0s autopkgtest [11:41:16]: starting date: 2024-03-13 0s autopkgtest [11:41:16]: git checkout: d9c0295 adt_testbed.py: supress warnings from apt using a shell pipeline 0s autopkgtest [11:41:16]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.4n5j_vd5/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:perl,src:db5.3,src:gdbm,src:mmdebstrap --apt-upgrade mummer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=perl/5.38.2-3.2 db5.3/5.3.28+dfsg2-5 gdbm/1.23-5.1 mmdebstrap/1.4.3-6' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos01-ppc64el-9.secgroup --name adt-noble-ppc64el-mummer-20240313-114116-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://us.ports.ubuntu.com/ubuntu-ports/ 114s autopkgtest [11:43:10]: @@@@@@@@@@@@@@@@@@@@ test bed setup 114s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 115s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [2792 kB] 115s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [4812 B] 115s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [448 kB] 115s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [40.4 kB] 115s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [594 kB] 115s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 115s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 115s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 115s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [3110 kB] 116s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 116s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [39.1 kB] 116s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 118s Fetched 7158 kB in 2s (3016 kB/s) 118s Reading package lists... 124s Reading package lists... 124s Building dependency tree... 124s Reading state information... 124s Calculating upgrade... 124s The following packages were automatically installed and are no longer required: 124s libgdbm-compat4t64 libperl5.38 lto-disabled-list make perl-modules-5.38 124s Use 'sudo apt autoremove' to remove them. 124s The following packages will be REMOVED: 124s dpkg-dev libdpkg-perl libgdbm-compat4 libgdbm6 perl 124s The following NEW packages will be installed: 124s libgdbm-compat4t64 libgdbm6t64 124s The following packages have been kept back: 124s libperl5.38 124s The following packages will be upgraded: 124s cloud-init gdisk perl-base perl-modules-5.38 124s 4 upgraded, 2 newly installed, 5 to remove and 1 not upgraded. 124s Need to get 5932 kB of archives. 124s After this operation, 4151 kB disk space will be freed. 124s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-base ppc64el 5.38.2-3.2 [1916 kB] 125s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm6t64 ppc64el 1.23-5.1 [41.9 kB] 125s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm-compat4t64 ppc64el 1.23-5.1 [6972 B] 125s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 125s Get:5 http://ftpmaster.internal/ubuntu noble/main ppc64el cloud-init all 24.1.1-0ubuntu1 [597 kB] 125s Get:6 http://ftpmaster.internal/ubuntu noble/main ppc64el gdisk ppc64el 1.0.10-1 [260 kB] 126s Preconfiguring packages ... 126s Fetched 5932 kB in 1s (5109 kB/s) 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70112 files and directories currently installed.) 126s Removing dpkg-dev (1.22.4ubuntu5) ... 126s Removing libdpkg-perl (1.22.4ubuntu5) ... 126s Removing perl (5.38.2-3) ... 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69531 files and directories currently installed.) 126s Preparing to unpack .../perl-base_5.38.2-3.2_ppc64el.deb ... 126s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 126s Setting up perl-base (5.38.2-3.2) ... 126s dpkg: libgdbm6:ppc64el: dependency problems, but removing anyway as you requested: 126s python3-gdbm:ppc64el depends on libgdbm6 (>= 1.16). 126s man-db depends on libgdbm6 (>= 1.16). 126s libperl5.38:ppc64el depends on libgdbm6 (>= 1.21). 126s libgdbm-compat4:ppc64el depends on libgdbm6 (>= 1.16). 126s 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69531 files and directories currently installed.) 126s Removing libgdbm6:ppc64el (1.23-5) ... 126s Selecting previously unselected package libgdbm6t64:ppc64el. 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69526 files and directories currently installed.) 126s Preparing to unpack .../libgdbm6t64_1.23-5.1_ppc64el.deb ... 126s Unpacking libgdbm6t64:ppc64el (1.23-5.1) ... 