258s Setting up inetutils-telnet (2:2.5-3ubuntu3) ...
258s Setting up e2fsprogs (1.47.0-2.4~exp1ubuntu2) ...
258s update-initramfs: deferring update (trigger activated)
258s e2scrub_all.service is a disabled or a static unit not running, not starting it.
259s Setting up libparted2t64:s390x (3.6-3.1build2) ...
259s Setting up linux-headers-generic (6.8.0-20.20+1) ...
259s Setting up dbus-daemon (1.14.10-4ubuntu2) ...
259s Setting up binutils (2.42-4ubuntu1) ...
259s Setting up libmbim-proxy (1.31.2-0ubuntu2) ...
259s Setting up vim-tiny (2:9.1.0016-1ubuntu6) ...
259s Setting up libnetplan1:s390x (1.0-1) ...
259s Setting up man-db (2.12.0-3build4) ...
259s Updating database of manual pages ...
261s man-db.service is a disabled or a static unit not running, not starting it.
261s Setting up libblockdev3:s390x (3.1.0-1build1) ...
261s Setting up fdisk (2.39.3-9ubuntu2) ...
261s Setting up multipath-tools (0.9.4-5ubuntu6) ...
262s Setting up libjson-glib-1.0-0:s390x (1.8.0-2build1) ...
262s Setting up libblockdev-part3:s390x (3.1.0-1build1) ...
262s Setting up libsasl2-modules-db:s390x (2.1.28+dfsg1-5ubuntu1) ...
262s Setting up hwdata (0.379-1) ...
262s Setting up libftdi1-2:s390x (1.5-6build4) ...
262s Setting up perl (5.38.2-3.2) ...
262s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) ...
262s update-initramfs: deferring update (trigger activated)
262s Setting up libfreetype6:s390x (2.13.2+dfsg-1build2) ...
262s Setting up gir1.2-girepository-2.0:s390x (1.79.1-1ubuntu6) ...
262s Setting up dbus (1.14.10-4ubuntu2) ...
262s A reboot is required to replace the running dbus-daemon.
262s Please reboot the system when convenient.
263s Setting up shared-mime-info (2.4-1build1) ...
263s Setting up libgssapi-krb5-2:s390x (1.20.1-6ubuntu1) ...
263s Setting up ftp (20230507-2build1) ...
263s Setting up keyboxd (2.4.4-2ubuntu15) ...
264s Setting up libdpkg-perl (1.22.6ubuntu5) ...
264s Setting up libsasl2-2:s390x (2.1.28+dfsg1-5ubuntu1) ...
264s Setting up libssh-4:s390x (0.10.6-2build1) ...
264s Setting up ieee-data (20220827.1) ...
264s Setting up libtiff6:s390x (4.5.1+git230720-4ubuntu1) ...
264s Setting up libpam-systemd:s390x (255.4-1ubuntu5) ...
264s Setting up libpolkit-agent-1-0:s390x (124-1ubuntu1) ...
264s Setting up libc6-dev:s390x (2.39-0ubuntu6) ...
264s Setting up libgpgme11t64:s390x (1.18.0-4.1ubuntu3) ...
264s Setting up libfontconfig1:s390x (2.15.0-1.1ubuntu1) ...
264s Setting up linux-image-virtual (6.8.0-20.20+1) ...
264s Setting up netplan-generator (1.0-1) ...
264s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator'
264s Setting up initramfs-tools-core (0.142ubuntu23) ...
264s Setting up libclang-cpp18 (1:18.1.2-1ubuntu2) ...
264s Setting up libbpfcc:s390x (0.29.1+ds-1ubuntu4) ...
264s Setting up linux-tools-common (6.8.0-20.20) ...
264s Setting up libarchive13t64:s390x (3.7.2-1.1ubuntu2) ...
264s Setting up libldap2:s390x (2.6.7+dfsg-1~exp1ubuntu6) ...
264s Setting up libpython3-stdlib:s390x (3.12.2-0ubuntu1) ...
264s Setting up systemd-resolved (255.4-1ubuntu5) ...
264s Setting up python3.11 (3.11.8-1build4) ...
266s Setting up linux-image-generic (6.8.0-20.20+1) ...
266s Setting up telnet (0.17+2.5-3ubuntu3) ...
266s Setting up initramfs-tools (0.142ubuntu23) ...
266s update-initramfs: deferring update (trigger activated)
266s Setting up linux-headers-virtual (6.8.0-20.20+1) ...
266s Setting up linux-generic (6.8.0-20.20+1) ...
266s Setting up libcurl4t64:s390x (8.5.0-2ubuntu8) ...
266s Setting up bpftrace (0.20.2-1ubuntu1) ...
266s Setting up bind9-libs:s390x (1:9.18.24-0ubuntu3) ...
266s Setting up libtirpc3t64:s390x (1.3.4+ds-1.1) ...
267s Setting up e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) ...
267s Setting up iproute2 (6.1.0-1ubuntu5) ...
267s Setting up openssh-client (1:9.6p1-3ubuntu11) ...
267s Setting up libgusb2:s390x (0.4.8-1build1) ...
267s Setting up libcurl3t64-gnutls:s390x (8.5.0-2ubuntu8) ...
267s Setting up parted (3.6-3.1build2) ...
267s Setting up libqmi-glib5:s390x (1.35.2-0ubuntu1) ...
267s Setting up linux-tools-6.8.0-20 (6.8.0-20.20) ...
267s Setting up python3 (3.12.2-0ubuntu1) ...
267s Setting up libjcat1:s390x (0.2.0-2build2) ...
267s Setting up dpkg-dev (1.22.6ubuntu5) ...
267s Setting up linux-virtual (6.8.0-20.20+1) ...
267s Setting up dirmngr (2.4.4-2ubuntu15) ...
267s Setting up dbus-user-session (1.14.10-4ubuntu2) ...
267s Setting up linux-tools-6.8.0-20-generic (6.8.0-20.20) ...
267s Setting up python3-cryptography (41.0.7-4build2) ...
268s Setting up python3-gi (3.47.0-3build1) ...
268s Setting up libgd3:s390x (2.3.3-9ubuntu3) ...
268s Setting up python3-typing-extensions (4.10.0-1) ...
268s Setting up lsof (4.95.0-1build2) ...
268s Setting up python3-pyrsistent:s390x (0.20.0-1build1) ...
268s Setting up python3-netaddr (0.8.0-2ubuntu1) ...
268s Setting up libnsl2:s390x (1.3.0-3build2) ...
268s Setting up gnupg (2.4.4-2ubuntu15) ...
268s Setting up python3-netplan (1.0-1) ...
268s Setting up curl (8.5.0-2ubuntu8) ...
268s Setting up libvolume-key1:s390x (0.3.12-7build1) ...
268s Setting up bind9-host (1:9.18.24-0ubuntu3) ...
268s Setting up python3-lib2to3 (3.12.2-3ubuntu1.1) ...
269s Setting up python3-bpfcc (0.29.1+ds-1ubuntu4) ...
269s Setting up libc-devtools (2.39-0ubuntu6) ...
269s Setting up python3-pkg-resources (68.1.2-2ubuntu1) ...
269s Setting up python3-distutils (3.12.2-3ubuntu1.1) ...
270s python3.12: can't get files for byte-compilation
270s Setting up openssh-sftp-server (1:9.6p1-3ubuntu11) ...
270s Setting up python3-dbus (1.3.2-5build2) ...
270s Setting up python3-setuptools (68.1.2-2ubuntu1) ...
270s Setting up gpg-wks-client (2.4.4-2ubuntu15) ...
270s Setting up openssh-server (1:9.6p1-3ubuntu11) ...
271s Replacing config file /etc/ssh/sshd_config with new version
272s Created symlink /etc/systemd/system/ssh.service.requires/ssh.socket → /usr/lib/systemd/system/ssh.socket.

274s Setting up libblockdev-crypto3:s390x (3.1.0-1build1) ...
274s Setting up python3-gdbm:s390x (3.12.2-3ubuntu1.1) ...
274s Setting up python3-apt (2.7.7) ...
274s Setting up libfwupd2:s390x (1.9.15-2) ...
274s Setting up python3-yaml (6.0.1-2build1) ...
275s Setting up libqmi-proxy (1.35.2-0ubuntu1) ...
275s Setting up netplan.io (1.0-1) ...
275s Setting up bpfcc-tools (0.29.1+ds-1ubuntu4) ...
275s Setting up bind9-dnsutils (1:9.18.24-0ubuntu3) ...
275s Setting up ubuntu-pro-client (31.2.2) ...
277s Setting up fwupd (1.9.15-2) ...
277s fwupd-offline-update.service is a disabled or a static unit not running, not starting it.
277s fwupd-refresh.service is a disabled or a static unit not running, not starting it.
277s Setting up ubuntu-pro-client-l10n (31.2.2) ...
277s Setting up udisks2 (2.10.1-6) ...
278s Processing triggers for ufw (0.36.2-5) ...
278s Processing triggers for debianutils (5.17) ...
278s Processing triggers for install-info (7.1-3build1) ...
278s Processing triggers for libc-bin (2.39-0ubuntu6) ...
278s Processing triggers for linux-image-6.8.0-20-generic (6.8.0-20.20) ...
278s /etc/kernel/postinst.d/initramfs-tools:
278s update-initramfs: Generating /boot/initrd.img-6.8.0-20-generic
278s W: No lz4 in /usr/bin:/sbin:/bin, using gzip
283s Using config file '/etc/zipl.conf'
283s Building bootmap in '/boot'
283s Adding IPL section 'ubuntu' (default)
283s Preparing boot device for LD-IPL: vda (0000).
283s Done.
283s /etc/kernel/postinst.d/zz-zipl:
283s Using config file '/etc/zipl.conf'
283s Building bootmap in '/boot'
283s Adding IPL section 'ubuntu' (default)
283s Preparing boot device for LD-IPL: vda (0000).
