0s autopkgtest [11:42:40]: starting date: 2024-03-13 0s autopkgtest [11:42:40]: git checkout: d9c0295 adt_testbed.py: supress warnings from apt using a shell pipeline 0s autopkgtest [11:42:40]: host juju-7f2275-prod-proposed-migration-environment-3; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.0bf6sqku/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:perl,src:db5.3,src:gdbm,src:mmdebstrap --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=perl/5.38.2-3.2 db5.3/5.3.28+dfsg2-5 gdbm/1.23-5.1 mmdebstrap/1.4.3-6' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-3@bos01-ppc64el-5.secgroup --name adt-noble-ppc64el-ncbi-blast+-20240313-114239-juju-7f2275-prod-proposed-migration-environment-3 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-3 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://us.ports.ubuntu.com/ubuntu-ports/ 107s autopkgtest [11:44:27]: @@@@@@@@@@@@@@@@@@@@ test bed setup 107s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 108s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [40.4 kB] 108s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [448 kB] 108s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [4812 B] 108s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [2792 kB] 108s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [594 kB] 108s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 108s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 108s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 108s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [3110 kB] 108s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 108s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [39.1 kB] 108s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 111s Fetched 7158 kB in 2s (3526 kB/s) 111s Reading package lists... 116s Reading package lists... 117s Building dependency tree... 117s Reading state information... 117s Calculating upgrade... 117s The following packages were automatically installed and are no longer required: 117s libgdbm-compat4t64 libperl5.38 lto-disabled-list make perl-modules-5.38 117s Use 'sudo apt autoremove' to remove them. 117s The following packages will be REMOVED: 117s dpkg-dev libdpkg-perl libgdbm-compat4 libgdbm6 perl 117s The following NEW packages will be installed: 117s libgdbm-compat4t64 libgdbm6t64 117s The following packages have been kept back: 117s libperl5.38 117s The following packages will be upgraded: 117s cloud-init gdisk perl-base perl-modules-5.38 117s 4 upgraded, 2 newly installed, 5 to remove and 1 not upgraded. 117s Need to get 5932 kB of archives. 117s After this operation, 4151 kB disk space will be freed. 117s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-base ppc64el 5.38.2-3.2 [1916 kB] 118s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm6t64 ppc64el 1.23-5.1 [41.9 kB] 118s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm-compat4t64 ppc64el 1.23-5.1 [6972 B] 118s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 118s Get:5 http://ftpmaster.internal/ubuntu noble/main ppc64el cloud-init all 24.1.1-0ubuntu1 [597 kB] 118s Get:6 http://ftpmaster.internal/ubuntu noble/main ppc64el gdisk ppc64el 1.0.10-1 [260 kB] 118s Preconfiguring packages ... 119s Fetched 5932 kB in 1s (5230 kB/s) 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70112 files and directories currently installed.) 119s Removing dpkg-dev (1.22.4ubuntu5) ... 119s Removing libdpkg-perl (1.22.4ubuntu5) ... 119s Removing perl (5.38.2-3) ... 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69531 files and directories currently installed.) 119s Preparing to unpack .../perl-base_5.38.2-3.2_ppc64el.deb ... 119s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 119s Setting up perl-base (5.38.2-3.2) ... 119s dpkg: libgdbm6:ppc64el: dependency problems, but removing anyway as you requested: 119s python3-gdbm:ppc64el depends on libgdbm6 (>= 1.16). 119s man-db depends on libgdbm6 (>= 1.16). 119s libperl5.38:ppc64el depends on libgdbm6 (>= 1.21). 119s libgdbm-compat4:ppc64el depends on libgdbm6 (>= 1.16). 119s 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69531 files and directories currently installed.) 119s Removing libgdbm6:ppc64el (1.23-5) ... 