126s dpkg: libgdbm-compat4:ppc64el: dependency problems, but removing anyway as you requested: 126s libperl5.38:ppc64el depends on libgdbm-compat4 (>= 1.18-3). 126s 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69532 files and directories currently installed.) 126s Removing libgdbm-compat4:ppc64el (1.23-5) ... 126s Selecting previously unselected package libgdbm-compat4t64:ppc64el. 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69527 files and directories currently installed.) 126s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_ppc64el.deb ... 126s Unpacking libgdbm-compat4t64:ppc64el (1.23-5.1) ... 126s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ... 126s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 127s Preparing to unpack .../cloud-init_24.1.1-0ubuntu1_all.deb ... 127s Unpacking cloud-init (24.1.1-0ubuntu1) over (24.1-0ubuntu1) ... 127s Preparing to unpack .../gdisk_1.0.10-1_ppc64el.deb ... 127s Unpacking gdisk (1.0.10-1) over (1.0.9-2.1) ... 127s Setting up cloud-init (24.1.1-0ubuntu1) ... 129s Setting up libgdbm6t64:ppc64el (1.23-5.1) ... 129s Setting up libgdbm-compat4t64:ppc64el (1.23-5.1) ... 129s Setting up gdisk (1.0.10-1) ... 129s Setting up perl-modules-5.38 (5.38.2-3.2) ... 129s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 129s Processing triggers for man-db (2.12.0-3) ... 130s Processing triggers for libc-bin (2.39-0ubuntu2) ... 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 130s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 130s Reading package lists... 130s Building dependency tree... 130s Reading state information... 131s The following packages will be REMOVED: 131s libgdbm-compat4t64* libperl5.38* lto-disabled-list* make* perl-modules-5.38* 131s 0 upgraded, 0 newly installed, 5 to remove and 0 not upgraded. 131s After this operation, 53.0 MB disk space will be freed. 131s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69533 files and directories currently installed.) 131s Removing libperl5.38:ppc64el (5.38.2-3) ... 131s Removing libgdbm-compat4t64:ppc64el (1.23-5.1) ... 131s Removing lto-disabled-list (47) ... 131s Removing make (4.3-4.1build1) ... 131s Removing perl-modules-5.38 (5.38.2-3.2) ... 131s Processing triggers for man-db (2.12.0-3) ... 131s Processing triggers for libc-bin (2.39-0ubuntu2) ... 132s sh: Attempting to set up Debian/Ubuntu apt sources automatically 132s sh: Distribution appears to be Ubuntu 132s Reading package lists... 132s Building dependency tree... 132s Reading state information... 133s eatmydata is already the newest version (131-1). 133s dbus is already the newest version (1.14.10-4ubuntu1). 133s dbus set to manually installed. 133s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 133s Reading package lists... 133s Building dependency tree... 133s Reading state information... 133s rng-tools-debian is already the newest version (2.4). 133s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 133s Reading package lists... 133s Building dependency tree... 133s Reading state information... 134s haveged is already the newest version (1.9.14-1ubuntu1). 134s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 134s Reading package lists... 134s Building dependency tree... 134s Reading state information... 134s The following additional packages will be installed: 134s libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 lto-disabled-list 134s make perl perl-modules-5.38 134s Suggested packages: 134s debian-keyring gcc | c-compiler git bzr make-doc perl-doc 134s libterm-readline-gnu-perl | libterm-readline-perl-perl 134s libtap-harness-archive-perl 134s Recommended packages: 134s build-essential gcc | c-compiler fakeroot libalgorithm-merge-perl 134s libfile-fcntllock-perl 134s The following packages will be REMOVED: 134s libdb5.3 134s The following NEW packages will be installed: 134s dpkg-dev libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 134s lto-disabled-list make perl perl-modules-5.38 134s 0 upgraded, 9 newly installed, 1 to remove and 0 not upgraded. 134s Need to get 7626 kB/10.7 MB of archives. 