0s autopkgtest [02:50:05]: starting date and time: 2024-03-19 02:50:05+0000 0s autopkgtest [02:50:05]: git checkout: b506e79c ssh-setup/nova: fix ARCH having two lines of data 0s autopkgtest [02:50:05]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.t5031aav/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.0.13-0ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-ppc64el-7.secgroup --name adt-noble-ppc64el-seqkit-20240319-025005-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 216s autopkgtest [02:53:41]: testbed dpkg architecture: ppc64el 216s autopkgtest [02:53:41]: testbed apt version: 2.7.12 216s autopkgtest [02:53:41]: @@@@@@@@@@@@@@@@@@@@ test bed setup 217s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 218s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3753 kB] 218s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 218s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [52.0 kB] 218s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [486 kB] 218s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [646 kB] 218s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 218s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 218s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 218s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [4025 kB] 219s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 219s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [47.3 kB] 219s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 222s Fetched 9146 kB in 3s (3468 kB/s) 222s Reading package lists... 226s Reading package lists... 226s Building dependency tree... 226s Reading state information... 226s Calculating upgrade... 226s The following packages will be REMOVED: 226s libssl3 226s The following NEW packages will be installed: 226s libssl3t64 226s The following packages will be upgraded: 226s openssl 226s 1 upgraded, 1 newly installed, 1 to remove and 0 not upgraded. 226s Need to get 3151 kB of archives. 226s After this operation, 73.7 kB of additional disk space will be used. 226s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssl ppc64el 3.0.13-0ubuntu2 [1026 kB] 227s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libssl3t64 ppc64el 3.0.13-0ubuntu2 [2125 kB] 227s Fetched 3151 kB in 1s (2990 kB/s) 228s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70095 files and directories currently installed.) 228s Preparing to unpack .../openssl_3.0.13-0ubuntu2_ppc64el.deb ... 228s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 228s dpkg: libssl3:ppc64el: dependency problems, but removing anyway as you requested: 228s wget depends on libssl3 (>= 3.0.0). 228s tnftp depends on libssl3 (>= 3.0.0). 228s tcpdump depends on libssl3 (>= 3.0.0). 228s systemd-resolved depends on libssl3 (>= 3.0.0). 228s systemd depends on libssl3 (>= 3.0.0). 228s sudo depends on libssl3 (>= 3.0.0). 228s rsync depends on libssl3 (>= 3.0.0). 228s python3-cryptography depends on libssl3 (>= 3.0.0). 228s openssh-server depends on libssl3 (>= 3.0.10). 228s openssh-client depends on libssl3 (>= 3.0.10). 228s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 228s libsystemd-shared:ppc64el depends on libssl3 (>= 3.0.0). 228s libssh-4:ppc64el depends on libssl3 (>= 3.0.0). 228s libsasl2-modules:ppc64el depends on libssl3 (>= 3.0.0). 228s libsasl2-2:ppc64el depends on libssl3 (>= 3.0.0). 228s libpython3.12-minimal:ppc64el depends on libssl3 (>= 3.0.0). 228s libpython3.11-minimal:ppc64el depends on libssl3 (>= 3.0.0). 228s libnvme1 depends on libssl3 (>= 3.0.0). 228s libkrb5-3:ppc64el depends on libssl3 (>= 3.0.0). 228s libkmod2:ppc64el depends on libssl3 (>= 3.0.0). 228s libfido2-1:ppc64el depends on libssl3 (>= 3.0.0). 228s libcurl4:ppc64el depends on libssl3 (>= 3.0.0). 228s libcryptsetup12:ppc64el depends on libssl3 (>= 3.0.0). 228s kmod depends on libssl3 (>= 3.0.0). 228s dhcpcd-base depends on libssl3 (>= 3.0.0). 228s bind9-libs:ppc64el depends on libssl3 (>= 3.0.0). 228s 228s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70095 files and directories currently installed.) 228s Removing libssl3:ppc64el (3.0.10-1ubuntu4) ... 228s Selecting previously unselected package libssl3t64:ppc64el. 228s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70084 files and directories currently installed.) 228s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_ppc64el.deb ... 228s Unpacking libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 228s Setting up libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 228s Setting up openssl (3.0.13-0ubuntu2) ... 228s Processing triggers for man-db (2.12.0-3) ... 229s Processing triggers for libc-bin (2.39-0ubuntu2) ... 229s Reading package lists... 229s Building dependency tree... 229s Reading state information... 229s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 230s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 230s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 230s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 230s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 231s Reading package lists... 231s Reading package lists... 232s Building dependency tree... 232s Reading state information... 232s Calculating upgrade... 232s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 232s Reading package lists... 232s Building dependency tree... 232s Reading state information... 233s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 236s autopkgtest [02:54:01]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 236s autopkgtest [02:54:01]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 246s Get:1 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (dsc) [2502 B] 246s Get:2 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (tar) [16.4 MB] 246s Get:3 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (diff) [10.8 MB] 246s gpgv: Signature made Mon Dec 25 17:00:09 2023 UTC 246s gpgv: using EDDSA key A095B66EE09024BEE6A2F0722A27904BD7243EDA 246s gpgv: Can't check signature: No public key 246s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.3.1+ds-2.dsc: no acceptable signature found 249s autopkgtest [02:54:14]: testing package seqkit version 2.3.1+ds-2 254s autopkgtest [02:54:19]: build not needed 262s autopkgtest [02:54:27]: test run-unit-test: preparing testbed 263s Reading package lists... 