119s Selecting previously unselected package libgdbm6t64:ppc64el. 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69526 files and directories currently installed.) 119s Preparing to unpack .../libgdbm6t64_1.23-5.1_ppc64el.deb ... 119s Unpacking libgdbm6t64:ppc64el (1.23-5.1) ... 119s dpkg: libgdbm-compat4:ppc64el: dependency problems, but removing anyway as you requested: 119s libperl5.38:ppc64el depends on libgdbm-compat4 (>= 1.18-3). 119s 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69532 files and directories currently installed.) 119s Removing libgdbm-compat4:ppc64el (1.23-5) ... 119s Selecting previously unselected package libgdbm-compat4t64:ppc64el. 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69527 files and directories currently installed.) 119s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_ppc64el.deb ... 119s Unpacking libgdbm-compat4t64:ppc64el (1.23-5.1) ... 119s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ... 119s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 120s Preparing to unpack .../cloud-init_24.1.1-0ubuntu1_all.deb ... 120s Unpacking cloud-init (24.1.1-0ubuntu1) over (24.1-0ubuntu1) ... 120s Preparing to unpack .../gdisk_1.0.10-1_ppc64el.deb ... 120s Unpacking gdisk (1.0.10-1) over (1.0.9-2.1) ... 120s Setting up cloud-init (24.1.1-0ubuntu1) ... 122s Setting up libgdbm6t64:ppc64el (1.23-5.1) ... 122s Setting up libgdbm-compat4t64:ppc64el (1.23-5.1) ... 122s Setting up gdisk (1.0.10-1) ... 122s Setting up perl-modules-5.38 (5.38.2-3.2) ... 122s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 122s Processing triggers for man-db (2.12.0-3) ... 124s Processing triggers for libc-bin (2.39-0ubuntu2) ... 124s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 124s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 124s Reading package lists... 124s Building dependency tree... 124s Reading state information... 124s The following packages will be REMOVED: 124s libgdbm-compat4t64* libperl5.38* lto-disabled-list* make* perl-modules-5.38* 124s 0 upgraded, 0 newly installed, 5 to remove and 0 not upgraded. 124s After this operation, 53.0 MB disk space will be freed. 125s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69533 files and directories currently installed.) 125s Removing libperl5.38:ppc64el (5.38.2-3) ... 125s Removing libgdbm-compat4t64:ppc64el (1.23-5.1) ... 125s Removing lto-disabled-list (47) ... 125s Removing make (4.3-4.1build1) ... 125s Removing perl-modules-5.38 (5.38.2-3.2) ... 125s Processing triggers for man-db (2.12.0-3) ... 125s Processing triggers for libc-bin (2.39-0ubuntu2) ... 126s sh: Attempting to set up Debian/Ubuntu apt sources automatically 126s sh: Distribution appears to be Ubuntu 130s Reading package lists... 130s Building dependency tree... 130s Reading state information... 130s eatmydata is already the newest version (131-1). 130s dbus is already the newest version (1.14.10-4ubuntu1). 130s dbus set to manually installed. 130s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s Reading package lists... 130s Building dependency tree... 130s Reading state information... 131s rng-tools-debian is already the newest version (2.4). 131s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 131s Reading package lists... 131s Building dependency tree... 131s Reading state information... 131s haveged is already the newest version (1.9.14-1ubuntu1). 131s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 131s Reading package lists... 132s Building dependency tree... 132s Reading state information... 132s The following additional packages will be installed: 132s libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 lto-disabled-list 132s make perl perl-modules-5.38 132s Suggested packages: 132s debian-keyring gcc | c-compiler git bzr make-doc perl-doc 132s libterm-readline-gnu-perl | libterm-readline-perl-perl 132s libtap-harness-archive-perl 132s Recommended packages: 132s build-essential gcc | c-compiler fakeroot libalgorithm-merge-perl 132s libfile-fcntllock-perl 132s The following packages will be REMOVED: 132s libdb5.3 132s The following NEW packages will be installed: 132s dpkg-dev libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 132s lto-disabled-list make perl perl-modules-5.38 132s 0 upgraded, 9 newly installed, 1 to remove and 0 not upgraded. 