0s autopkgtest [22:19:53]: starting date and time: 2024-03-17 22:19:53+0000 0s autopkgtest [22:19:53]: git checkout: b506e79c ssh-setup/nova: fix ARCH having two lines of data 0s autopkgtest [22:19:53]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.7y6edlna/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:ncbi-blast+,src:mbedtls --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ncbi-blast+/2.12.0+ds-4build1 mbedtls/2.28.7-1.1ubuntu1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-s390x-4.secgroup --name adt-noble-s390x-ncbi-blast+-20240317-221953-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 204s autopkgtest [22:23:17]: testbed dpkg architecture: s390x 204s autopkgtest [22:23:17]: testbed apt version: 2.7.12 204s autopkgtest [22:23:17]: @@@@@@@@@@@@@@@@@@@@ test bed setup 205s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 206s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3691 kB] 206s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [485 kB] 206s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [51.4 kB] 206s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 206s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main s390x Packages [639 kB] 206s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main s390x c-n-f Metadata [3032 B] 206s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x Packages [1372 B] 206s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x c-n-f Metadata [116 B] 206s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x Packages [3878 kB] 206s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x c-n-f Metadata [7292 B] 206s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x Packages [33.2 kB] 206s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x c-n-f Metadata [116 B] 208s Fetched 8913 kB in 2s (4099 kB/s) 208s Reading package lists... 211s Reading package lists... 211s Building dependency tree... 211s Reading state information... 211s Calculating upgrade... 211s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 211s Reading package lists... 211s Building dependency tree... 211s Reading state information... 211s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 212s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 212s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 212s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 212s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 213s Reading package lists... 213s Reading package lists... 213s Building dependency tree... 213s Reading state information... 213s Calculating upgrade... 213s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 214s Reading package lists... 214s Building dependency tree... 214s Reading state information... 214s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 216s autopkgtest [22:23:29]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Tue Feb 13 23:45:46 UTC 2024 216s autopkgtest [22:23:29]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 221s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (dsc) [2451 B] 221s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (tar) [47.5 MB] 221s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (diff) [33.6 kB] 221s gpgv: Signature made Sun Mar 17 18:10:08 2024 UTC 221s gpgv: using RSA key AC483F68DE728F43F2202FCA568D30F321B2133D 221s gpgv: issuer "steve.langasek@ubuntu.com" 221s gpgv: Can't check signature: No public key 221s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.12.0+ds-4build1.dsc: no acceptable signature found 227s autopkgtest [22:23:40]: testing package ncbi-blast+ version 2.12.0+ds-4build1 227s autopkgtest [22:23:40]: build not needed 234s autopkgtest [22:23:47]: test run-unit-test: preparing testbed 235s Reading package lists... 235s Building dependency tree... 235s Reading state information... 235s Starting pkgProblemResolver with broken count: 0 235s Starting 2 pkgProblemResolver with broken count: 0 235s Done 235s The following additional packages will be installed: 235s libgomp1 libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 ncbi-blast+ 235s ncbi-blast+-legacy ncbi-data 235s The following NEW packages will be installed: 235s autopkgtest-satdep libgomp1 libmbedcrypto7t64 libmbedtls14t64 235s libmbedx509-1t64 ncbi-blast+ ncbi-blast+-legacy ncbi-data 235s 0 upgraded, 8 newly installed, 0 to remove and 0 not upgraded. 235s Need to get 17.7 MB/17.7 MB of archives. 