134s After this operation, 57.2 MB of additional disk space will be used. 134s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdb5.3t64 ppc64el 5.3.28+dfsg2-5build1 [868 kB] 135s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libperl5.38t64 ppc64el 5.38.2-3.2 [4957 kB] 135s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl ppc64el 5.38.2-3.2 [231 kB] 135s Get:4 http://ftpmaster.internal/ubuntu noble/main ppc64el libdpkg-perl all 1.22.4ubuntu5 [268 kB] 135s Get:5 http://ftpmaster.internal/ubuntu noble/main ppc64el make ppc64el 4.3-4.1build1 [211 kB] 135s Get:6 http://ftpmaster.internal/ubuntu noble/main ppc64el lto-disabled-list all 47 [12.4 kB] 135s Get:7 http://ftpmaster.internal/ubuntu noble/main ppc64el dpkg-dev all 1.22.4ubuntu5 [1078 kB] 136s Fetched 7626 kB in 1s (6004 kB/s) 136s dpkg: libdb5.3:ppc64el: dependency problems, but removing anyway as you requested: 136s libsasl2-modules-db:ppc64el depends on libdb5.3. 136s libpython3.12-stdlib:ppc64el depends on libdb5.3. 136s libpython3.11-stdlib:ppc64el depends on libdb5.3. 136s libpam-modules:ppc64el depends on libdb5.3. 136s iproute2 depends on libdb5.3. 136s apt-utils depends on libdb5.3. 136s 136s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67568 files and directories currently installed.) 136s Removing libdb5.3:ppc64el (5.3.28+dfsg2-4) ... 136s Selecting previously unselected package libdb5.3t64:ppc64el. 136s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67562 files and directories currently installed.) 136s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-5build1_ppc64el.deb ... 136s Unpacking libdb5.3t64:ppc64el (5.3.28+dfsg2-5build1) ... 136s Setting up libdb5.3t64:ppc64el (5.3.28+dfsg2-5build1) ... 136s Selecting previously unselected package perl-modules-5.38. 136s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 67568 files and directories currently installed.) 136s Preparing to unpack .../0-perl-modules-5.38_5.38.2-3.2_all.deb ... 136s Unpacking perl-modules-5.38 (5.38.2-3.2) ... 136s Selecting previously unselected package libgdbm-compat4t64:ppc64el. 136s Preparing to unpack .../1-libgdbm-compat4t64_1.23-5.1_ppc64el.deb ... 136s Unpacking libgdbm-compat4t64:ppc64el (1.23-5.1) ... 137s Selecting previously unselected package libperl5.38t64:ppc64el. 137s Preparing to unpack .../2-libperl5.38t64_5.38.2-3.2_ppc64el.deb ... 137s Unpacking libperl5.38t64:ppc64el (5.38.2-3.2) ... 137s Selecting previously unselected package perl. 137s Preparing to unpack .../3-perl_5.38.2-3.2_ppc64el.deb ... 137s Unpacking perl (5.38.2-3.2) ... 137s Selecting previously unselected package libdpkg-perl. 137s Preparing to unpack .../4-libdpkg-perl_1.22.4ubuntu5_all.deb ... 137s Unpacking libdpkg-perl (1.22.4ubuntu5) ... 137s Selecting previously unselected package make. 137s Preparing to unpack .../5-make_4.3-4.1build1_ppc64el.deb ... 137s Unpacking make (4.3-4.1build1) ... 137s Selecting previously unselected package lto-disabled-list. 137s Preparing to unpack .../6-lto-disabled-list_47_all.deb ... 137s Unpacking lto-disabled-list (47) ... 137s Selecting previously unselected package dpkg-dev. 137s Preparing to unpack .../7-dpkg-dev_1.22.4ubuntu5_all.deb ... 137s Unpacking dpkg-dev (1.22.4ubuntu5) ... 137s Setting up lto-disabled-list (47) ... 137s Setting up libgdbm-compat4t64:ppc64el (1.23-5.1) ... 137s Setting up make (4.3-4.1build1) ... 137s Setting up perl-modules-5.38 (5.38.2-3.2) ... 137s Setting up libperl5.38t64:ppc64el (5.38.2-3.2) ... 137s Setting up perl (5.38.2-3.2) ... 137s Setting up libdpkg-perl (1.22.4ubuntu5) ... 137s Setting up dpkg-dev (1.22.4ubuntu5) ... 137s Processing triggers for man-db (2.12.0-3) ... 138s Processing triggers for libc-bin (2.39-0ubuntu2) ... 142s Reading package lists... 142s Building dependency tree... 142s Reading state information... 142s The following packages will be REMOVED: 142s cloud-init* python3-configobj* python3-debconf* 142s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 142s After this operation, 3252 kB disk space will be freed. 143s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70114 files and directories currently installed.) 143s Removing cloud-init (24.1.1-0ubuntu1) ... 143s Removing python3-configobj (5.0.8-3) ... 143s Removing python3-debconf (1.5.86) ... 143s Processing triggers for man-db (2.12.0-3) ... 143s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69725 files and directories currently installed.) 143s Purging configuration files for cloud-init (24.1.1-0ubuntu1) ... 144s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 144s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 145s Reading package lists... 145s Building dependency tree... 145s Reading state information... 