264s Building dependency tree... 264s Reading state information... 264s Starting pkgProblemResolver with broken count: 0 264s Starting 2 pkgProblemResolver with broken count: 0 264s Done 264s The following additional packages will be installed: 264s seqkit seqkit-examples ssshtest 264s The following NEW packages will be installed: 264s autopkgtest-satdep seqkit seqkit-examples ssshtest 264s 0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded. 264s Need to get 47.3 MB/47.3 MB of archives. 264s After this operation, 56.2 MB of additional disk space will be used. 264s Get:1 /tmp/autopkgtest.2Bfag0/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [724 B] 264s Get:2 http://ftpmaster.internal/ubuntu noble/universe ppc64el seqkit ppc64el 2.3.1+ds-2 [7586 kB] 267s Get:3 http://ftpmaster.internal/ubuntu noble/universe ppc64el seqkit-examples all 2.3.1+ds-2 [39.7 MB] 277s Get:4 http://ftpmaster.internal/ubuntu noble/universe ppc64el ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 278s Fetched 47.3 MB in 13s (3593 kB/s) 278s Selecting previously unselected package seqkit. 278s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70097 files and directories currently installed.) 278s Preparing to unpack .../seqkit_2.3.1+ds-2_ppc64el.deb ... 278s Unpacking seqkit (2.3.1+ds-2) ... 278s Selecting previously unselected package seqkit-examples. 278s Preparing to unpack .../seqkit-examples_2.3.1+ds-2_all.deb ... 278s Unpacking seqkit-examples (2.3.1+ds-2) ... 278s Selecting previously unselected package ssshtest. 278s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 278s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 278s Selecting previously unselected package autopkgtest-satdep. 278s Preparing to unpack .../1-autopkgtest-satdep.deb ... 278s Unpacking autopkgtest-satdep (0) ... 278s Setting up seqkit (2.3.1+ds-2) ... 278s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 278s Setting up seqkit-examples (2.3.1+ds-2) ... 278s Setting up autopkgtest-satdep (0) ... 278s Processing triggers for man-db (2.12.0-3) ... 281s (Reading database ... 70181 files and directories currently installed.) 281s Removing autopkgtest-satdep (0) ... 281s autopkgtest [02:54:46]: test run-unit-test: [----------------------- 282s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 283s 283s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 283s PASS "28645" == "28645" (LINE 28) 283s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 283s 283s seq_type ran in 0 sec with 2/0 lines to STDERR/OUT 283s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 283s 283s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 283s PASS STDOUT CONTAINS "Protein" (LINE 42) 283s 283s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 283s PASS STDOUT CONTAINS "RNA" (LINE 48) 283s 283s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 283s PASS STDOUT CONTAINS "DNA" (LINE 54) 283s 283s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 283s PASS STDOUT CONTAINS "DNA" (LINE 60) 283s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 283s 283s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 283s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 283s 283s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 283s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 283s 283s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 283s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 284s 284s seq_revcom ran in 1 sec with 1/3 lines to STDERR/OUT 284s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 284s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 284s 284s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT 284s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 284s 284s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 284s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 284s 284s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 284s PASS "a" == "a" (LINE 117) 284s 284s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 284s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 284s 284s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 284s PASS "gtn" == "gtn" (LINE 129) 284s 284s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 284s PASS "ACG" == "ACG" (LINE 135) 284s 284s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 284s PASS "N" == "N" (LINE 141) 284s 284s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 284s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 284s 284s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 284s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 284s 284s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 284s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 284s 284s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 284s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 284s 284s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 284s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 284s 284s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT 285s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 285s 285s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 285s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 285s [ERRO] xopen: no content 285s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 285s 285s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT 285s Length correlation: 285s PASS "1" == "1" (LINE 220) 285s Length correlation: 