0s autopkgtest [15:46:18]: starting date and time: 2024-03-23 15:46:18+0000 0s autopkgtest [15:46:18]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [15:46:18]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.eqb2_vo_/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:samtools,src:curl,src:gnutls28,src:htslib,src:libpsl,src:nettle,src:openssl --apt-upgrade fastaq --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=samtools/1.19.2-1build1 curl/8.5.0-2ubuntu7 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-ppc64el-6.secgroup --name adt-noble-ppc64el-fastaq-20240323-154618-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 344s autopkgtest [15:52:02]: testbed dpkg architecture: ppc64el 344s autopkgtest [15:52:02]: testbed apt version: 2.7.12 344s autopkgtest [15:52:02]: @@@@@@@@@@@@@@@@@@@@ test bed setup 345s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 345s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [56.9 kB] 345s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 345s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3969 kB] 345s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [493 kB] 346s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [659 kB] 346s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 346s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 346s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 346s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [4248 kB] 346s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 346s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [60.8 kB] 346s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 350s Fetched 9623 kB in 3s (3824 kB/s) 350s Reading package lists... 353s Reading package lists... 353s Building dependency tree... 353s Reading state information... 353s Calculating upgrade... 354s The following packages will be REMOVED: 354s libssl3 354s The following NEW packages will be installed: 354s libssl3t64 354s The following packages have been kept back: 354s curl 354s The following packages will be upgraded: 354s openssl 354s 1 upgraded, 1 newly installed, 1 to remove and 1 not upgraded. 354s Need to get 3151 kB of archives. 354s After this operation, 73.7 kB of additional disk space will be used. 354s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssl ppc64el 3.0.13-0ubuntu2 [1026 kB] 354s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libssl3t64 ppc64el 3.0.13-0ubuntu2 [2125 kB] 355s Fetched 3151 kB in 1s (3090 kB/s) 355s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 355s Preparing to unpack .../openssl_3.0.13-0ubuntu2_ppc64el.deb ... 355s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 355s dpkg: libssl3:ppc64el: dependency problems, but removing anyway as you requested: 355s wget depends on libssl3 (>= 3.0.0). 355s tnftp depends on libssl3 (>= 3.0.0). 355s tcpdump depends on libssl3 (>= 3.0.0). 355s systemd-resolved depends on libssl3 (>= 3.0.0). 355s systemd depends on libssl3 (>= 3.0.0). 355s sudo depends on libssl3 (>= 3.0.0). 355s rsync depends on libssl3 (>= 3.0.0). 355s python3-cryptography depends on libssl3 (>= 3.0.0). 355s openssh-server depends on libssl3 (>= 3.0.10). 355s openssh-client depends on libssl3 (>= 3.0.10). 355s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 355s libsystemd-shared:ppc64el depends on libssl3 (>= 3.0.0). 355s libssh-4:ppc64el depends on libssl3 (>= 3.0.0). 355s libsasl2-modules:ppc64el depends on libssl3 (>= 3.0.0). 355s libsasl2-2:ppc64el depends on libssl3 (>= 3.0.0). 355s libpython3.12-minimal:ppc64el depends on libssl3 (>= 3.0.0). 355s libpython3.11-minimal:ppc64el depends on libssl3 (>= 3.0.0). 355s libnvme1 depends on libssl3 (>= 3.0.0). 355s libkrb5-3:ppc64el depends on libssl3 (>= 3.0.0). 355s libkmod2:ppc64el depends on libssl3 (>= 3.0.0). 355s libfido2-1:ppc64el depends on libssl3 (>= 3.0.0). 355s libcurl4:ppc64el depends on libssl3 (>= 3.0.0). 355s libcryptsetup12:ppc64el depends on libssl3 (>= 3.0.0). 355s kmod depends on libssl3 (>= 3.0.0). 355s dhcpcd-base depends on libssl3 (>= 3.0.0). 355s bind9-libs:ppc64el depends on libssl3 (>= 3.0.0). 355s 355s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 355s Removing libssl3:ppc64el (3.0.10-1ubuntu4) ... 355s Selecting previously unselected package libssl3t64:ppc64el. 355s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70145 files and directories currently installed.) 355s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_ppc64el.deb ... 355s Unpacking libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 355s Setting up libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 355s Setting up openssl (3.0.13-0ubuntu2) ... 355s Processing triggers for man-db (2.12.0-3) ... 356s Processing triggers for libc-bin (2.39-0ubuntu6) ... 356s Reading package lists... 357s Building dependency tree... 357s Reading state information... 