0s autopkgtest [18:22:17]: starting date and time: 2024-03-18 18:22:17+0000 0s autopkgtest [18:22:17]: git checkout: b506e79c ssh-setup/nova: fix ARCH having two lines of data 0s autopkgtest [18:22:17]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.60bya1ee/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:ncbi-blast+,src:mbedtls --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ncbi-blast+/2.12.0+ds-4build1 mbedtls/2.28.7-1.1ubuntu1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos01-ppc64el-9.secgroup --name adt-noble-ppc64el-ncbi-blast+-20240318-182217-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://us.ports.ubuntu.com/ubuntu-ports/ 210s autopkgtest [18:25:47]: testbed dpkg architecture: ppc64el 210s autopkgtest [18:25:47]: testbed apt version: 2.7.12 210s autopkgtest [18:25:47]: @@@@@@@@@@@@@@@@@@@@ test bed setup 211s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 212s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 212s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [52.0 kB] 212s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [485 kB] 212s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3720 kB] 213s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [643 kB] 213s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 213s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 213s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 213s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [4012 kB] 213s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 213s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [48.4 kB] 213s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 216s Fetched 9098 kB in 3s (3400 kB/s) 216s Reading package lists... 219s Reading package lists... 220s Building dependency tree... 220s Reading state information... 220s Calculating upgrade... 220s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 220s Reading package lists... 221s Building dependency tree... 221s Reading state information... 221s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 221s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 222s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 222s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 222s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 223s Reading package lists... 223s Reading package lists... 224s Building dependency tree... 224s Reading state information... 224s Calculating upgrade... 224s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 224s Reading package lists... 225s Building dependency tree... 225s Reading state information... 225s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 227s autopkgtest [18:26:04]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 228s autopkgtest [18:26:05]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 233s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (dsc) [2451 B] 233s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (tar) [47.5 MB] 233s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ncbi-blast+ 2.12.0+ds-4build1 (diff) [33.6 kB] 233s gpgv: Signature made Sun Mar 17 18:10:08 2024 UTC 233s gpgv: using RSA key AC483F68DE728F43F2202FCA568D30F321B2133D 233s gpgv: issuer "steve.langasek@ubuntu.com" 233s gpgv: Can't check signature: No public key 233s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.12.0+ds-4build1.dsc: no acceptable signature found 238s autopkgtest [18:26:15]: testing package ncbi-blast+ version 2.12.0+ds-4build1 239s autopkgtest [18:26:16]: build not needed 674s autopkgtest [18:33:31]: test run-unit-test: preparing testbed 675s Reading package lists... 676s Building dependency tree... 676s Reading state information... 676s Starting pkgProblemResolver with broken count: 0 676s Starting 2 pkgProblemResolver with broken count: 0 676s Done 676s The following additional packages will be installed: 676s libgomp1 libmbedcrypto7t64 libmbedtls14t64 libmbedx509-1t64 ncbi-blast+ 676s ncbi-blast+-legacy ncbi-data 676s The following NEW packages will be installed: 676s autopkgtest-satdep libgomp1 libmbedcrypto7t64 libmbedtls14t64 676s libmbedx509-1t64 ncbi-blast+ ncbi-blast+-legacy ncbi-data 676s 0 upgraded, 8 newly installed, 0 to remove and 0 not upgraded. 676s Need to get 18.5 MB/18.5 MB of archives. 