0s autopkgtest [09:27:20]: starting date and time: 2024-03-23 09:27:20+0000 0s autopkgtest [09:27:20]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [09:27:20]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.7veagsdx/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:samtools,src:curl,src:gnutls28,src:htslib,src:libpsl,src:nettle,src:openssl --apt-upgrade fastaq --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=samtools/1.19.2-1build1 curl/8.5.0-2ubuntu7 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-s390x-8.secgroup --name adt-noble-s390x-fastaq-20240323-092720-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-s390x-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 120s autopkgtest [09:29:20]: testbed dpkg architecture: s390x 120s autopkgtest [09:29:20]: testbed apt version: 2.7.12 120s autopkgtest [09:29:20]: @@@@@@@@@@@@@@@@@@@@ test bed setup 121s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 122s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3972 kB] 122s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 122s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [56.9 kB] 122s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [494 kB] 122s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main s390x Packages [651 kB] 122s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main s390x c-n-f Metadata [3032 B] 122s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x Packages [1372 B] 122s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted s390x c-n-f Metadata [116 B] 122s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x Packages [4148 kB] 122s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe s390x c-n-f Metadata [7292 B] 122s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x Packages [46.8 kB] 122s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse s390x c-n-f Metadata [116 B] 124s Fetched 9504 kB in 3s (3777 kB/s) 125s Reading package lists... 127s Reading package lists... 127s Building dependency tree... 127s Reading state information... 127s Calculating upgrade... 128s The following packages will be REMOVED: 128s libssl3 128s The following NEW packages will be installed: 128s libssl3t64 128s The following packages have been kept back: 128s curl 128s The following packages will be upgraded: 128s libbsd0 libc-bin libc6 locales openssl 128s 5 upgraded, 1 newly installed, 1 to remove and 1 not upgraded. 128s Need to get 10.5 MB of archives. 128s After this operation, 241 kB of additional disk space will be used. 128s Get:1 http://ftpmaster.internal/ubuntu noble/main s390x libc6 s390x 2.39-0ubuntu6 [2847 kB] 128s Get:2 http://ftpmaster.internal/ubuntu noble/main s390x libc-bin s390x 2.39-0ubuntu6 [654 kB] 129s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main s390x openssl s390x 3.0.13-0ubuntu2 [1010 kB] 129s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main s390x libssl3t64 s390x 3.0.13-0ubuntu2 [1675 kB] 129s Get:5 http://ftpmaster.internal/ubuntu noble/main s390x libbsd0 s390x 0.12.1-1 [46.7 kB] 129s Get:6 http://ftpmaster.internal/ubuntu noble/main s390x locales all 2.39-0ubuntu6 [4232 kB] 129s Preconfiguring packages ... 129s Fetched 10.5 MB in 2s (6893 kB/s) 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52170 files and directories currently installed.) 130s Preparing to unpack .../libc6_2.39-0ubuntu6_s390x.deb ... 130s Unpacking libc6:s390x (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 130s Setting up libc6:s390x (2.39-0ubuntu6) ... 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52170 files and directories currently installed.) 130s Preparing to unpack .../libc-bin_2.39-0ubuntu6_s390x.deb ... 130s Unpacking libc-bin (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 130s Setting up libc-bin (2.39-0ubuntu6) ... 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52170 files and directories currently installed.) 130s Preparing to unpack .../openssl_3.0.13-0ubuntu2_s390x.deb ... 130s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 130s dpkg: libssl3:s390x: dependency problems, but removing anyway as you requested: 130s wget depends on libssl3 (>= 3.0.0). 130s tnftp depends on libssl3 (>= 3.0.0). 130s tcpdump depends on libssl3 (>= 3.0.0). 130s systemd-resolved depends on libssl3 (>= 3.0.0). 130s systemd depends on libssl3 (>= 3.0.0). 130s sudo depends on libssl3 (>= 3.0.0). 130s s390-tools depends on libssl3 (>= 3.0.0). 130s rsync depends on libssl3 (>= 3.0.0). 130s python3-cryptography depends on libssl3 (>= 3.0.0). 130s openssh-server depends on libssl3 (>= 3.0.10). 130s openssh-client depends on libssl3 (>= 3.0.10). 130s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 130s libsystemd-shared:s390x depends on libssl3 (>= 3.0.0). 130s libssh-4:s390x depends on libssl3 (>= 3.0.0). 130s libsasl2-modules:s390x depends on libssl3 (>= 3.0.0). 130s libsasl2-2:s390x depends on libssl3 (>= 3.0.0). 130s libpython3.12-minimal:s390x depends on libssl3 (>= 3.0.0). 130s libpython3.11-minimal:s390x depends on libssl3 (>= 3.0.0). 130s libnvme1 depends on libssl3 (>= 3.0.0). 130s libkrb5-3:s390x depends on libssl3 (>= 3.0.0). 