132s Need to get 7626 kB/10.7 MB of archives. 132s After this operation, 57.2 MB of additional disk space will be used. 132s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdb5.3t64 ppc64el 5.3.28+dfsg2-5build1 [868 kB] 133s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libperl5.38t64 ppc64el 5.38.2-3.2 [4957 kB] 134s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl ppc64el 5.38.2-3.2 [231 kB] 134s Get:4 http://ftpmaster.internal/ubuntu noble/main ppc64el libdpkg-perl all 1.22.4ubuntu5 [268 kB] 134s Get:5 http://ftpmaster.internal/ubuntu noble/main ppc64el make ppc64el 4.3-4.1build1 [211 kB] 134s Get:6 http://ftpmaster.internal/ubuntu noble/main ppc64el lto-disabled-list all 47 [12.4 kB] 134s Get:7 http://ftpmaster.internal/ubuntu noble/main ppc64el dpkg-dev all 1.22.4ubuntu5 [1078 kB] 134s Fetched 7626 kB in 2s (3365 kB/s) 135s dpkg: libdb5.3:ppc64el: dependency problems, but removing anyway as you requested: 135s libsasl2-modules-db:ppc64el depends on libdb5.3. 135s libpython3.12-stdlib:ppc64el depends on libdb5.3. 135s libpython3.11-stdlib:ppc64el depends on libdb5.3. 135s libpam-modules:ppc64el depends on libdb5.3. 135s iproute2 depends on libdb5.3. 135s apt-utils depends on libdb5.3. 135s 135s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67568 files and directories currently installed.) 135s Removing libdb5.3:ppc64el (5.3.28+dfsg2-4) ... 135s Selecting previously unselected package libdb5.3t64:ppc64el. 135s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67562 files and directories currently installed.) 135s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-5build1_ppc64el.deb ... 135s Unpacking libdb5.3t64:ppc64el (5.3.28+dfsg2-5build1) ... 135s Setting up libdb5.3t64:ppc64el (5.3.28+dfsg2-5build1) ... 135s Selecting previously unselected package perl-modules-5.38. 135s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67568 files and directories currently installed.) 135s Preparing to unpack .../0-perl-modules-5.38_5.38.2-3.2_all.deb ... 135s Unpacking perl-modules-5.38 (5.38.2-3.2) ... 135s Selecting previously unselected package libgdbm-compat4t64:ppc64el. 135s Preparing to unpack .../1-libgdbm-compat4t64_1.23-5.1_ppc64el.deb ... 135s Unpacking libgdbm-compat4t64:ppc64el (1.23-5.1) ... 135s Selecting previously unselected package libperl5.38t64:ppc64el. 135s Preparing to unpack .../2-libperl5.38t64_5.38.2-3.2_ppc64el.deb ... 135s Unpacking libperl5.38t64:ppc64el (5.38.2-3.2) ... 136s Selecting previously unselected package perl. 136s Preparing to unpack .../3-perl_5.38.2-3.2_ppc64el.deb ... 136s Unpacking perl (5.38.2-3.2) ... 136s Selecting previously unselected package libdpkg-perl. 136s Preparing to unpack .../4-libdpkg-perl_1.22.4ubuntu5_all.deb ... 136s Unpacking libdpkg-perl (1.22.4ubuntu5) ... 136s Selecting previously unselected package make. 136s Preparing to unpack .../5-make_4.3-4.1build1_ppc64el.deb ... 136s Unpacking make (4.3-4.1build1) ... 136s Selecting previously unselected package lto-disabled-list. 136s Preparing to unpack .../6-lto-disabled-list_47_all.deb ... 136s Unpacking lto-disabled-list (47) ... 136s Selecting previously unselected package dpkg-dev. 136s Preparing to unpack .../7-dpkg-dev_1.22.4ubuntu5_all.deb ... 136s Unpacking dpkg-dev (1.22.4ubuntu5) ... 136s Setting up lto-disabled-list (47) ... 136s Setting up libgdbm-compat4t64:ppc64el (1.23-5.1) ... 136s Setting up make (4.3-4.1build1) ... 136s Setting up perl-modules-5.38 (5.38.2-3.2) ... 136s Setting up libperl5.38t64:ppc64el (5.38.2-3.2) ... 136s Setting up perl (5.38.2-3.2) ... 136s Setting up libdpkg-perl (1.22.4ubuntu5) ... 136s Setting up dpkg-dev (1.22.4ubuntu5) ... 136s Processing triggers for man-db (2.12.0-3) ... 137s Processing triggers for libc-bin (2.39-0ubuntu2) ... 137s Reading package lists... 138s Building dependency tree... 138s Reading state information... 138s The following packages will be REMOVED: 138s cloud-init* python3-configobj* python3-debconf* 138s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 138s After this operation, 3252 kB disk space will be freed. 