235s After this operation, 75.1 MB of additional disk space will be used. 235s Get:1 /tmp/autopkgtest.1eRZs5/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [716 B] 236s Get:2 http://ftpmaster.internal/ubuntu noble/main s390x libgomp1 s390x 14-20240303-1ubuntu1 [151 kB] 236s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedcrypto7t64 s390x 2.28.7-1.1ubuntu1 [216 kB] 236s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedx509-1t64 s390x 2.28.7-1.1ubuntu1 [46.2 kB] 236s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x libmbedtls14t64 s390x 2.28.7-1.1ubuntu1 [84.7 kB] 236s Get:6 http://ftpmaster.internal/ubuntu noble/universe s390x ncbi-data all 6.1.20170106+dfsg1-10 [4395 kB] 238s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x ncbi-blast+ s390x 2.12.0+ds-4build1 [12.8 MB] 239s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x ncbi-blast+-legacy all 2.12.0+ds-4build1 [4990 B] 239s Fetched 17.7 MB in 4s (4649 kB/s) 240s Selecting previously unselected package libgomp1:s390x. 240s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52171 files and directories currently installed.) 240s Preparing to unpack .../0-libgomp1_14-20240303-1ubuntu1_s390x.deb ... 240s Unpacking libgomp1:s390x (14-20240303-1ubuntu1) ... 240s Selecting previously unselected package libmbedcrypto7t64:s390x. 240s Preparing to unpack .../1-libmbedcrypto7t64_2.28.7-1.1ubuntu1_s390x.deb ... 240s Unpacking libmbedcrypto7t64:s390x (2.28.7-1.1ubuntu1) ... 240s Selecting previously unselected package libmbedx509-1t64:s390x. 240s Preparing to unpack .../2-libmbedx509-1t64_2.28.7-1.1ubuntu1_s390x.deb ... 240s Unpacking libmbedx509-1t64:s390x (2.28.7-1.1ubuntu1) ... 240s Selecting previously unselected package libmbedtls14t64:s390x. 240s Preparing to unpack .../3-libmbedtls14t64_2.28.7-1.1ubuntu1_s390x.deb ... 240s Unpacking libmbedtls14t64:s390x (2.28.7-1.1ubuntu1) ... 240s Selecting previously unselected package ncbi-data. 240s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg1-10_all.deb ... 240s Unpacking ncbi-data (6.1.20170106+dfsg1-10) ... 240s Selecting previously unselected package ncbi-blast+. 240s Preparing to unpack .../5-ncbi-blast+_2.12.0+ds-4build1_s390x.deb ... 240s Unpacking ncbi-blast+ (2.12.0+ds-4build1) ... 240s Selecting previously unselected package ncbi-blast+-legacy. 240s Preparing to unpack .../6-ncbi-blast+-legacy_2.12.0+ds-4build1_all.deb ... 240s Unpacking ncbi-blast+-legacy (2.12.0+ds-4build1) ... 240s Selecting previously unselected package autopkgtest-satdep. 240s Preparing to unpack .../7-1-autopkgtest-satdep.deb ... 240s Unpacking autopkgtest-satdep (0) ... 240s Setting up ncbi-data (6.1.20170106+dfsg1-10) ... 240s Setting up libmbedcrypto7t64:s390x (2.28.7-1.1ubuntu1) ... 240s Setting up libgomp1:s390x (14-20240303-1ubuntu1) ... 240s Setting up libmbedx509-1t64:s390x (2.28.7-1.1ubuntu1) ... 240s Setting up libmbedtls14t64:s390x (2.28.7-1.1ubuntu1) ... 240s Setting up ncbi-blast+ (2.12.0+ds-4build1) ... 240s Setting up ncbi-blast+-legacy (2.12.0+ds-4build1) ... 240s Setting up autopkgtest-satdep (0) ... 240s Processing triggers for man-db (2.12.0-3) ... 240s Processing triggers for libc-bin (2.39-0ubuntu2) ... 243s (Reading database ... 52442 files and directories currently installed.) 243s Removing autopkgtest-satdep (0) ... 243s autopkgtest [22:23:56]: test run-unit-test: [----------------------- 243s ---Creating Database-- 243s 243s 243s Building a new DB, current time: 03/17/2024 22:23:56 243s New DB name: /tmp/autopkgtest.1eRZs5/autopkgtest_tmp/testdb 243s New DB title: testdatabase.fa 243s Sequence type: Nucleotide 243s Keep MBits: T 243s Maximum file size: 1000000000B 243s Adding sequences from FASTA; added 3 sequences in 0.0896051 seconds. 243s 243s 243s ---Searching Database for Hits--- 243s Warning: [blastn] Examining 5 or more matches is recommended 243s # BLASTN 2.12.0+ 243s # Query: gnl|MYDB|1 this is sequence 1 243s # Database: testdb 243s # Fields: query id, subject id, evalue, bit score 243s # 2 hits found 243s gnl|MYDB|1 Unknown 0.0 1299 243s gnl|MYDB|1 gnl1 0.0 1299 243s # BLAST processed 1 queries 243s ---Search and Fetch An Entry From Database--- 243s >gnl1 243s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 243s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 243s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 243s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 243s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 243s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 243s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 243s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 243s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 243s PASS 244s autopkgtest [22:23:57]: test run-unit-test: -----------------------] 244s autopkgtest [22:23:57]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 244s run-unit-test PASS 245s autopkgtest [22:23:58]: @@@@@@@@@@@@@@@@@@@@ summary 245s run-unit-test PASS 262s Creating nova instance adt-noble-s390x-ncbi-blast+-20240317-221953-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-s390x-server-20240316.img (UUID 7afe023c-7cb8-41b6-91a7-c69e7d1e7c0d)...