283s Done.
283s Processing triggers for initramfs-tools (0.142ubuntu23) ...
283s update-initramfs: Generating /boot/initrd.img-6.8.0-20-generic
283s W: No lz4 in /usr/bin:/sbin:/bin, using gzip
288s Using config file '/etc/zipl.conf'
288s Building bootmap in '/boot'
288s Adding IPL section 'ubuntu' (default)
288s Preparing boot device for LD-IPL: vda (0000).
288s Done.
290s Reading package lists...
290s Building dependency tree...
290s Reading state information...
291s The following packages will be REMOVED:
291s   libaio1* libnetplan0* python3-distutils* python3-lib2to3*
291s 0 upgraded, 0 newly installed, 4 to remove and 1 not upgraded.
291s After this operation, 1445 kB disk space will be freed.
291s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 81786 files and directories currently installed.)
291s Removing libaio1:s390x (0.3.113-5) ...
291s Removing libnetplan0:s390x (0.107.1-3) ...
291s Removing python3-distutils (3.12.2-3ubuntu1.1) ...
291s Removing python3-lib2to3 (3.12.2-3ubuntu1.1) ...
291s Processing triggers for libc-bin (2.39-0ubuntu6) ...
292s autopkgtest [01:10:03]: rebooting testbed after setup commands that affected boot
320s autopkgtest-virt-ssh: WARNING: ssh connection failed. Retrying in 3 seconds...
328s autopkgtest [01:10:39]: testbed running kernel: Linux 6.8.0-20-generic #20-Ubuntu SMP Mon Mar 18 10:49:25 UTC 2024
331s autopkgtest [01:10:42]: @@@@@@@@@@@@@@@@@@@@ apt-source presto
334s Get:1 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (dsc) [2233 B]
334s Get:2 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (tar) [362 kB]
334s Get:3 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (diff) [20.8 kB]
334s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC
334s gpgv:                using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7
334s gpgv: Can't check signature: No public key
334s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found
334s autopkgtest [01:10:45]: testing package presto version 0.7.2-1
335s autopkgtest [01:10:46]: build not needed
337s autopkgtest [01:10:48]: test pybuild-autopkgtest: preparing testbed
338s Reading package lists...
339s Building dependency tree...
339s Reading state information...
339s Starting pkgProblemResolver with broken count: 0
339s Starting 2 pkgProblemResolver with broken count: 0
339s Done
340s The following additional packages will be installed:
340s   autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-13
340s   cpp-13-s390x-linux-gnu cpp-s390x-linux-gnu debhelper debugedit dh-autoreconf
340s   dh-python dh-strip-nondeterminism dwz fonts-urw-base35 g++ g++-13
340s   g++-13-s390x-linux-gnu g++-s390x-linux-gnu gcc gcc-13 gcc-13-s390x-linux-gnu
340s   gcc-s390x-linux-gnu gettext intltool-debian libarchive-zip-perl libasan8
340s   libatomic1 libblas3 libcairo2 libcc1-0 libdebhelper-perl
340s   libfile-stripnondeterminism-perl libfontenc1 libgcc-13-dev libgfortran5
340s   libgomp1 libgraphite2-3 libharfbuzz0b libimagequant0 libisl23 libitm1
340s   liblapack3 liblbfgsb0 liblcms2-2 libmbedcrypto7t64 libmbedtls14t64
340s   libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libraqm0
340s   libstdc++-13-dev libsub-override-perl libtool libubsan1 libwebpdemux2
340s   libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data
340s   po-debconf presto pybuild-plugin-autopkgtest python3-all python3-biopython
340s   python3-cairo python3-dateutil python3-decorator python3-freetype
340s   python3-numpy python3-packaging python3-pandas python3-pandas-lib
340s   python3-pil python3-presto python3-reportlab python3-rlpycairo python3-scipy
340s   sgml-base w3c-sgml-lib x11-common xfonts-encodings xfonts-utils xml-core
340s Suggested packages:
340s   autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-13-locales
340s   cpp-13-doc dh-make flit python3-build python3-installer python3-wheel
340s   fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre g++-multilib
340s   g++-13-multilib gcc-13-doc gcc-multilib flex bison gdb gcc-doc
340s   gcc-13-multilib gdb-s390x-linux-gnu gettext-doc libasprintf-dev
340s   libgettextpo-dev liblcms2-utils libstdc++-13-doc libtool-doc gfortran
340s   | fortran95-compiler gcj-jdk m4-doc libmail-box-perl python3-tk bwa clustalo
340s   clustalw dialign dssp emboss fasttree mafft muscle3 phylip phyml prank
340s   probcons python3-mysqldb python3-matplotlib python3-mmtf python3-rdflib
340s   python3-psycopg2 raxml samtools t-coffee wise gfortran python3-dev
340s   python3-pytest python-pandas-doc python3-statsmodels python-pil-doc
340s   pdf-viewer python3-egenix-mxtexttools python-reportlab-doc rl-accel
340s   rl-renderpm python-scipy-doc sgml-base-doc
340s Recommended packages:
340s   libarchive-cpio-perl libltdl-dev libmail-sendmail-perl python-biopython-doc
340s   python3-matplotlib python3-bottleneck python3-numexpr python3-odf
340s   python3-openpyxl python3-bs4 python3-html5lib python3-lxml python3-tables
340s   python3-olefile fonts-dejavu-extra
340s The following NEW packages will be installed:
340s   autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential
340s   cd-hit cpp cpp-13 cpp-13-s390x-linux-gnu cpp-s390x-linux-gnu debhelper
340s   debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz
340s   fonts-urw-base35 g++ g++-13 g++-13-s390x-linux-gnu g++-s390x-linux-gnu gcc
340s   gcc-13 gcc-13-s390x-linux-gnu gcc-s390x-linux-gnu gettext intltool-debian
340s   libarchive-zip-perl libasan8 libatomic1 libblas3 libcairo2 libcc1-0
340s   libdebhelper-perl libfile-stripnondeterminism-perl libfontenc1 libgcc-13-dev
340s   libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b libimagequant0 libisl23
340s   libitm1 liblapack3 liblbfgsb0 liblcms2-2 libmbedcrypto7t64 libmbedtls14t64
340s   libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libraqm0
340s   libstdc++-13-dev libsub-override-perl libtool libubsan1 libwebpdemux2
340s   libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 m4 ncbi-blast+ ncbi-data
340s   po-debconf presto pybuild-plugin-autopkgtest python3-all python3-biopython
340s   python3-cairo python3-dateutil python3-decorator python3-freetype
340s   python3-numpy python3-packaging python3-pandas python3-pandas-lib
340s   python3-pil python3-presto python3-reportlab python3-rlpycairo python3-scipy
340s   sgml-base w3c-sgml-lib x11-common xfonts-encodings xfonts-utils xml-core
341s 0 upgraded, 91 newly installed, 0 to remove and 1 not upgraded.
341s Need to get 130 MB/130 MB of archives.
341s After this operation, 492 MB of additional disk space will be used.