138s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70114 files and directories currently installed.) 138s Removing cloud-init (24.1.1-0ubuntu1) ... 139s Removing python3-configobj (5.0.8-3) ... 139s Removing python3-debconf (1.5.86) ... 139s Processing triggers for man-db (2.12.0-3) ... 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69725 files and directories currently installed.) 139s Purging configuration files for cloud-init (24.1.1-0ubuntu1) ... 140s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 140s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 140s Reading package lists... 141s Building dependency tree... 141s Reading state information... 141s linux-generic is already the newest version (6.8.0-11.11+1). 141s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 141s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 141s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 141s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 141s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease 141s Hit:5 http://ftpmaster.internal/ubuntu noble-backports InRelease 145s Reading package lists... 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 145s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 145s Reading package lists... 146s Building dependency tree... 146s Reading state information... 146s Calculating upgrade... 146s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 146s Reading package lists... 146s Building dependency tree... 146s Reading state information... 147s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 147s autopkgtest [11:45:07]: rebooting testbed after setup commands that affected boot 306s autopkgtest [11:47:46]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 307s autopkgtest [11:47:47]: testbed dpkg architecture: ppc64el 308s autopkgtest [11:47:48]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 309s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 309s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 309s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 313s Get:1 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (dsc) [2311 B] 313s Get:2 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (tar) [47.5 MB] 313s Get:3 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (diff) [33.5 kB] 313s gpgv: Signature made Tue Sep 5 02:41:47 2023 UTC 313s gpgv: using RSA key 7C3AB9CFD230BD30DD009C591E7091B1F14A64A2 313s gpgv: Can't check signature: No public key 313s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.12.0+ds-4.dsc: no acceptable signature found 319s autopkgtest [11:47:59]: testing package ncbi-blast+ version 2.12.0+ds-4 319s autopkgtest [11:47:59]: build not needed 554s autopkgtest [11:51:54]: test run-unit-test: preparing testbed 556s Reading package lists... 556s Building dependency tree... 556s Reading state information... 557s Correcting dependencies...Starting pkgProblemResolver with broken count: 0 557s Starting 2 pkgProblemResolver with broken count: 0 557s Done 557s Done 557s Starting pkgProblemResolver with broken count: 0 557s Starting 2 pkgProblemResolver with broken count: 0 557s Done 557s The following additional packages will be installed: 557s libgomp1 libmbedcrypto7 libmbedtls14 libmbedx509-1 ncbi-blast+ 557s ncbi-blast+-legacy ncbi-data 557s The following NEW packages will be installed: 557s libgomp1 libmbedcrypto7 libmbedtls14 libmbedx509-1 ncbi-blast+ 557s ncbi-blast+-legacy ncbi-data 557s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 557s 1 not fully installed or removed. 557s Need to get 18.3 MB of archives. 557s After this operation, 84.9 MB of additional disk space will be used. 557s Get:1 http://ftpmaster.internal/ubuntu noble/universe ppc64el ncbi-data all 6.1.20170106+dfsg1-10 [4395 kB] 558s Get:2 http://ftpmaster.internal/ubuntu noble/main ppc64el libgomp1 ppc64el 14-20240303-1ubuntu1 [161 kB] 558s Get:3 http://ftpmaster.internal/ubuntu noble/universe ppc64el libmbedcrypto7 ppc64el 2.28.7-1ubuntu1 [262 kB] 558s Get:4 http://ftpmaster.internal/ubuntu noble/universe ppc64el libmbedx509-1 ppc64el 2.28.7-1ubuntu1 [51.4 kB] 558s Get:5 http://ftpmaster.internal/ubuntu noble/universe ppc64el libmbedtls14 ppc64el 2.28.7-1ubuntu1 [89.7 kB] 558s Get:6 http://ftpmaster.internal/ubuntu noble/universe ppc64el ncbi-blast+ ppc64el 2.12.0+ds-4 [13.4 MB] 559s Get:7 http://ftpmaster.internal/ubuntu noble/universe ppc64el ncbi-blast+-legacy all 2.12.0+ds-4 [4984 B] 559s Fetched 18.3 MB in 1s (14.0 MB/s) 559s Selecting previously unselected package ncbi-data. 559s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69670 files and directories currently installed.) 