130s libkmod2:s390x depends on libssl3 (>= 3.0.0). 130s libfido2-1:s390x depends on libssl3 (>= 3.0.0). 130s libcurl4:s390x depends on libssl3 (>= 3.0.0). 130s libcryptsetup12:s390x depends on libssl3 (>= 3.0.0). 130s kmod depends on libssl3 (>= 3.0.0). 130s dhcpcd-base depends on libssl3 (>= 3.0.0). 130s bind9-libs:s390x depends on libssl3 (>= 3.0.0). 130s 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52170 files and directories currently installed.) 130s Removing libssl3:s390x (3.0.10-1ubuntu4) ... 130s Selecting previously unselected package libssl3t64:s390x. 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52159 files and directories currently installed.) 130s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_s390x.deb ... 130s Unpacking libssl3t64:s390x (3.0.13-0ubuntu2) ... 131s Preparing to unpack .../libbsd0_0.12.1-1_s390x.deb ... 131s Unpacking libbsd0:s390x (0.12.1-1) over (0.11.8-1) ... 131s Preparing to unpack .../locales_2.39-0ubuntu6_all.deb ... 131s Unpacking locales (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 131s Setting up libssl3t64:s390x (3.0.13-0ubuntu2) ... 131s Setting up locales (2.39-0ubuntu6) ... 131s Generating locales (this might take a while)... 133s en_US.UTF-8... done 133s Generation complete. 133s Setting up openssl (3.0.13-0ubuntu2) ... 133s Setting up libbsd0:s390x (0.12.1-1) ... 133s Processing triggers for man-db (2.12.0-3) ... 133s Processing triggers for libc-bin (2.39-0ubuntu6) ... 134s Reading package lists... 134s Building dependency tree... 134s Reading state information... 134s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 134s Unknown architecture, assuming PC-style ttyS0 134s sh: Attempting to set up Debian/Ubuntu apt sources automatically 134s sh: Distribution appears to be Ubuntu 135s Reading package lists... 135s Building dependency tree... 135s Reading state information... 136s eatmydata is already the newest version (131-1). 136s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 136s Reading package lists... 136s Building dependency tree... 136s Reading state information... 136s dbus is already the newest version (1.14.10-4ubuntu1). 136s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 136s Reading package lists... 136s Building dependency tree... 136s Reading state information... 136s rng-tools-debian is already the newest version (2.4). 136s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 136s Reading package lists... 136s Building dependency tree... 136s Reading state information... 137s The following packages will be REMOVED: 137s cloud-init* python3-configobj* python3-debconf* 137s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 137s After this operation, 3256 kB disk space will be freed. 137s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 52172 files and directories currently installed.) 137s Removing cloud-init (24.1.2-0ubuntu1) ... 137s Removing python3-configobj (5.0.8-3) ... 137s Removing python3-debconf (1.5.86) ... 137s Processing triggers for man-db (2.12.0-3) ... 138s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 51783 files and directories currently installed.) 138s Purging configuration files for cloud-init (24.1.2-0ubuntu1) ... 138s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 138s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 138s invoke-rc.d: policy-rc.d denied execution of try-restart. 139s Reading package lists... 139s Building dependency tree... 139s Reading state information... 139s linux-generic is already the newest version (6.8.0-11.11+1). 139s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 139s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 139s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 139s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 141s Reading package lists... 141s Reading package lists... 141s Building dependency tree... 141s Reading state information... 141s Calculating upgrade... 142s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 142s Reading package lists... 142s Building dependency tree... 142s Reading state information... 142s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 142s autopkgtest [09:29:42]: rebooting testbed after setup commands that affected boot 157s autopkgtest [09:29:57]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Tue Feb 13 23:45:46 UTC 2024 159s autopkgtest [09:29:59]: @@@@@@@@@@@@@@@@@@@@ apt-source fastaq 161s Get:1 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (dsc) [2135 B] 161s Get:2 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (tar) [71.3 kB] 161s Get:3 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (diff) [4884 B] 161s gpgv: Signature made Mon Dec 18 16:27:46 2023 UTC 161s gpgv: using RSA key 5B34BA5AAB5507E903426E85E8D37AE2F09F4872 161s gpgv: Can't check signature: No public key 161s dpkg-source: warning: cannot verify inline signature for ./fastaq_3.17.0-6.dsc: no acceptable signature found 161s autopkgtest [09:30:01]: testing package fastaq version 3.17.0-6 161s autopkgtest [09:30:01]: build not needed 162s autopkgtest [09:30:02]: test run: preparing testbed 164s Reading package lists... 