341s Get:1 /tmp/autopkgtest.eWjFWB/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [816 B]
341s Get:2 http://ftpmaster.internal/ubuntu noble/main s390x sgml-base all 1.31 [11.4 kB]
341s Get:3 http://ftpmaster.internal/ubuntu noble/main s390x m4 s390x 1.4.19-4 [255 kB]
341s Get:4 http://ftpmaster.internal/ubuntu noble/main s390x autoconf all 2.71-3 [339 kB]
341s Get:5 http://ftpmaster.internal/ubuntu noble/main s390x autotools-dev all 20220109.1 [44.9 kB]
341s Get:6 http://ftpmaster.internal/ubuntu noble/main s390x automake all 1:1.16.5-1.3ubuntu1 [558 kB]
342s Get:7 http://ftpmaster.internal/ubuntu noble/main s390x autopoint all 0.21-14ubuntu1 [422 kB]
342s Get:8 http://ftpmaster.internal/ubuntu noble/main s390x libisl23 s390x 0.26-3 [722 kB]
342s Get:9 http://ftpmaster.internal/ubuntu noble/main s390x libmpc3 s390x 1.3.1-1 [54.9 kB]
343s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main s390x cpp-13-s390x-linux-gnu s390x 13.2.0-21ubuntu1 [9935 kB]
345s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main s390x cpp-13 s390x 13.2.0-21ubuntu1 [1026 B]
345s Get:12 http://ftpmaster.internal/ubuntu noble/main s390x cpp-s390x-linux-gnu s390x 4:13.2.0-7ubuntu1 [5308 B]
345s Get:13 http://ftpmaster.internal/ubuntu noble/main s390x cpp s390x 4:13.2.0-7ubuntu1 [22.4 kB]
345s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcc1-0 s390x 14-20240315-1ubuntu1 [50.0 kB]
345s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgomp1 s390x 14-20240315-1ubuntu1 [151 kB]
345s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libitm1 s390x 14-20240315-1ubuntu1 [31.1 kB]
345s Get:17 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libatomic1 s390x 14-20240315-1ubuntu1 [9396 B]
345s Get:18 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libasan8 s390x 14-20240315-1ubuntu1 [2997 kB]
345s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libubsan1 s390x 14-20240315-1ubuntu1 [1186 kB]
345s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgcc-13-dev s390x 13.2.0-21ubuntu1 [1003 kB]
345s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gcc-13-s390x-linux-gnu s390x 13.2.0-21ubuntu1 [19.1 MB]
348s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main s390x gcc-13 s390x 13.2.0-21ubuntu1 [469 kB]
348s Get:23 http://ftpmaster.internal/ubuntu noble/main s390x gcc-s390x-linux-gnu s390x 4:13.2.0-7ubuntu1 [1208 B]
348s Get:24 http://ftpmaster.internal/ubuntu noble/main s390x gcc s390x 4:13.2.0-7ubuntu1 [5014 B]
348s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libstdc++-13-dev s390x 13.2.0-21ubuntu1 [2494 kB]
348s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main s390x g++-13-s390x-linux-gnu s390x 13.2.0-21ubuntu1 [11.3 MB]
350s Get:27 http://ftpmaster.internal/ubuntu noble-proposed/main s390x g++-13 s390x 13.2.0-21ubuntu1 [14.4 kB]
350s Get:28 http://ftpmaster.internal/ubuntu noble/main s390x g++-s390x-linux-gnu s390x 4:13.2.0-7ubuntu1 [956 B]
350s Get:29 http://ftpmaster.internal/ubuntu noble/main s390x g++ s390x 4:13.2.0-7ubuntu1 [1096 B]
350s Get:30 http://ftpmaster.internal/ubuntu noble/main s390x build-essential s390x 12.10ubuntu1 [4930 B]
350s Get:31 http://ftpmaster.internal/ubuntu noble/universe s390x cd-hit s390x 4.8.1-4 [521 kB]
350s Get:32 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libdebhelper-perl all 13.14.1ubuntu5 [89.8 kB]
350s Get:33 http://ftpmaster.internal/ubuntu noble/main s390x libtool all 2.4.7-7 [166 kB]
350s Get:34 http://ftpmaster.internal/ubuntu noble/main s390x dh-autoreconf all 20 [16.1 kB]
350s Get:35 http://ftpmaster.internal/ubuntu noble/main s390x libarchive-zip-perl all 1.68-1 [90.2 kB]
350s Get:36 http://ftpmaster.internal/ubuntu noble/main s390x libsub-override-perl all 0.10-1 [10.0 kB]
350s Get:37 http://ftpmaster.internal/ubuntu noble/main s390x libfile-stripnondeterminism-perl all 1.13.1-1 [18.1 kB]
350s Get:38 http://ftpmaster.internal/ubuntu noble/main s390x dh-strip-nondeterminism all 1.13.1-1 [5362 B]
350s Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main s390x debugedit s390x 1:5.0-5build1 [50.5 kB]
350s Get:40 http://ftpmaster.internal/ubuntu noble-proposed/main s390x dwz s390x 0.15-1build5 [122 kB]
350s Get:41 http://ftpmaster.internal/ubuntu noble/main s390x gettext s390x 0.21-14ubuntu1 [917 kB]
350s Get:42 http://ftpmaster.internal/ubuntu noble/main s390x intltool-debian all 0.35.0+20060710.6 [23.2 kB]
350s Get:43 http://ftpmaster.internal/ubuntu noble/main s390x po-debconf all 1.0.21+nmu1 [233 kB]
350s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main s390x debhelper all 13.14.1ubuntu5 [869 kB]
350s Get:45 http://ftpmaster.internal/ubuntu noble/universe s390x dh-python all 6.20231223ubuntu2 [111 kB]
350s Get:46 http://ftpmaster.internal/ubuntu noble/main s390x libfontenc1 s390x 1:1.1.8-1 [14.8 kB]
350s Get:47 http://ftpmaster.internal/ubuntu noble/main s390x x11-common all 1:7.7+23ubuntu2 [23.4 kB]
350s Get:48 http://ftpmaster.internal/ubuntu noble/main s390x xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB]
350s Get:49 http://ftpmaster.internal/ubuntu noble/main s390x xfonts-utils s390x 1:7.7+6build2 [94.8 kB]
350s Get:50 http://ftpmaster.internal/ubuntu noble/main s390x fonts-urw-base35 all 20200910-8 [11.0 MB]
353s Get:51 http://ftpmaster.internal/ubuntu noble/main s390x libblas3 s390x 3.12.0-3 [245 kB]
353s Get:52 http://ftpmaster.internal/ubuntu noble/main s390x libpixman-1-0 s390x 0.42.2-1 [173 kB]
353s Get:53 http://ftpmaster.internal/ubuntu noble/main s390x libxcb-render0 s390x 1.15-1 [17.0 kB]
353s Get:54 http://ftpmaster.internal/ubuntu noble/main s390x libxcb-shm0 s390x 1.15-1 [5782 B]
353s Get:55 http://ftpmaster.internal/ubuntu noble/main s390x libxrender1 s390x 1:0.9.10-1.1 [19.4 kB]
353s Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libcairo2 s390x 1.18.0-1ubuntu1 [589 kB]
353s Get:57 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libgfortran5 s390x 14-20240315-1ubuntu1 [600 kB]
353s Get:58 http://ftpmaster.internal/ubuntu noble/main s390x libgraphite2-3 s390x 1.3.14-2 [90.4 kB]
353s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libharfbuzz0b s390x 8.3.0-2build1 [515 kB]
353s Get:60 http://ftpmaster.internal/ubuntu noble/main s390x libimagequant0 s390x 2.18.0-1 [42.9 kB]
353s Get:61 http://ftpmaster.internal/ubuntu noble/main s390x liblapack3 s390x 3.12.0-3 [2979 kB]
354s Get:62 http://ftpmaster.internal/ubuntu noble/universe s390x liblbfgsb0 s390x 3.0+dfsg.4-1 [28.4 kB]
354s Get:63 http://ftpmaster.internal/ubuntu noble/main s390x liblcms2-2 s390x 2.14-2 [155 kB]
354s Get:64 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedcrypto7t64 s390x 2.28.7-1.1ubuntu1 [216 kB]
354s Get:65 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedx509-1t64 s390x 2.28.7-1.1ubuntu1 [46.2 kB]
354s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedtls14t64 s390x 2.28.7-1.1ubuntu1 [84.7 kB]
354s Get:67 http://ftpmaster.internal/ubuntu noble/main s390x libraqm0 s390x 0.10.1-1 [14.4 kB]
354s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libwebpdemux2 s390x 1.3.2-0.4build2 [12.5 kB]
354s Get:69 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libwebpmux3 s390x 1.3.2-0.4build2 [25.4 kB]
354s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x ncbi-data all 6.1.20170106+dfsg2-1 [4285 kB]
355s Get:71 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x ncbi-blast+ s390x 2.12.0+ds-4build1 [12.8 MB]
359s Get:72 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-numpy s390x 1:1.24.2-3ubuntu1 [4155 kB]
361s Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libopenjp2-7 s390x 2.5.0-2build2 [192 kB]
361s Get:74 http://ftpmaster.internal/ubuntu noble/main s390x python3-pil s390x 10.2.0-1 [519 kB]
361s Get:75 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-cairo s390x 1.25.1-2build1 [120 kB]
361s Get:76 http://ftpmaster.internal/ubuntu noble/universe s390x python3-freetype all 2.4.0-1 [83.1 kB]
361s Get:77 http://ftpmaster.internal/ubuntu noble/universe s390x python3-rlpycairo all 0.3.0-3 [9130 B]
361s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x python3-reportlab all 4.1.0-4 [1105 kB]
361s Get:79 http://ftpmaster.internal/ubuntu noble/main s390x xml-core all 0.19 [20.3 kB]
361s Get:80 http://ftpmaster.internal/ubuntu noble/universe s390x w3c-sgml-lib all 1.3-3 [280 kB]
361s Get:81 http://ftpmaster.internal/ubuntu noble/universe s390x python3-biopython s390x 1.81+dfsg-3 [2234 kB]
362s Get:82 http://ftpmaster.internal/ubuntu noble/main s390x python3-dateutil all 2.8.2-3 [79.2 kB]
362s Get:83 http://ftpmaster.internal/ubuntu noble/universe s390x python3-pandas-lib s390x 2.1.4+dfsg-4ubuntu2 [8852 kB]
365s Get:84 http://ftpmaster.internal/ubuntu noble/universe s390x python3-pandas all 2.1.4+dfsg-4ubuntu2 [3042 kB]
365s Get:85 http://ftpmaster.internal/ubuntu noble/main s390x python3-decorator all 5.1.1-5 [10.1 kB]
365s Get:86 http://ftpmaster.internal/ubuntu noble/universe s390x python3-scipy s390x 1.11.4-6 [20.1 MB]
370s Get:87 http://ftpmaster.internal/ubuntu noble/main s390x python3-packaging all 23.2-1 [40.6 kB]
370s Get:88 http://ftpmaster.internal/ubuntu noble/universe s390x python3-presto s390x 0.7.2-1 [80.7 kB]
370s Get:89 http://ftpmaster.internal/ubuntu noble/universe s390x presto all 0.7.2-1 [240 kB]
370s Get:90 http://ftpmaster.internal/ubuntu noble/universe s390x pybuild-plugin-autopkgtest all 6.20231223ubuntu2 [1760 B]
370s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main s390x python3-all s390x 3.12.2-0ubuntu1 [890 B]
371s Fetched 130 MB in 30s (4366 kB/s)
371s Selecting previously unselected package sgml-base.
371s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 81562 files and directories currently installed.)
371s Preparing to unpack .../00-sgml-base_1.31_all.deb ...
371s Unpacking sgml-base (1.31) ...
371s Selecting previously unselected package m4.
371s Preparing to unpack .../01-m4_1.4.19-4_s390x.deb ...
371s Unpacking m4 (1.4.19-4) ...
371s Selecting previously unselected package autoconf.
371s Preparing to unpack .../02-autoconf_2.71-3_all.deb ...
371s Unpacking autoconf (2.71-3) ...
371s Selecting previously unselected package autotools-dev.
371s Preparing to unpack .../03-autotools-dev_20220109.1_all.deb ...
371s Unpacking autotools-dev (20220109.1) ...
371s Selecting previously unselected package automake.
371s Preparing to unpack .../04-automake_1%3a1.16.5-1.3ubuntu1_all.deb ...
371s Unpacking automake (1:1.16.5-1.3ubuntu1) ...
371s Selecting previously unselected package autopoint.