559s Preparing to unpack .../0-ncbi-data_6.1.20170106+dfsg1-10_all.deb ... 559s Unpacking ncbi-data (6.1.20170106+dfsg1-10) ... 559s Selecting previously unselected package libgomp1:ppc64el. 559s Preparing to unpack .../1-libgomp1_14-20240303-1ubuntu1_ppc64el.deb ... 559s Unpacking libgomp1:ppc64el (14-20240303-1ubuntu1) ... 559s Selecting previously unselected package libmbedcrypto7:ppc64el. 559s Preparing to unpack .../2-libmbedcrypto7_2.28.7-1ubuntu1_ppc64el.deb ... 559s Unpacking libmbedcrypto7:ppc64el (2.28.7-1ubuntu1) ... 559s Selecting previously unselected package libmbedx509-1:ppc64el. 559s Preparing to unpack .../3-libmbedx509-1_2.28.7-1ubuntu1_ppc64el.deb ... 559s Unpacking libmbedx509-1:ppc64el (2.28.7-1ubuntu1) ... 559s Selecting previously unselected package libmbedtls14:ppc64el. 559s Preparing to unpack .../4-libmbedtls14_2.28.7-1ubuntu1_ppc64el.deb ... 559s Unpacking libmbedtls14:ppc64el (2.28.7-1ubuntu1) ... 559s Selecting previously unselected package ncbi-blast+. 559s Preparing to unpack .../5-ncbi-blast+_2.12.0+ds-4_ppc64el.deb ... 559s Unpacking ncbi-blast+ (2.12.0+ds-4) ... 560s Selecting previously unselected package ncbi-blast+-legacy. 560s Preparing to unpack .../6-ncbi-blast+-legacy_2.12.0+ds-4_all.deb ... 560s Unpacking ncbi-blast+-legacy (2.12.0+ds-4) ... 560s Setting up ncbi-data (6.1.20170106+dfsg1-10) ... 560s Setting up libgomp1:ppc64el (14-20240303-1ubuntu1) ... 560s Setting up libmbedcrypto7:ppc64el (2.28.7-1ubuntu1) ... 560s Setting up libmbedx509-1:ppc64el (2.28.7-1ubuntu1) ... 560s Setting up libmbedtls14:ppc64el (2.28.7-1ubuntu1) ... 560s Setting up ncbi-blast+ (2.12.0+ds-4) ... 560s Setting up ncbi-blast+-legacy (2.12.0+ds-4) ... 560s Setting up autopkgtest-satdep (0) ... 560s Processing triggers for man-db (2.12.0-3) ... 560s Processing triggers for libc-bin (2.39-0ubuntu2) ... 563s (Reading database ... 69938 files and directories currently installed.) 563s Removing autopkgtest-satdep (0) ... 564s autopkgtest [11:52:04]: test run-unit-test: [----------------------- 564s ---Creating Database-- 564s 564s 564s Building a new DB, current time: 03/13/2024 11:52:04 564s New DB name: /tmp/autopkgtest.aykaEG/autopkgtest_tmp/testdb 564s New DB title: testdatabase.fa 564s Sequence type: Nucleotide 564s Keep MBits: T 564s Maximum file size: 1000000000B 564s Adding sequences from FASTA; added 3 sequences in 0.0822229 seconds. 564s 564s 564s ---Searching Database for Hits--- 564s Warning: [blastn] Examining 5 or more matches is recommended 564s # BLASTN 2.12.0+ 564s # Query: gnl|MYDB|1 this is sequence 1 564s # Database: testdb 564s # Fields: query id, subject id, evalue, bit score 564s # 2 hits found 564s gnl|MYDB|1 gnl2 0.0 1299 564s gnl|MYDB|1 gnl1 0.0 1299 564s # BLAST processed 1 queries 564s ---Search and Fetch An Entry From Database--- 564s >gnl1 564s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 564s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 564s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 564s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 564s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 564s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 564s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 564s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 564s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 564s PASS 564s autopkgtest [11:52:04]: test run-unit-test: -----------------------] 565s run-unit-test PASS 565s autopkgtest [11:52:05]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 565s autopkgtest [11:52:05]: @@@@@@@@@@@@@@@@@@@@ summary 565s run-unit-test PASS 579s Creating nova instance adt-noble-ppc64el-ncbi-blast+-20240313-114239-juju-7f2275-prod-proposed-migration-environment-3 from image adt/ubuntu-noble-ppc64el-server-20240312.img (UUID 2068c266-b1f4-4468-a3e5-e52b1c42dc85)...