285s PASS "1" == "1" (LINE 224) 285s Qual correlation: 285s PASS "1" == "1" (LINE 228) 285s 285s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 285s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 285s 285s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 285s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 286s 286s grep_by_list_head100 ran in 1 sec with 1/299 lines to STDERR/OUT 286s PASS "100" == "100" (LINE 249) 286s 286s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 286s PASS "3074" == "3074" (LINE 254) 286s 286s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT 286s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 286s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 286s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 286s 286s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 286s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 286s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 286s [INFO] 0 duplicated records removed 286s [INFO] sample by proportion 286s [INFO] 2814 sequences outputted 286s 286s common ran in 0 sec with 5/0 lines to STDERR/OUT 286s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 299) 286s 286s split ran in 0 sec with 104/0 lines to STDERR/OUT 286s [INFO] 0 duplicated records removed 286s PASS "100" == "100" (LINE 316) 286s [INFO] 0 duplicated records removed 286s PASS "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" == "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" (LINE 317) 287s [INFO] sample by proportion 287s [INFO] 2814 sequences outputted 287s [INFO] sample by proportion 287s [INFO] 2814 sequences outputted 287s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 324) 287s 287s head ran in 0 sec with 0/30 lines to STDERR/OUT 287s PASS "10" == "10" (LINE 332) 287s PASS "snq" == "snq" (LINE 341) 287s PASS "seq_2" == "seq_2" (LINE 350) 287s 287s restart ran in 0 sec with 0/2 lines to STDERR/OUT 287s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 287s 287s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 287s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 288s 288s shuffle ran in 1 sec with 20/0 lines to STDERR/OUT 288s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 389) 288s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 288s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 393) 288s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 394) 288s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 395) 288s 288s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 288s Correlation: 288s PASS "1" == "1" (LINE 422) 289s 289s bam_mean_qual ran in 1 sec with 0/0 lines to STDERR/OUT 289s Correlation: 289s PASS "1" == "1" (LINE 432) 289s 289s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 289s Correlation: 289s PASS "1" == "1" (LINE 442) 289s 289s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 289s Correlation: 289s PASS "1" == "1" (LINE 452) 289s 289s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT 289s Correlation: 289s PASS "1" == "1" (LINE 462) 290s 290s bam_left_clip ran in 1 sec with 0/0 lines to STDERR/OUT 290s Correlation: 290s PASS "1" == "1" (LINE 475) 290s 290s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 290s Correlation: 290s PASS "1" == "1" (LINE 488) 291s 291s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 291s PASS "0" == "0" (LINE 498) 291s 291s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT 291s PASS EXIT CODE (LINE 516) 291s 291s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 291s PASS "0" == "0" (LINE 530) 291s 291s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 291s PASS "0" == "0" (LINE 541) 291s 291s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 291s PASS "0" == "0" (LINE 549) 291s 291s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 291s PASS "0" == "0" (LINE 557) 294s 294s scat_fasta ran in 3 sec with 261/0 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 606) 294s PASS "0" == "0" (LINE 608) 296s 296s scat_fastq ran in 2 sec with 531/0 lines to STDERR/OUT 296s PASS "0" == "0" (LINE 652) 296s PASS "0" == "0" (LINE 654) 296s [INFO] sample by number 296s [INFO] loading all sequences into memory... 296s [INFO] 9 sequences outputted 296s 296s faidx_id ran in 0 sec with 0/0 lines to STDERR/OUT 297s [INFO] 9 patterns loaded from file 297s [INFO] read sequences ... 297s [INFO] 9 sequences loaded 297s [INFO] sorting ... 297s [INFO] output ... 297s [INFO] read sequences ... 297s [INFO] 9 sequences loaded 297s [INFO] sorting ... 297s [INFO] output ... 297s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 670) 297s 297s faidx_full_head ran in 0 sec with 0/0 lines to STDERR/OUT 297s [INFO] 9 patterns loaded from file 297s [INFO] read sequences ... 297s [INFO] 9 sequences loaded 297s [INFO] sorting ... 297s [INFO] output ... 297s [INFO] read sequences ... 297s [INFO] 9 sequences loaded 297s [INFO] sorting ... 297s [INFO] output ... 297s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 677) 297s 297s faidx_region ran in 0 sec with 0/0 lines to STDERR/OUT 297s PASS "AGGUGGUAGAAUGUUCUCUGAAAGCACGCCUUGUAAGACGCACUUUCAGCCUAUACGACAUCCAAGUCAACUUAAAAUGCGUCCUACAGGGCGUACUUUCAGAGAACAUUUUGCCACCU" == "AGGUGGUAGAAUGUUCUCUGAAAGCACGCCUUGUAAGACGCACUUUCAGCCUAUACGACAUCCAAGUCAACUUAAAAUGCGUCCUACAGGGCGUACUUUCAGAGAACAUUUUGCCACCU" (LINE 686) 297s 297s sshtest v0.1.5 297s 297s 71 Tests 297s 0 Failures 297s 71 Successes 297s autopkgtest [02:55:02]: test run-unit-test: -----------------------] 298s run-unit-test PASS 298s autopkgtest [02:55:03]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 298s autopkgtest [02:55:03]: @@@@@@@@@@@@@@@@@@@@ summary 298s run-unit-test PASS 347s Creating nova instance adt-noble-ppc64el-seqkit-20240319-025005-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-ppc64el-server-20240319.img (UUID 6e7a6c13-d651-45a1-a24f-48d9d59effd9)...