371s Preparing to unpack .../05-autopoint_0.21-14ubuntu1_all.deb ...
371s Unpacking autopoint (0.21-14ubuntu1) ...
371s Selecting previously unselected package libisl23:s390x.
371s Preparing to unpack .../06-libisl23_0.26-3_s390x.deb ...
371s Unpacking libisl23:s390x (0.26-3) ...
371s Selecting previously unselected package libmpc3:s390x.
371s Preparing to unpack .../07-libmpc3_1.3.1-1_s390x.deb ...
371s Unpacking libmpc3:s390x (1.3.1-1) ...
371s Selecting previously unselected package cpp-13-s390x-linux-gnu.
371s Preparing to unpack .../08-cpp-13-s390x-linux-gnu_13.2.0-21ubuntu1_s390x.deb ...
371s Unpacking cpp-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
371s Selecting previously unselected package cpp-13.
371s Preparing to unpack .../09-cpp-13_13.2.0-21ubuntu1_s390x.deb ...
371s Unpacking cpp-13 (13.2.0-21ubuntu1) ...
371s Selecting previously unselected package cpp-s390x-linux-gnu.
371s Preparing to unpack .../10-cpp-s390x-linux-gnu_4%3a13.2.0-7ubuntu1_s390x.deb ...
371s Unpacking cpp-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
371s Selecting previously unselected package cpp.
371s Preparing to unpack .../11-cpp_4%3a13.2.0-7ubuntu1_s390x.deb ...
371s Unpacking cpp (4:13.2.0-7ubuntu1) ...
371s Selecting previously unselected package libcc1-0:s390x.
371s Preparing to unpack .../12-libcc1-0_14-20240315-1ubuntu1_s390x.deb ...
371s Unpacking libcc1-0:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libgomp1:s390x.
372s Preparing to unpack .../13-libgomp1_14-20240315-1ubuntu1_s390x.deb ...
372s Unpacking libgomp1:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libitm1:s390x.
372s Preparing to unpack .../14-libitm1_14-20240315-1ubuntu1_s390x.deb ...
372s Unpacking libitm1:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libatomic1:s390x.
372s Preparing to unpack .../15-libatomic1_14-20240315-1ubuntu1_s390x.deb ...
372s Unpacking libatomic1:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libasan8:s390x.
372s Preparing to unpack .../16-libasan8_14-20240315-1ubuntu1_s390x.deb ...
372s Unpacking libasan8:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libubsan1:s390x.
372s Preparing to unpack .../17-libubsan1_14-20240315-1ubuntu1_s390x.deb ...
372s Unpacking libubsan1:s390x (14-20240315-1ubuntu1) ...
372s Selecting previously unselected package libgcc-13-dev:s390x.
372s Preparing to unpack .../18-libgcc-13-dev_13.2.0-21ubuntu1_s390x.deb ...
372s Unpacking libgcc-13-dev:s390x (13.2.0-21ubuntu1) ...
372s Selecting previously unselected package gcc-13-s390x-linux-gnu.
372s Preparing to unpack .../19-gcc-13-s390x-linux-gnu_13.2.0-21ubuntu1_s390x.deb ...
372s Unpacking gcc-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
372s Selecting previously unselected package gcc-13.
372s Preparing to unpack .../20-gcc-13_13.2.0-21ubuntu1_s390x.deb ...
372s Unpacking gcc-13 (13.2.0-21ubuntu1) ...
372s Selecting previously unselected package gcc-s390x-linux-gnu.
372s Preparing to unpack .../21-gcc-s390x-linux-gnu_4%3a13.2.0-7ubuntu1_s390x.deb ...
372s Unpacking gcc-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
372s Selecting previously unselected package gcc.
372s Preparing to unpack .../22-gcc_4%3a13.2.0-7ubuntu1_s390x.deb ...
372s Unpacking gcc (4:13.2.0-7ubuntu1) ...
372s Selecting previously unselected package libstdc++-13-dev:s390x.
372s Preparing to unpack .../23-libstdc++-13-dev_13.2.0-21ubuntu1_s390x.deb ...
372s Unpacking libstdc++-13-dev:s390x (13.2.0-21ubuntu1) ...
373s Selecting previously unselected package g++-13-s390x-linux-gnu.
373s Preparing to unpack .../24-g++-13-s390x-linux-gnu_13.2.0-21ubuntu1_s390x.deb ...
373s Unpacking g++-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
373s Selecting previously unselected package g++-13.
373s Preparing to unpack .../25-g++-13_13.2.0-21ubuntu1_s390x.deb ...
373s Unpacking g++-13 (13.2.0-21ubuntu1) ...
373s Selecting previously unselected package g++-s390x-linux-gnu.
373s Preparing to unpack .../26-g++-s390x-linux-gnu_4%3a13.2.0-7ubuntu1_s390x.deb ...
373s Unpacking g++-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
373s Selecting previously unselected package g++.
373s Preparing to unpack .../27-g++_4%3a13.2.0-7ubuntu1_s390x.deb ...
373s Unpacking g++ (4:13.2.0-7ubuntu1) ...
373s Selecting previously unselected package build-essential.
373s Preparing to unpack .../28-build-essential_12.10ubuntu1_s390x.deb ...
373s Unpacking build-essential (12.10ubuntu1) ...
373s Selecting previously unselected package cd-hit.
373s Preparing to unpack .../29-cd-hit_4.8.1-4_s390x.deb ...
373s Unpacking cd-hit (4.8.1-4) ...
373s Selecting previously unselected package libdebhelper-perl.
373s Preparing to unpack .../30-libdebhelper-perl_13.14.1ubuntu5_all.deb ...
373s Unpacking libdebhelper-perl (13.14.1ubuntu5) ...
373s Selecting previously unselected package libtool.
373s Preparing to unpack .../31-libtool_2.4.7-7_all.deb ...
373s Unpacking libtool (2.4.7-7) ...
373s Selecting previously unselected package dh-autoreconf.
373s Preparing to unpack .../32-dh-autoreconf_20_all.deb ...
373s Unpacking dh-autoreconf (20) ...
373s Selecting previously unselected package libarchive-zip-perl.
373s Preparing to unpack .../33-libarchive-zip-perl_1.68-1_all.deb ...
373s Unpacking libarchive-zip-perl (1.68-1) ...
373s Selecting previously unselected package libsub-override-perl.
373s Preparing to unpack .../34-libsub-override-perl_0.10-1_all.deb ...
373s Unpacking libsub-override-perl (0.10-1) ...
373s Selecting previously unselected package libfile-stripnondeterminism-perl.
373s Preparing to unpack .../35-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ...
373s Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ...
373s Selecting previously unselected package dh-strip-nondeterminism.
373s Preparing to unpack .../36-dh-strip-nondeterminism_1.13.1-1_all.deb ...
373s Unpacking dh-strip-nondeterminism (1.13.1-1) ...
373s Selecting previously unselected package debugedit.
373s Preparing to unpack .../37-debugedit_1%3a5.0-5build1_s390x.deb ...
373s Unpacking debugedit (1:5.0-5build1) ...
373s Selecting previously unselected package dwz.
373s Preparing to unpack .../38-dwz_0.15-1build5_s390x.deb ...
373s Unpacking dwz (0.15-1build5) ...
373s Selecting previously unselected package gettext.
373s Preparing to unpack .../39-gettext_0.21-14ubuntu1_s390x.deb ...
373s Unpacking gettext (0.21-14ubuntu1) ...
373s Selecting previously unselected package intltool-debian.
373s Preparing to unpack .../40-intltool-debian_0.35.0+20060710.6_all.deb ...
373s Unpacking intltool-debian (0.35.0+20060710.6) ...
374s Selecting previously unselected package po-debconf.
374s Preparing to unpack .../41-po-debconf_1.0.21+nmu1_all.deb ...
374s Unpacking po-debconf (1.0.21+nmu1) ...
374s Selecting previously unselected package debhelper.
374s Preparing to unpack .../42-debhelper_13.14.1ubuntu5_all.deb ...
374s Unpacking debhelper (13.14.1ubuntu5) ...
374s Selecting previously unselected package dh-python.
374s Preparing to unpack .../43-dh-python_6.20231223ubuntu2_all.deb ...
374s Unpacking dh-python (6.20231223ubuntu2) ...
374s Selecting previously unselected package libfontenc1:s390x.
374s Preparing to unpack .../44-libfontenc1_1%3a1.1.8-1_s390x.deb ...
374s Unpacking libfontenc1:s390x (1:1.1.8-1) ...
374s Selecting previously unselected package x11-common.
374s Preparing to unpack .../45-x11-common_1%3a7.7+23ubuntu2_all.deb ...
374s Unpacking x11-common (1:7.7+23ubuntu2) ...
374s Selecting previously unselected package xfonts-encodings.
374s Preparing to unpack .../46-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ...
374s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ...
374s Selecting previously unselected package xfonts-utils.
374s Preparing to unpack .../47-xfonts-utils_1%3a7.7+6build2_s390x.deb ...
374s Unpacking xfonts-utils (1:7.7+6build2) ...
374s Selecting previously unselected package fonts-urw-base35.
374s Preparing to unpack .../48-fonts-urw-base35_20200910-8_all.deb ...
374s Unpacking fonts-urw-base35 (20200910-8) ...
374s Selecting previously unselected package libblas3:s390x.
374s Preparing to unpack .../49-libblas3_3.12.0-3_s390x.deb ...
374s Unpacking libblas3:s390x (3.12.0-3) ...
374s Selecting previously unselected package libpixman-1-0:s390x.
374s Preparing to unpack .../50-libpixman-1-0_0.42.2-1_s390x.deb ...
374s Unpacking libpixman-1-0:s390x (0.42.2-1) ...
374s Selecting previously unselected package libxcb-render0:s390x.
374s Preparing to unpack .../51-libxcb-render0_1.15-1_s390x.deb ...