145s linux-generic is already the newest version (6.8.0-11.11+1). 145s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 145s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 146s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 146s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 146s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease 146s Hit:5 http://ftpmaster.internal/ubuntu noble-backports InRelease 150s Reading package lists... 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 150s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 150s Reading package lists... 150s Building dependency tree... 150s Reading state information... 150s Calculating upgrade... 150s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 150s Reading package lists... 150s Building dependency tree... 150s Reading state information... 151s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 151s autopkgtest [11:43:47]: rebooting testbed after setup commands that affected boot 317s autopkgtest-virt-ssh: WARNING: ssh connection failed. Retrying in 3 seconds... 323s autopkgtest [11:46:39]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 323s autopkgtest [11:46:39]: testbed dpkg architecture: ppc64el 324s autopkgtest [11:46:40]: @@@@@@@@@@@@@@@@@@@@ apt-source mummer 325s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 325s W: Target Packages (main/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (main/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (universe/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (universe/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (restricted/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (restricted/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (multiverse/binary-ppc64el/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (multiverse/cnf/Commands-ppc64el) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 325s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 327s Get:1 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (dsc) [2173 B] 327s Get:2 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (tar) [1113 kB] 327s Get:3 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (diff) [416 kB] 327s gpgv: Signature made Sun Dec 4 11:37:19 2022 UTC 327s gpgv: using RSA key F1F007320A035541F0A663CA578A0494D1C646D1 327s gpgv: issuer "tille@debian.org" 327s gpgv: Can't check signature: No public key 327s dpkg-source: warning: cannot verify inline signature for ./mummer_3.23+dfsg-8.dsc: no acceptable signature found 327s autopkgtest [11:46:43]: testing package mummer version 3.23+dfsg-8 327s autopkgtest [11:46:43]: build not needed 328s autopkgtest [11:46:44]: test run-unit-test: preparing testbed 331s Reading package lists... 331s Building dependency tree... 331s Reading state information... 332s Correcting dependencies...Starting pkgProblemResolver with broken count: 0 332s Starting 2 pkgProblemResolver with broken count: 0 332s Done 332s Done 332s Starting pkgProblemResolver with broken count: 0 332s Starting 2 pkgProblemResolver with broken count: 0 332s Done 332s The following additional packages will be installed: 332s mummer mummer-doc 332s The following NEW packages will be installed: 332s mummer mummer-doc 332s 0 upgraded, 2 newly installed, 0 to remove and 0 not upgraded. 332s 1 not fully installed or removed. 332s Need to get 2028 kB of archives. 332s After this operation, 5334 kB of additional disk space will be used. 332s Get:1 http://ftpmaster.internal/ubuntu noble/universe ppc64el mummer ppc64el 3.23+dfsg-8 [714 kB] 333s Get:2 http://ftpmaster.internal/ubuntu noble/universe ppc64el mummer-doc all 3.23+dfsg-8 [1314 kB] 334s Fetched 2028 kB in 1s (2849 kB/s) 334s Selecting previously unselected package mummer. 334s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69670 files and directories currently installed.) 334s Preparing to unpack .../mummer_3.23+dfsg-8_ppc64el.deb ... 334s Unpacking mummer (3.23+dfsg-8) ... 334s Selecting previously unselected package mummer-doc. 334s Preparing to unpack .../mummer-doc_3.23+dfsg-8_all.deb ... 334s Unpacking mummer-doc (3.23+dfsg-8) ... 334s Setting up mummer-doc (3.23+dfsg-8) ... 334s Setting up mummer (3.23+dfsg-8) ... 334s Setting up autopkgtest-satdep (0) ... 334s Processing triggers for man-db (2.12.0-3) ... 337s (Reading database ... 69839 files and directories currently installed.) 