164s Building dependency tree... 164s Reading state information... 164s Starting pkgProblemResolver with broken count: 0 164s Starting 2 pkgProblemResolver with broken count: 0 164s Done 164s The following additional packages will be installed: 164s fastaq libdeflate0 libhts3 libhtscodecs2 samtools 164s Suggested packages: 164s cwltool 164s The following NEW packages will be installed: 164s autopkgtest-satdep fastaq libdeflate0 libhts3 libhtscodecs2 samtools 164s 0 upgraded, 6 newly installed, 0 to remove and 0 not upgraded. 164s Need to get 1257 kB/1258 kB of archives. 164s After this operation, 2992 kB of additional disk space will be used. 164s Get:1 /tmp/autopkgtest.xiQeof/1-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [724 B] 164s Get:2 http://ftpmaster.internal/ubuntu noble/main s390x libdeflate0 s390x 1.19-1 [46.0 kB] 165s Get:3 http://ftpmaster.internal/ubuntu noble/universe s390x libhtscodecs2 s390x 1.6.0-1 [87.2 kB] 165s Get:4 http://ftpmaster.internal/ubuntu noble/universe s390x libhts3 s390x 1.18+ds-1 [463 kB] 165s Get:5 http://ftpmaster.internal/ubuntu noble/universe s390x samtools s390x 1.19.2-1 [613 kB] 165s Get:6 http://ftpmaster.internal/ubuntu noble/universe s390x fastaq all 3.17.0-6 [47.9 kB] 165s Fetched 1257 kB in 1s (2070 kB/s) 165s Selecting previously unselected package libdeflate0:s390x. 165s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 51728 files and directories currently installed.) 165s Preparing to unpack .../0-libdeflate0_1.19-1_s390x.deb ... 165s Unpacking libdeflate0:s390x (1.19-1) ... 165s Selecting previously unselected package libhtscodecs2:s390x. 165s Preparing to unpack .../1-libhtscodecs2_1.6.0-1_s390x.deb ... 165s Unpacking libhtscodecs2:s390x (1.6.0-1) ... 165s Selecting previously unselected package libhts3:s390x. 165s Preparing to unpack .../2-libhts3_1.18+ds-1_s390x.deb ... 165s Unpacking libhts3:s390x (1.18+ds-1) ... 165s Selecting previously unselected package samtools. 165s Preparing to unpack .../3-samtools_1.19.2-1_s390x.deb ... 165s Unpacking samtools (1.19.2-1) ... 165s Selecting previously unselected package fastaq. 165s Preparing to unpack .../4-fastaq_3.17.0-6_all.deb ... 165s Unpacking fastaq (3.17.0-6) ... 165s Selecting previously unselected package autopkgtest-satdep. 165s Preparing to unpack .../5-1-autopkgtest-satdep.deb ... 165s Unpacking autopkgtest-satdep (0) ... 165s Setting up libhtscodecs2:s390x (1.6.0-1) ... 165s Setting up libdeflate0:s390x (1.19-1) ... 165s Setting up libhts3:s390x (1.18+ds-1) ... 165s Setting up samtools (1.19.2-1) ... 165s Setting up fastaq (3.17.0-6) ... 165s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:37: SyntaxWarning: invalid escape sequence '\s' 165s phylip_regex = re.compile('^\s*[0-9]+\s+[0-9]+$') 165s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:38: SyntaxWarning: invalid escape sequence '\s' 165s gbk_regex = re.compile('^LOCUS\s+\S') 166s Setting up autopkgtest-satdep (0) ... 166s Processing triggers for man-db (2.12.0-3) ... 166s Processing triggers for libc-bin (2.39-0ubuntu6) ... 168s (Reading database ... 51934 files and directories currently installed.) 168s Removing autopkgtest-satdep (0) ... 168s autopkgtest [09:30:08]: test run: [----------------------- 169s >test 169s TCGTAGCCGGCTCGCATCGACTG 169s autopkgtest [09:30:09]: test run: -----------------------] 170s autopkgtest [09:30:09]: test run: - - - - - - - - - - results - - - - - - - - - - 170s run PASS 170s autopkgtest [09:30:10]: test python-test: preparing testbed 175s Reading package lists... 175s Building dependency tree... 175s Reading state information... 175s Starting pkgProblemResolver with broken count: 0 175s Starting 2 pkgProblemResolver with broken count: 0 175s Done 176s The following NEW packages will be installed: 176s autopkgtest-satdep 176s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 176s Need to get 0 B/720 B of archives. 176s After this operation, 0 B of additional disk space will be used. 176s Get:1 /tmp/autopkgtest.xiQeof/2-autopkgtest-satdep.deb autopkgtest-satdep s390x 0 [720 B] 176s Selecting previously unselected package autopkgtest-satdep. 176s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 51934 files and directories currently installed.) 176s Preparing to unpack .../2-autopkgtest-satdep.deb ... 176s Unpacking autopkgtest-satdep (0) ... 176s Setting up autopkgtest-satdep (0) ... 177s (Reading database ... 51934 files and directories currently installed.) 177s Removing autopkgtest-satdep (0) ... 178s autopkgtest [09:30:18]: test python-test: [----------------------- 179s autopkgtest [09:30:19]: test python-test: -----------------------] 179s autopkgtest [09:30:19]: test python-test: - - - - - - - - - - results - - - - - - - - - - 179s python-test PASS 179s autopkgtest [09:30:19]: @@@@@@@@@@@@@@@@@@@@ summary 179s run PASS 179s python-test PASS 191s Creating nova instance adt-noble-s390x-fastaq-20240323-092720-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-s390x-server-20240322.img (UUID c8671f9a-0e89-48e3-af4f-3c79b89294e8)...