374s Unpacking libxcb-render0:s390x (1.15-1) ...
374s Selecting previously unselected package libxcb-shm0:s390x.
374s Preparing to unpack .../52-libxcb-shm0_1.15-1_s390x.deb ...
374s Unpacking libxcb-shm0:s390x (1.15-1) ...
374s Selecting previously unselected package libxrender1:s390x.
374s Preparing to unpack .../53-libxrender1_1%3a0.9.10-1.1_s390x.deb ...
374s Unpacking libxrender1:s390x (1:0.9.10-1.1) ...
374s Selecting previously unselected package libcairo2:s390x.
374s Preparing to unpack .../54-libcairo2_1.18.0-1ubuntu1_s390x.deb ...
374s Unpacking libcairo2:s390x (1.18.0-1ubuntu1) ...
374s Selecting previously unselected package libgfortran5:s390x.
374s Preparing to unpack .../55-libgfortran5_14-20240315-1ubuntu1_s390x.deb ...
374s Unpacking libgfortran5:s390x (14-20240315-1ubuntu1) ...
374s Selecting previously unselected package libgraphite2-3:s390x.
374s Preparing to unpack .../56-libgraphite2-3_1.3.14-2_s390x.deb ...
374s Unpacking libgraphite2-3:s390x (1.3.14-2) ...
374s Selecting previously unselected package libharfbuzz0b:s390x.
374s Preparing to unpack .../57-libharfbuzz0b_8.3.0-2build1_s390x.deb ...
374s Unpacking libharfbuzz0b:s390x (8.3.0-2build1) ...
374s Selecting previously unselected package libimagequant0:s390x.
374s Preparing to unpack .../58-libimagequant0_2.18.0-1_s390x.deb ...
374s Unpacking libimagequant0:s390x (2.18.0-1) ...
374s Selecting previously unselected package liblapack3:s390x.
374s Preparing to unpack .../59-liblapack3_3.12.0-3_s390x.deb ...
374s Unpacking liblapack3:s390x (3.12.0-3) ...
375s Selecting previously unselected package liblbfgsb0:s390x.
375s Preparing to unpack .../60-liblbfgsb0_3.0+dfsg.4-1_s390x.deb ...
375s Unpacking liblbfgsb0:s390x (3.0+dfsg.4-1) ...
375s Selecting previously unselected package liblcms2-2:s390x.
375s Preparing to unpack .../61-liblcms2-2_2.14-2_s390x.deb ...
375s Unpacking liblcms2-2:s390x (2.14-2) ...
375s Selecting previously unselected package libmbedcrypto7t64:s390x.
375s Preparing to unpack .../62-libmbedcrypto7t64_2.28.7-1.1ubuntu1_s390x.deb ...
375s Unpacking libmbedcrypto7t64:s390x (2.28.7-1.1ubuntu1) ...
375s Selecting previously unselected package libmbedx509-1t64:s390x.
375s Preparing to unpack .../63-libmbedx509-1t64_2.28.7-1.1ubuntu1_s390x.deb ...
375s Unpacking libmbedx509-1t64:s390x (2.28.7-1.1ubuntu1) ...
375s Selecting previously unselected package libmbedtls14t64:s390x.
375s Preparing to unpack .../64-libmbedtls14t64_2.28.7-1.1ubuntu1_s390x.deb ...
375s Unpacking libmbedtls14t64:s390x (2.28.7-1.1ubuntu1) ...
375s Selecting previously unselected package libraqm0:s390x.
375s Preparing to unpack .../65-libraqm0_0.10.1-1_s390x.deb ...
375s Unpacking libraqm0:s390x (0.10.1-1) ...
375s Selecting previously unselected package libwebpdemux2:s390x.
375s Preparing to unpack .../66-libwebpdemux2_1.3.2-0.4build2_s390x.deb ...
375s Unpacking libwebpdemux2:s390x (1.3.2-0.4build2) ...
375s Selecting previously unselected package libwebpmux3:s390x.
375s Preparing to unpack .../67-libwebpmux3_1.3.2-0.4build2_s390x.deb ...
375s Unpacking libwebpmux3:s390x (1.3.2-0.4build2) ...
375s Selecting previously unselected package ncbi-data.
375s Preparing to unpack .../68-ncbi-data_6.1.20170106+dfsg2-1_all.deb ...
375s Unpacking ncbi-data (6.1.20170106+dfsg2-1) ...
375s Selecting previously unselected package ncbi-blast+.
375s Preparing to unpack .../69-ncbi-blast+_2.12.0+ds-4build1_s390x.deb ...
375s Unpacking ncbi-blast+ (2.12.0+ds-4build1) ...
376s Selecting previously unselected package python3-numpy.
376s Preparing to unpack .../70-python3-numpy_1%3a1.24.2-3ubuntu1_s390x.deb ...
376s Unpacking python3-numpy (1:1.24.2-3ubuntu1) ...
376s Selecting previously unselected package libopenjp2-7:s390x.
376s Preparing to unpack .../71-libopenjp2-7_2.5.0-2build2_s390x.deb ...
376s Unpacking libopenjp2-7:s390x (2.5.0-2build2) ...
376s Selecting previously unselected package python3-pil:s390x.
376s Preparing to unpack .../72-python3-pil_10.2.0-1_s390x.deb ...
376s Unpacking python3-pil:s390x (10.2.0-1) ...
376s Selecting previously unselected package python3-cairo.
376s Preparing to unpack .../73-python3-cairo_1.25.1-2build1_s390x.deb ...
376s Unpacking python3-cairo (1.25.1-2build1) ...
376s Selecting previously unselected package python3-freetype.
376s Preparing to unpack .../74-python3-freetype_2.4.0-1_all.deb ...
376s Unpacking python3-freetype (2.4.0-1) ...
376s Selecting previously unselected package python3-rlpycairo.
376s Preparing to unpack .../75-python3-rlpycairo_0.3.0-3_all.deb ...
376s Unpacking python3-rlpycairo (0.3.0-3) ...
376s Selecting previously unselected package python3-reportlab.
376s Preparing to unpack .../76-python3-reportlab_4.1.0-4_all.deb ...
376s Unpacking python3-reportlab (4.1.0-4) ...
377s Selecting previously unselected package xml-core.
377s Preparing to unpack .../77-xml-core_0.19_all.deb ...
377s Unpacking xml-core (0.19) ...
377s Selecting previously unselected package w3c-sgml-lib.
377s Preparing to unpack .../78-w3c-sgml-lib_1.3-3_all.deb ...
377s Unpacking w3c-sgml-lib (1.3-3) ...
377s Selecting previously unselected package python3-biopython.
377s Preparing to unpack .../79-python3-biopython_1.81+dfsg-3_s390x.deb ...
377s Unpacking python3-biopython (1.81+dfsg-3) ...
377s Selecting previously unselected package python3-dateutil.
377s Preparing to unpack .../80-python3-dateutil_2.8.2-3_all.deb ...
377s Unpacking python3-dateutil (2.8.2-3) ...
377s Selecting previously unselected package python3-pandas-lib:s390x.
377s Preparing to unpack .../81-python3-pandas-lib_2.1.4+dfsg-4ubuntu2_s390x.deb ...
377s Unpacking python3-pandas-lib:s390x (2.1.4+dfsg-4ubuntu2) ...
377s Selecting previously unselected package python3-pandas.
377s Preparing to unpack .../82-python3-pandas_2.1.4+dfsg-4ubuntu2_all.deb ...
377s Unpacking python3-pandas (2.1.4+dfsg-4ubuntu2) ...
378s Selecting previously unselected package python3-decorator.
378s Preparing to unpack .../83-python3-decorator_5.1.1-5_all.deb ...
378s Unpacking python3-decorator (5.1.1-5) ...
378s Selecting previously unselected package python3-scipy.
378s Preparing to unpack .../84-python3-scipy_1.11.4-6_s390x.deb ...
378s Unpacking python3-scipy (1.11.4-6) ...
379s Selecting previously unselected package python3-packaging.
379s Preparing to unpack .../85-python3-packaging_23.2-1_all.deb ...
379s Unpacking python3-packaging (23.2-1) ...
379s Selecting previously unselected package python3-presto.
379s Preparing to unpack .../86-python3-presto_0.7.2-1_s390x.deb ...
379s Unpacking python3-presto (0.7.2-1) ...
379s Selecting previously unselected package presto.
379s Preparing to unpack .../87-presto_0.7.2-1_all.deb ...
379s Unpacking presto (0.7.2-1) ...
379s Selecting previously unselected package pybuild-plugin-autopkgtest.
379s Preparing to unpack .../88-pybuild-plugin-autopkgtest_6.20231223ubuntu2_all.deb ...
379s Unpacking pybuild-plugin-autopkgtest (6.20231223ubuntu2) ...
379s Selecting previously unselected package python3-all.
379s Preparing to unpack .../89-python3-all_3.12.2-0ubuntu1_s390x.deb ...
379s Unpacking python3-all (3.12.2-0ubuntu1) ...
379s Selecting previously unselected package autopkgtest-satdep.
379s Preparing to unpack .../90-1-autopkgtest-satdep.deb ...
379s Unpacking autopkgtest-satdep (0) ...
379s Setting up dh-python (6.20231223ubuntu2) ...
379s Setting up libgraphite2-3:s390x (1.3.14-2) ...
379s Setting up liblcms2-2:s390x (2.14-2) ...
379s Setting up ncbi-data (6.1.20170106+dfsg2-1) ...
379s Setting up libpixman-1-0:s390x (0.42.2-1) ...
379s Setting up libmbedcrypto7t64:s390x (2.28.7-1.1ubuntu1) ...
379s Setting up libxrender1:s390x (1:0.9.10-1.1) ...
379s Setting up libxcb-render0:s390x (1.15-1) ...
379s Setting up libarchive-zip-perl (1.68-1) ...