676s After this operation, 86.3 MB of additional disk space will be used. 676s Get:1 /tmp/autopkgtest.k3032U/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [724 B] 676s Get:2 http://ftpmaster.internal/ubuntu noble/main ppc64el libgomp1 ppc64el 14-20240303-1ubuntu1 [161 kB] 677s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el libmbedcrypto7t64 ppc64el 2.28.7-1.1ubuntu1 [264 kB] 677s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el libmbedx509-1t64 ppc64el 2.28.7-1.1ubuntu1 [51.8 kB] 677s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el libmbedtls14t64 ppc64el 2.28.7-1.1ubuntu1 [90.5 kB] 677s Get:6 http://ftpmaster.internal/ubuntu noble/universe ppc64el ncbi-data all 6.1.20170106+dfsg1-10 [4395 kB] 677s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el ncbi-blast+ ppc64el 2.12.0+ds-4build1 [13.6 MB] 677s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el ncbi-blast+-legacy all 2.12.0+ds-4build1 [4990 B] 678s Fetched 18.5 MB in 1s (15.0 MB/s) 678s Selecting previously unselected package libgomp1:ppc64el. 678s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70095 files and directories currently installed.) 678s Preparing to unpack .../0-libgomp1_14-20240303-1ubuntu1_ppc64el.deb ... 678s Unpacking libgomp1:ppc64el (14-20240303-1ubuntu1) ... 678s Selecting previously unselected package libmbedcrypto7t64:ppc64el. 678s Preparing to unpack .../1-libmbedcrypto7t64_2.28.7-1.1ubuntu1_ppc64el.deb ... 678s Unpacking libmbedcrypto7t64:ppc64el (2.28.7-1.1ubuntu1) ... 678s Selecting previously unselected package libmbedx509-1t64:ppc64el. 678s Preparing to unpack .../2-libmbedx509-1t64_2.28.7-1.1ubuntu1_ppc64el.deb ... 678s Unpacking libmbedx509-1t64:ppc64el (2.28.7-1.1ubuntu1) ... 678s Selecting previously unselected package libmbedtls14t64:ppc64el. 678s Preparing to unpack .../3-libmbedtls14t64_2.28.7-1.1ubuntu1_ppc64el.deb ... 678s Unpacking libmbedtls14t64:ppc64el (2.28.7-1.1ubuntu1) ... 678s Selecting previously unselected package ncbi-data. 678s Preparing to unpack .../4-ncbi-data_6.1.20170106+dfsg1-10_all.deb ... 678s Unpacking ncbi-data (6.1.20170106+dfsg1-10) ... 678s Selecting previously unselected package ncbi-blast+. 678s Preparing to unpack .../5-ncbi-blast+_2.12.0+ds-4build1_ppc64el.deb ... 678s Unpacking ncbi-blast+ (2.12.0+ds-4build1) ... 678s Selecting previously unselected package ncbi-blast+-legacy. 678s Preparing to unpack .../6-ncbi-blast+-legacy_2.12.0+ds-4build1_all.deb ... 678s Unpacking ncbi-blast+-legacy (2.12.0+ds-4build1) ... 679s Selecting previously unselected package autopkgtest-satdep. 679s Preparing to unpack .../7-1-autopkgtest-satdep.deb ... 679s Unpacking autopkgtest-satdep (0) ... 679s Setting up ncbi-data (6.1.20170106+dfsg1-10) ... 679s Setting up libmbedcrypto7t64:ppc64el (2.28.7-1.1ubuntu1) ... 679s Setting up libgomp1:ppc64el (14-20240303-1ubuntu1) ... 679s Setting up libmbedx509-1t64:ppc64el (2.28.7-1.1ubuntu1) ... 679s Setting up libmbedtls14t64:ppc64el (2.28.7-1.1ubuntu1) ... 679s Setting up ncbi-blast+ (2.12.0+ds-4build1) ... 679s Setting up ncbi-blast+-legacy (2.12.0+ds-4build1) ... 679s Setting up autopkgtest-satdep (0) ... 679s Processing triggers for man-db (2.12.0-3) ... 679s Processing triggers for libc-bin (2.39-0ubuntu2) ... 681s (Reading database ... 70366 files and directories currently installed.) 681s Removing autopkgtest-satdep (0) ... 682s autopkgtest [18:33:39]: test run-unit-test: [----------------------- 682s ---Creating Database-- 682s 682s 682s Building a new DB, current time: 03/18/2024 18:33:39 682s New DB name: /tmp/autopkgtest.k3032U/autopkgtest_tmp/testdb 682s New DB title: testdatabase.fa 682s Sequence type: Nucleotide 682s Keep MBits: T 682s Maximum file size: 1000000000B 682s Adding sequences from FASTA; added 3 sequences in 0.0858212 seconds. 682s 682s 682s ---Searching Database for Hits--- 682s Warning: [blastn] Examining 5 or more matches is recommended 682s # BLASTN 2.12.0+ 682s # Query: gnl|MYDB|1 this is sequence 1 682s # Database: testdb 682s # Fields: query id, subject id, evalue, bit score 682s # 2 hits found 682s gnl|MYDB|1 gnl2 0.0 1299 682s gnl|MYDB|1 gnl1 0.0 1299 682s # BLAST processed 1 queries 682s ---Search and Fetch An Entry From Database--- 682s >gnl1 682s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 682s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 682s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 682s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 682s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 682s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 682s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 682s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 682s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 682s PASS 683s autopkgtest [18:33:40]: test run-unit-test: -----------------------] 683s run-unit-test PASS 683s autopkgtest [18:33:40]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 683s autopkgtest [18:33:40]: @@@@@@@@@@@@@@@@@@@@ summary 683s run-unit-test PASS 699s Creating nova instance adt-noble-ppc64el-ncbi-blast+-20240318-182217-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-ppc64el-server-20240316.img (UUID 1492b190-05c5-462d-b1de-84bc330afe32)...