337s Removing autopkgtest-satdep (0) ... 338s autopkgtest [11:46:54]: test run-unit-test: [----------------------- 338s --------promer---- 338s 1: PREPARING DATA 338s 2,3: RUNNING mummer AND CREATING CLUSTERS 338s # reading input file "promer.aaref" of length 71202 338s # construct suffix tree for sequence of length 71202 338s # (maximum reference length is 536870908) 338s # (maximum query length is 4294967295) 338s # CONSTRUCTIONTIME /usr/bin/mummer promer.aaref 0.01 338s # reading input file "promer.aaqry" of length 84243 338s # matching query-file "promer.aaqry" 338s # against subject-file "promer.aaref" 338s # COMPLETETIME /usr/bin/mummer promer.aaref 0.03 338s # SPACE /usr/bin/mummer promer.aaref 0.15 338s 4: FINISHING DATA 338s --------mapview---- 338s --------mummer---- 338s # reading input file "../input/H_pylori26695_Eslice.fasta" of length 275287 338s # construct suffix tree for sequence of length 275287 338s # (maximum reference length is 536870908) 338s # (maximum query length is 4294967295) 338s # process 2752 characters per dot 338s #.................................................................................................... 338s # CONSTRUCTIONTIME /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.04 338s # reading input file "../input/H_pyloriJ99_Eslice.fasta" of length 265111 338s # matching query-file "../input/H_pyloriJ99_Eslice.fasta" 338s # against subject-file "../input/H_pylori26695_Eslice.fasta" 338s # COMPLETETIME /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.10 338s # SPACE /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.52 338s echo 338s --------nucmer---- 338s 1: PREPARING DATA 338s 2,3: RUNNING mummer AND CREATING CLUSTERS 338s # reading input file "nucmer.ntref" of length 312601 338s # construct suffix tree for sequence of length 312601 338s # (maximum reference length is 536870908) 338s # (maximum query length is 4294967295) 338s # process 3126 characters per dot 339s #.................................................................................................... 339s # CONSTRUCTIONTIME /usr/bin/mummer nucmer.ntref 0.04 339s # reading input file "/tmp/autopkgtest.FGe7R4/autopkgtest_tmp/output/../input/B_anthracis_contigs.fasta" of length 308869 339s # matching query-file "/tmp/autopkgtest.FGe7R4/autopkgtest_tmp/output/../input/B_anthracis_contigs.fasta" 339s # against subject-file "nucmer.ntref" 339s # COMPLETETIME /usr/bin/mummer nucmer.ntref 0.12 339s # SPACE /usr/bin/mummer nucmer.ntref 0.60 339s 4: FINISHING DATA 339s --------run-mummer3---- 339s Find MUMs 339s # reading input file "../input/H_pylori26695_Bslice.fasta" of length 69860 339s # construct suffix tree for sequence of length 69860 339s # (maximum reference length is 536870908) 339s # (maximum query length is 4294967295) 339s # CONSTRUCTIONTIME /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.01 339s # reading input file "../input/H_pyloriJ99_Bslice.fasta" of length 69860 339s # matching query-file "../input/H_pyloriJ99_Bslice.fasta" 339s # against subject-file "../input/H_pylori26695_Bslice.fasta" 339s # COMPLETETIME /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.02 339s # SPACE /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.14 339s Determine gaps 339s Align gaps 339s Ref len = 69860 339s acgt's = 69860 339s Non acgt's = 0 339s Number of matches = 14 339s Sum of match bases = 60449 339s Avg match bases = 4318 339s 400,404c400,404 339s < Errors = 3 339s < A: ttttttttaacgcttgtcaagaataattgagaaatattgcggttttttaaaaaatg 339s < B: ttttttttaatgcttgtcaagaataactgaaaaatattgcggttttttaaaaaatg 339s < ==========^ ^ ^ ========== 339s < Region: 167 .. 4847 1 .. 4684 229 / 4684 4.89% 339s --- 339s > Errors = 1 339s > A: ttttttttaacgcttgtcaagaataattaaaaaatg 339s > B: ttttttttaatgcttgtcaagaataattaaaaaatg 339s > ==========^ ========== 339s > Region: 167 .. 4827 1 .. 4664 227 / 4664 4.87% 339s autopkgtest [11:46:55]: test run-unit-test: -----------------------] 339s autopkgtest [11:46:55]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 339s run-unit-test FAIL non-zero exit status 1 340s autopkgtest [11:46:56]: @@@@@@@@@@@@@@@@@@@@ summary 340s run-unit-test FAIL non-zero exit status 1 354s Creating nova instance adt-noble-ppc64el-mummer-20240313-114116-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-ppc64el-server-20240312.img (UUID 2068c266-b1f4-4468-a3e5-e52b1c42dc85)...