379s Setting up libwebpdemux2:s390x (1.3.2-0.4build2) ...
379s Setting up libdebhelper-perl (13.14.1ubuntu5) ...
379s Setting up x11-common (1:7.7+23ubuntu2) ...
380s Setting up m4 (1.4.19-4) ...
380s Setting up python3-all (3.12.2-0ubuntu1) ...
380s Setting up libxcb-shm0:s390x (1.15-1) ...
380s Setting up libgomp1:s390x (14-20240315-1ubuntu1) ...
380s Setting up python3-freetype (2.4.0-1) ...
380s Setting up libcairo2:s390x (1.18.0-1ubuntu1) ...
380s Setting up python3-decorator (5.1.1-5) ...
380s Setting up libfontenc1:s390x (1:1.1.8-1) ...
380s Setting up autotools-dev (20220109.1) ...
380s Setting up libblas3:s390x (3.12.0-3) ...
380s update-alternatives: using /usr/lib/s390x-linux-gnu/blas/libblas.so.3 to provide /usr/lib/s390x-linux-gnu/libblas.so.3 (libblas.so.3-s390x-linux-gnu) in auto mode
380s Setting up python3-packaging (23.2-1) ...
380s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ...
380s Setting up libimagequant0:s390x (2.18.0-1) ...
380s Setting up libmpc3:s390x (1.3.1-1) ...
380s Setting up libatomic1:s390x (14-20240315-1ubuntu1) ...
380s Setting up autopoint (0.21-14ubuntu1) ...
380s Setting up libgfortran5:s390x (14-20240315-1ubuntu1) ...
380s Setting up autoconf (2.71-3) ...
380s Setting up libubsan1:s390x (14-20240315-1ubuntu1) ...
380s Setting up dwz (0.15-1build5) ...
380s Setting up libasan8:s390x (14-20240315-1ubuntu1) ...
380s Setting up debugedit (1:5.0-5build1) ...
380s Setting up libopenjp2-7:s390x (2.5.0-2build2) ...
380s Setting up libsub-override-perl (0.10-1) ...
380s Setting up libharfbuzz0b:s390x (8.3.0-2build1) ...
380s Setting up python3-dateutil (2.8.2-3) ...
380s Setting up sgml-base (1.31) ...
380s Setting up libisl23:s390x (0.26-3) ...
380s Setting up libwebpmux3:s390x (1.3.2-0.4build2) ...
380s Setting up libcc1-0:s390x (14-20240315-1ubuntu1) ...
380s Setting up libitm1:s390x (14-20240315-1ubuntu1) ...
380s Setting up cd-hit (4.8.1-4) ...
380s Setting up automake (1:1.16.5-1.3ubuntu1) ...
380s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode
380s Setting up libfile-stripnondeterminism-perl (1.13.1-1) ...
380s Setting up liblapack3:s390x (3.12.0-3) ...
380s update-alternatives: using /usr/lib/s390x-linux-gnu/lapack/liblapack.so.3 to provide /usr/lib/s390x-linux-gnu/liblapack.so.3 (liblapack.so.3-s390x-linux-gnu) in auto mode
380s Setting up gettext (0.21-14ubuntu1) ...
380s Setting up libmbedx509-1t64:s390x (2.28.7-1.1ubuntu1) ...
380s Setting up python3-cairo (1.25.1-2build1) ...
381s Setting up xfonts-utils (1:7.7+6build2) ...
381s Setting up intltool-debian (0.35.0+20060710.6) ...
381s Setting up cpp-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
381s Setting up python3-rlpycairo (0.3.0-3) ...
381s Setting up libraqm0:s390x (0.10.1-1) ...
381s Setting up python3-numpy (1:1.24.2-3ubuntu1) ...
385s Setting up dh-strip-nondeterminism (1.13.1-1) ...
385s Setting up libgcc-13-dev:s390x (13.2.0-21ubuntu1) ...
385s Setting up libmbedtls14t64:s390x (2.28.7-1.1ubuntu1) ...
385s Setting up xml-core (0.19) ...
385s Setting up libstdc++-13-dev:s390x (13.2.0-21ubuntu1) ...
385s Setting up liblbfgsb0:s390x (3.0+dfsg.4-1) ...
385s Setting up python3-scipy (1.11.4-6) ...
392s Setting up cpp-13 (13.2.0-21ubuntu1) ...
392s Setting up cpp-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
392s Setting up po-debconf (1.0.21+nmu1) ...
392s Setting up python3-pandas-lib:s390x (2.1.4+dfsg-4ubuntu2) ...
392s Setting up fonts-urw-base35 (20200910-8) ...
392s Setting up ncbi-blast+ (2.12.0+ds-4build1) ...
392s Setting up python3-pil:s390x (10.2.0-1) ...
393s Setting up python3-pandas (2.1.4+dfsg-4ubuntu2) ...
404s Setting up gcc-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
404s Setting up gcc-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
404s Setting up g++-13-s390x-linux-gnu (13.2.0-21ubuntu1) ...
404s Setting up gcc-13 (13.2.0-21ubuntu1) ...
404s Setting up python3-reportlab (4.1.0-4) ...
405s Setting up cpp (4:13.2.0-7ubuntu1) ...
405s Setting up g++-13 (13.2.0-21ubuntu1) ...
405s Setting up libtool (2.4.7-7) ...
405s Setting up g++-s390x-linux-gnu (4:13.2.0-7ubuntu1) ...
405s Setting up gcc (4:13.2.0-7ubuntu1) ...
405s Setting up dh-autoreconf (20) ...
405s Setting up g++ (4:13.2.0-7ubuntu1) ...
405s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode
405s Setting up build-essential (12.10ubuntu1) ...
405s Setting up debhelper (13.14.1ubuntu5) ...
405s Setting up pybuild-plugin-autopkgtest (6.20231223ubuntu2) ...
405s Processing triggers for libc-bin (2.39-0ubuntu6) ...
405s Processing triggers for man-db (2.12.0-3build4) ...
408s Processing triggers for install-info (7.1-3build1) ...
408s Processing triggers for sgml-base (1.31) ...
408s Setting up w3c-sgml-lib (1.3-3) ...
445s Setting up python3-biopython (1.81+dfsg-3) ...
448s Setting up python3-presto (0.7.2-1) ...
448s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s'
448s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter))
448s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s'
448s   sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:]))
448s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s'
448s   header['SPECIES'] = re.sub('\s', '_', fields[2])
448s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\('
448s   header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3])
448s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s'
448s   header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE'
448s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.'
448s   version = re.sub('\.linux.*$','',version)
448s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>'
448s   id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)')
448s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s'
448s   if replace_special:  parse_id = lambda x: re.sub('[\s,=|]+', '_', x)
448s Setting up presto (0.7.2-1) ...
448s Setting up autopkgtest-satdep (0) ...
453s (Reading database ... 90698 files and directories currently installed.)
453s Removing autopkgtest-satdep (0) ...
454s autopkgtest [01:12:45]: test pybuild-autopkgtest: pybuild-autopkgtest
454s autopkgtest [01:12:45]: test pybuild-autopkgtest: [-----------------------
455s pybuild-autopkgtest
455s I: pybuild pybuild:310: cp -r /tmp/autopkgtest.eWjFWB/build.FWC/src/bin /tmp/autopkgtest.eWjFWB/autopkgtest_tmp/build; rm /tmp/autopkgtest.eWjFWB/build.FWC/src/tests/test_ClusterSets.py || echo "Test file already removed or moved";
455s I: pybuild base:305: cd /tmp/autopkgtest.eWjFWB/autopkgtest_tmp/build; python3.12 -m unittest discover -v 
457s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok
457s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok
457s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok
457s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok
457s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n'
457s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n'
457s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n'
457s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n'
457s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n'
457s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n'
457s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... ok
457s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok
457s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok
457s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok
457s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok
457s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok
457s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok
457s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok
457s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok
457s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok
457s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok
457s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok
457s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... ok
457s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok
457s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok
457s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok
457s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok
457s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok
457s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok
457s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok
457s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok
457s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok
457s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok
457s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok
457s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... -> test_collapseAnnotation()
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']})
457s <- test_collapseAnnotation() 0.000
457s -> test_getCoordKey()
457s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066']
457s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6']
457s ['000034_0199_0169', 'GXGJ56Z01AE06X']
457s <- test_getCoordKey() 0.000
457s -> test_mergeAnnotation()
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']})
457s <- test_mergeAnnotation() 0.000
457s -> test_renameAnnotation()
457s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']})
457s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'})
457s <- test_renameAnnotation() 0.000
457s -> test_calculateSetError()
457s Frequency consensus error>
457s   REF> CGGCGTAA
457s  SEQ1> CGGCGTAA
457s  SEQ2> CCNNGTAA
457s  SEQ3> CGGC--TA
457s  SEQ4> CGNN--TA
457s  SEQ5> CGGC--AA
457s ERROR> 0.250000
457s Quality consensus error>
457s   REF> CGGCNNAA
457s  SEQ1> CGGCGTAA
457s  SEQ2> CCNNGTAA
457s  SEQ3> CGGC--TA
457s  SEQ4> CGNN--TA
457s  SEQ5> CGGC--AA
457s ERROR> 0.233333
457s <- test_calculateSetError() 0.000
457s -> test_deleteSeqPositions()
457s MAX_GAP=0.4> CGGCAA
457s MAX_GAP=0.8> CGGCGTAA
457s <- test_deleteSeqPositions() 0.000
457s -> test_findGapPositions()
457s MAX_GAP=0.4> [4, 5]
457s MAX_GAP=0.8> []
457s <- test_findGapPositions() 0.000
457s -> test_frequencyConsensus()
457s MIN_FREQ=0.2> CGGCGTAA
457s MIN_FREQ=0.8> CGGCGTNA
457s <- test_frequencyConsensus() 0.000
457s -> test_qualityConsensus()
457s   MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90]
457s  MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90]
457s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90]
457s <- test_qualityConsensus() 0.000
457s -> test_checkSeqEqual()
457s DNA Equality>
457s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
457s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
457s          EQUAL> True
457s 
457s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
457s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
457s          EQUAL> False
457s 
457s   SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA
457s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
457s          EQUAL> True
457s 
457s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
457s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
457s          EQUAL> False
457s 
457s   SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA
457s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
457s          EQUAL> True
457s 
457s   SEQ3|COUNT=3> CCACGTTTTACTAATTAATA
457s   SEQ4|COUNT=4> CCACGTTTTANTAATTAATA
457s          EQUAL> True
457s 
457s <- test_checkSeqEqual() 0.000
457s -> test_convert454Header()
457s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'})
457s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'})
457s <- test_convert454Header() 0.000
457s -> test_convertGenbankHeader()
457s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
457s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'})
457s <- test_convertGenbankHeader() 0.000
457s -> test_convertGenericHeader()
457s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
457s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'})
457s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'})
457s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"})
457s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'})
457s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'})
457s <- test_convertGenericHeader() 0.000
457s -> test_convertIMGTHeader()
457s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'})
457s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'})
457s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'})
457s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'})
457s OrderedDict({'ID': 'IGHV1-18*01'})
457s OrderedDict({'ID': 'IGHV1-69*07'})
457s OrderedDict({'ID': 'IGHV(III)-22-2*01'})
457s OrderedDict({'ID': 'TRAV11*01'})
457s <- test_convertIMGTHeader() 0.000
457s -> test_convertIlluminaHeader()
457s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'})
457s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'})
457s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'})
457s <- test_convertIlluminaHeader() 0.000
457s -> test_convertSRAHeader()
457s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'})
457s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'})
457s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'})
457s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'})
457s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'})
457s <- test_convertSRAHeader() 0.000
457s -> test_calculateDistances()
457s <- test_calculateDistances() 0.001
457s -> test_countMismatches()
457s <- test_countMismatches() 0.004
457s -> test_initializeMismatchDictionary()
457s <- test_initializeMismatchDictionary() 0.000
457s -> test_getFileType()
457s <- test_getFileType() 0.000
457s -> test_extractAlignment()
457s   SEQ1>
457s       SEQ> CCACGTTTTAGTAATTAATA
457s   ALN-SEQ> CCACGTTTTAGT
457s    ALN-PR> ----GTTTTAGT
457s    PRIMER> GTTTTAGT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ2>
457s       SEQ> CCNCGTTTTAGTAATTAATA
457s   ALN-SEQ> CCNCGTTTTAGT
457s    ALN-PR> ----GTTTTAGT
457s    PRIMER> GTTTTAGT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ3>
457s       SEQ> GGGCGTTTTAGTAATTAATA
457s   ALN-SEQ> GGGCGTTTTAGT
457s    ALN-PR> ----GTTTTAGT
457s    PRIMER> GTTTTAGT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ4>
457s       SEQ> GGNNGTTTTACTAATTAATA
457s   ALN-SEQ> GGNNGTTTTACT
457s    ALN-PR> ----GTTTTACT
457s    PRIMER> GTTTTACT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ5>
457s       SEQ> NNGCNNNNNACTAATTAATA
457s   ALN-SEQ> NNGCNNNNNACT
457s    ALN-PR> ----NNNNNACT
457s    PRIMER> NNNNNACT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ6>
457s       SEQ> GGGATANNNACTAATTAATA
457s   ALN-SEQ> GGGATANNNACT
457s    ALN-PR> ----TANNNACT
457s    PRIMER> TANNNACT
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ7>
457s       SEQ> NNNNNNNNNNNNNNNNNNNN
457s   ALN-SEQ> NNNNNNNNNNNN
457s    ALN-PR> ----NNNNNNNN
457s    PRIMER> NNNNNNNN
457s     START> 4
457s       END> 12
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s <- test_extractAlignment() 0.000
457s -> test_localAlignment()
457s TEST Ns>
457s   SEQ1>
457s       SEQ> CCACGTTTTAGTAATTAATA
457s   ALN-SEQ> CCACGTTTTAGTAATTAATA
457s    ALN-PR> -CACGTTTT-----------
457s    PRIMER> PR1
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ2>
457s       SEQ> CCNCGTTTTAGTAATTAATA
457s   ALN-SEQ> CCNCGTTTTAGTAATTAATA
457s    ALN-PR> -CACGTTTT-----------
457s    PRIMER> PR1
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.125000
457s 
457s   SEQ3>
457s       SEQ> GGGCGTTTTAGTAATTAATA
457s   ALN-SEQ> GGGCGTTTTAGTAATTAATA
457s    ALN-PR> -GGCGTTTT-----------
457s    PRIMER> PR2
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ4>
457s       SEQ> GGNNGTTTTACTAATTAATA
457s   ALN-SEQ> GGNNGTTTTACTAATTAATA
457s    ALN-PR> GGC-GTTTT-----------
457s    PRIMER> PR2
457s     START> 0
457s       END> 9
457s      GAPS> 1
457s     ERROR> 0.250000
457s 
457s   SEQ5>
457s       SEQ> NNGCNNNNNACTAATTAATA
457s   ALN-SEQ> NNGCNNNNNACTAATTAATA
457s    ALN-PR> ------------ANATAA--
457s    PRIMER> PR3
457s     START> 12
457s       END> 18
457s      GAPS> 0
457s     ERROR> 0.375000
457s 
457s   SEQ6>
457s       SEQ> GGGATANNNACTAATTAATA
457s   ALN-SEQ> GGGATANNNACTAATTAATA
457s    ALN-PR> -GGANA--------------
457s    PRIMER> PR3
457s     START> 1
457s       END> 6
457s      GAPS> 0
457s     ERROR> 0.375000
457s 
457s   SEQ7>
457s       SEQ> NNNNNNNNNNNNNNNNNNNN
457s   ALN-SEQ> None
457s    ALN-PR> None
457s    PRIMER> None
457s     START> None
457s       END> None
457s      GAPS> 0
457s     ERROR> 1.000000
457s 
457s TEST INDELS>
457s   SEQ1>
457s       SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG
457s   ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG
457s    ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------
457s    PRIMER> PR1
457s     START> 15
457s       END> 38
457s      GAPS> 0
457s     ERROR> 0.083333
457s 
457s   SEQ2>
457s       SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG
457s   ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG
457s    ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------
457s    PRIMER> PR1
457s     START> 14
457s       END> 38
457s      GAPS> 2
457s     ERROR> 0.208333
457s 
457s   SEQ3>
457s       SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG
457s   ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG
457s    ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------
457s    PRIMER> PR1
457s     START> 15
457s       END> 38
457s      GAPS> 1
457s     ERROR> 0.125000
457s 
457s   SEQ4>
457s       SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT
457s   ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT
457s    ALN-PR> ------CATCT-TCCTCTA-------------------------------------------
457s    PRIMER> PR2
457s     START> 6
457s       END> 19
457s      GAPS> 1
457s     ERROR> 0.250000
457s 
457s   SEQ5>
457s       SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG
457s   ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG
457s    ALN-PR> ------CATCTTCCTCTA--------------------------------------------
457s    PRIMER> PR2
457s     START> 6
457s       END> 18
457s      GAPS> 0
457s     ERROR> 0.166667
457s 
457s   SEQ6>
457s       SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA
457s   ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA
457s    ALN-PR> TCT-TCCTCTA---------------------------------------------------
457s    PRIMER> PR2
457s     START> 0
457s       END> 11
457s      GAPS> 1
457s     ERROR> 0.250000
457s 
457s   SEQ7>
457s       SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s   ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s    ALN-PR> --GTGAAGA-GCCTG-----------------------------------------------
457s    PRIMER> PR3
457s     START> 2
457s       END> 15
457s      GAPS> 1
457s     ERROR> 0.083333
457s 
457s   SEQ8>
457s       SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s   ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s    ALN-PR> ---TGAAGA-GCCTG-----------------------------------------------
457s    PRIMER> PR3
457s     START> 3
457s       END> 15
457s      GAPS> 1
457s     ERROR> 0.166667
457s 
457s   SEQ9>
457s       SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s   ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC
457s    ALN-PR> ---TGAAGA-GCCTG-----------------------------------------------
457s    PRIMER> PR3
457s     START> 3
457s       END> 15
457s      GAPS> 1
457s     ERROR> 0.333333
457s 
457s   SEQ10>
457s       SEQ> --------------------------------------------------------------
457s   ALN-SEQ> None
457s    ALN-PR> None
457s    PRIMER> None
457s     START> None
457s       END> None
457s      GAPS> 0
457s     ERROR> 1.000000
457s 
457s <- test_localAlignment() 0.032
457s -> test_maskSeq()
457s TEST CUT>
457s  ID> SEQ|PRIMER=A|BARCODE=CCA
457s SEQ> AGTAATTAATA
457s 
457s TEST MASK>
457s  ID> SEQ|PRIMER=A|BARCODE=CCA
457s SEQ> NNNNNNAGTAATTAATA
457s 
457s TEST TRIM>
457s  ID> SEQ|PRIMER=A|BARCODE=CCA
457s SEQ> CGTTTTAGTAATTAATA
457s 
457s TEST TAG>
457s  ID> SEQ|PRIMER=A|BARCODE=CCA
457s SEQ> CCACGTTTTAGTAATTAATA
457s 
457s <- test_maskSeq() 0.001
457s -> test_scoreAlignment()
457s   SEQ1>
457s       SEQ> CCACGTTTTAGTAATTAATA
457s   ALN-SEQ> CCACGTTTT
457s    ALN-PR> -CACGTTTT
457s    PRIMER> PR1
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ2>
457s       SEQ> CCNCGTTTTAGTAATTAATA
457s   ALN-SEQ> CCNCGTTTT
457s    ALN-PR> -CACGTTTT
457s    PRIMER> PR1
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.125000
457s 
457s   SEQ3>
457s       SEQ> GGGCGTTTTAGTAATTAATA
457s   ALN-SEQ> GGGCGTTTT
457s    ALN-PR> -GGCGTTTT
457s    PRIMER> PR2
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.000000
457s 
457s   SEQ4>
457s       SEQ> GGNNGTTTTACTAATTAATA
457s   ALN-SEQ> GGNNGTTTT
457s    ALN-PR> -GGCGTTTT
457s    PRIMER> PR2
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.250000
457s 
457s   SEQ5>
457s       SEQ> NNGCNNNNNACTAATTAATA
457s   ALN-SEQ> NNGCNNNNN
457s    ALN-PR> -GGCGTTTT
457s    PRIMER> PR2
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.750000
457s 
457s   SEQ6>
457s       SEQ> GGGATANNNACTAATTAATA
457s   ALN-SEQ> GGGATANNN
457s    ALN-PR> -GGANATAA
457s    PRIMER> PR3
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 0.375000
457s 
457s   SEQ7>
457s       SEQ> NNNNNNNNNNNNNNNNNNNN
457s   ALN-SEQ> NNNNNNNNN
457s    ALN-PR> -CACGTTTT
457s    PRIMER> None
457s     START> 1
457s       END> 9
457s      GAPS> 0
457s     ERROR> 1.000000
457s 
457s <- test_scoreAlignment() 0.011
457s -> test_calculateSetError()
457s REF> CGGCGTAA 0.4347826086956522
457s REF> NNNNNNNN 1.0
457s <- test_calculateSetError() 0.000
457s -> test_filterQuality()
457s RESULT> True 25
457s RESULT> False 5
457s RESULT> False 0
457s <- test_filterQuality() 0.000
457s -> test_meanQuality()
457s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40]
457s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20]
457s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0]
457s <- test_meanQuality() 0.000
457s -> test_scoreDNA()
457s Default DNA Scores>
457s   A==A> 1
457s   A==T> 0
457s   A==R> 1
457s   U==T> 1
457s   A==N> 1
457s   N==A> 1
457s   A==-> 0
457s   -==A> 0
457s Symmetric DNA Scores>
457s   A==A> 1
457s   A==T> 0
457s   A==R> 1
457s   U==T> 1
457s   A==N> 1
457s   N==A> 1
457s   A==-> 1
457s   -==A> 1
457s Asymmetric DNA Scores>
457s   A==A> 1
457s   A==T> 0
457s   A==R> 1
457s   U==T> 1
457s   A==N> 1
457s   N==A> 0
457s   A==-> 1
457s   -==A> 0
457s <- test_scoreDNA() 0.000
457s -> test_scoreSeqPair()
457s Default DNA Scores>
457s     SEQ1> CGGCGTAA
457s     SEQ2> CGNNGTAG
457s    SCORE> 7
457s   WEIGHT> 8
457s    ERROR> 0.125000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ3> CGGC--AA
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ4> CGNN--AG
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ5> NNNNNNNN
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ6> NNNNNNAA
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ3> CGGC--AA
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ4> CGNN--AG
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ5> NNNNNNNN
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ6> NNNNNNAA
457s    SCORE> 7
457s   WEIGHT> 8
457s    ERROR> 0.125000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ4> CGNN--AG
457s    SCORE> 7
457s   WEIGHT> 8
457s    ERROR> 0.125000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ5> NNNNNNNN
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ6> NNNNNNAA
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ7> --------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ8> CG------
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ5> NNNNNNNN
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ6> NNNNNNAA
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ7> --------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ8> CG------
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ6> NNNNNNAA
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ7> --------
457s     SEQ8> CG------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s Asymmetric DNA Scores>
457s     SEQ1> CGGCGTAA
457s     SEQ2> CGNNGTAG
457s    SCORE> 7
457s   WEIGHT> 8
457s    ERROR> 0.125000
457s 
457s     SEQ1> CGGCGTAA
457s ok
457s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok
457s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok
457s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok
457s 
457s ----------------------------------------------------------------------
457s Ran 38 tests in 0.065s
457s 
457s OK (skipped=6)
457s     SEQ3> CGGC--AA
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ4> CGNN--AG
457s    SCORE> 7
457s   WEIGHT> 8
457s    ERROR> 0.125000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ5> NNNNNNNN
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ6> NNNNNNAA
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ7> --------
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ8> CG------
457s    SCORE> 8
457s   WEIGHT> 8
457s    ERROR> 0.000000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ3> CGGC--AA
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ4> CGNN--AG
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ5> NNNNNNNN
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ6> NNNNNNAA
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ7> --------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ8> CG------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ4> CGNN--AG
457s    SCORE> 5
457s   WEIGHT> 8
457s    ERROR> 0.375000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ5> NNNNNNNN
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ6> NNNNNNAA
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ7> --------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ8> CG------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ5> NNNNNNNN
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ6> NNNNNNAA
457s    SCORE> 3
457s   WEIGHT> 8
457s    ERROR> 0.625000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ7> --------
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ8> CG------
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ6> NNNNNNAA
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ8> CG------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ7> --------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ7> --------
457s     SEQ8> CG------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s Masked DNA Scores>
457s     SEQ1> CGGCGTAA
457s     SEQ2> CGNNGTAG
457s    SCORE> 5
457s   WEIGHT> 6
457s    ERROR> 0.166667
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ3> CGGC--AA
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ4> CGNN--AG
457s    SCORE> 3
457s   WEIGHT> 6
457s    ERROR> 0.500000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ5> NNNNNNNN
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ6> NNNNNNAA
457s    SCORE> 2
457s   WEIGHT> 2
457s    ERROR> 0.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 8
457s    ERROR> 1.000000
457s 
457s     SEQ1> CGGCGTAA
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ3> CGGC--AA
457s    SCORE> 3
457s   WEIGHT> 6
457s    ERROR> 0.500000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ4> CGNN--AG
457s    SCORE> 4
457s   WEIGHT> 6
457s    ERROR> 0.333333
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ5> NNNNNNNN
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ6> NNNNNNAA
457s    SCORE> 1
457s   WEIGHT> 2
457s    ERROR> 0.500000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 6
457s    ERROR> 1.000000
457s 
457s     SEQ2> CGNNGTAG
457s     SEQ8> CG------
457s    SCORE> 2
457s   WEIGHT> 6
457s    ERROR> 0.666667
457s 
457s     SEQ3> CGGC--AA
457s     SEQ4> CGNN--AG
457s    SCORE> 5
457s   WEIGHT> 6
457s    ERROR> 0.166667
457s 
457s     SEQ3> CGGC--AA
457s     SEQ5> NNNNNNNN
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ6> NNNNNNAA
457s    SCORE> 2
457s   WEIGHT> 2
457s    ERROR> 0.000000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ7> --------
457s    SCORE> 2
457s   WEIGHT> 8
457s    ERROR> 0.750000
457s 
457s     SEQ3> CGGC--AA
457s     SEQ8> CG------
457s    SCORE> 4
457s   WEIGHT> 8
457s    ERROR> 0.500000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ5> NNNNNNNN
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ6> NNNNNNAA
457s    SCORE> 1
457s   WEIGHT> 2
457s    ERROR> 0.500000
457s 
457s     SEQ4> CGNN--AG
457s     SEQ7> --------
457s    SCORE> 2
457s   WEIGHT> 6
457s    ERROR> 0.666667
457s 
457s     SEQ4> CGNN--AG
457s     SEQ8> CG------
457s    SCORE> 4
457s   WEIGHT> 6
457s    ERROR> 0.333333
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ6> NNNNNNAA
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ5> NNNNNNNN
457s     SEQ8> CG------
457s    SCORE> 0
457s   WEIGHT> 0
457s    ERROR> 1.000000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ7> --------
457s    SCORE> 0
457s   WEIGHT> 2
457s    ERROR> 1.000000
457s 
457s     SEQ6> NNNNNNAA
457s     SEQ8> CG------
457s    SCORE> 0
457s   WEIGHT> 2
457s    ERROR> 1.000000
457s 
457s     SEQ7> --------
457s     SEQ8> CG------
457s    SCORE> 6
457s   WEIGHT> 8
457s    ERROR> 0.250000
457s 
457s <- test_scoreSeqPair() 0.008
457s -> test_weightDNA()
457s DNA Weight>
457s   SEQ1> 8
457s   SEQ2> 6
457s   SEQ3> 8
457s   SEQ4> 6
457s   SEQ5> 0
457s   SEQ6> 2
457s   SEQ7> 8
457s   SEQ8> 8
457s AA Weight>
457s   SEQ1> 8
457s   SEQ2> 6
457s   SEQ3> 8
457s   SEQ4> 6
457s <- test_weightDNA() 0.000
457s -> test_consensusUnify()
457s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1
457s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1
457s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1
457s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1
457s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1
457s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1
457s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2
457s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2
457s <- test_consensusUnify() 0.000
457s -> test_deletionUnify()
457s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False
457s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False
457s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False
457s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False
457s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False
457s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False
457s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True
457s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True
457s <- test_deletionUnify() 0.000
457s autopkgtest [01:12:48]: test pybuild-autopkgtest: -----------------------]
458s pybuild-autopkgtest  PASS
458s autopkgtest [01:12:49]: test pybuild-autopkgtest:  - - - - - - - - - - results - - - - - - - - - -
458s autopkgtest [01:12:49]: @@@@@@@@@@@@@@@@@@@@ summary
458s pybuild-autopkgtest  PASS
476s Creating nova instance adt-noble-s390x-presto-20240327-010510-juju-7f2275-prod-proposed-migration-environment-2-c1e0497b-3450-4b1d-85c0-0c63de4d2562 from image adt/ubuntu-noble-s390x-server-20240326.img (UUID c527e0e4-2e65-4e86-ad63-05d7f665f2fb)...