357s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 357s sh: Attempting to set up Debian/Ubuntu apt sources automatically 357s sh: Distribution appears to be Ubuntu 358s Reading package lists... 359s Building dependency tree... 359s Reading state information... 359s eatmydata is already the newest version (131-1). 359s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 359s Reading package lists... 359s Building dependency tree... 359s Reading state information... 359s dbus is already the newest version (1.14.10-4ubuntu1). 359s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 359s Reading package lists... 360s Building dependency tree... 360s Reading state information... 360s rng-tools-debian is already the newest version (2.4). 360s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 360s Reading package lists... 360s Building dependency tree... 360s Reading state information... 360s The following packages will be REMOVED: 360s cloud-init* python3-configobj* python3-debconf* 360s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 360s After this operation, 3256 kB disk space will be freed. 360s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70158 files and directories currently installed.) 360s Removing cloud-init (24.1.2-0ubuntu1) ... 361s Removing python3-configobj (5.0.8-3) ... 361s Removing python3-debconf (1.5.86) ... 361s Processing triggers for man-db (2.12.0-3) ... 362s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69769 files and directories currently installed.) 362s Purging configuration files for cloud-init (24.1.2-0ubuntu1) ... 362s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 362s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 362s invoke-rc.d: policy-rc.d denied execution of try-restart. 362s Reading package lists... 363s Building dependency tree... 363s Reading state information... 363s linux-generic is already the newest version (6.8.0-11.11+1). 363s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 363s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 363s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 363s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 366s Reading package lists... 366s Reading package lists... 366s Building dependency tree... 366s Reading state information... 367s Calculating upgrade... 367s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 367s Reading package lists... 367s Building dependency tree... 367s Reading state information... 367s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 368s autopkgtest [15:52:26]: rebooting testbed after setup commands that affected boot 533s autopkgtest [15:55:11]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 535s autopkgtest [15:55:13]: @@@@@@@@@@@@@@@@@@@@ apt-source fastaq 537s Get:1 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (dsc) [2135 B] 537s Get:2 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (tar) [71.3 kB] 537s Get:3 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (diff) [4884 B] 537s gpgv: Signature made Mon Dec 18 16:27:46 2023 UTC 537s gpgv: using RSA key 5B34BA5AAB5507E903426E85E8D37AE2F09F4872 537s gpgv: Can't check signature: No public key 537s dpkg-source: warning: cannot verify inline signature for ./fastaq_3.17.0-6.dsc: no acceptable signature found 537s autopkgtest [15:55:15]: testing package fastaq version 3.17.0-6 537s autopkgtest [15:55:15]: build not needed 538s autopkgtest [15:55:16]: test run: preparing testbed 556s Reading package lists... 556s Building dependency tree... 556s Reading state information... 557s Starting pkgProblemResolver with broken count: 0 557s Starting 2 pkgProblemResolver with broken count: 0 557s Done 557s The following additional packages will be installed: 557s fastaq libdeflate0 libhts3 libhtscodecs2 samtools 557s Suggested packages: 557s cwltool 557s The following NEW packages will be installed: 557s autopkgtest-satdep fastaq libdeflate0 libhts3 libhtscodecs2 samtools 557s 0 upgraded, 6 newly installed, 0 to remove and 0 not upgraded. 557s Need to get 1441 kB/1442 kB of archives. 557s After this operation, 4159 kB of additional disk space will be used. 557s Get:1 /tmp/autopkgtest.9mLAYx/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [720 B] 557s Get:2 http://ftpmaster.internal/ubuntu noble/main ppc64el libdeflate0 ppc64el 1.19-1 [61.9 kB] 557s Get:3 http://ftpmaster.internal/ubuntu noble/universe ppc64el libhtscodecs2 ppc64el 1.6.0-1 [110 kB] 557s Get:4 http://ftpmaster.internal/ubuntu noble/universe ppc64el libhts3 ppc64el 1.18+ds-1 [553 kB] 557s Get:5 http://ftpmaster.internal/ubuntu noble/universe ppc64el samtools ppc64el 1.19.2-1 [669 kB] 558s Get:6 http://ftpmaster.internal/ubuntu noble/universe ppc64el fastaq all 3.17.0-6 [47.9 kB] 558s Fetched 1441 kB in 1s (2355 kB/s) 558s Selecting previously unselected package libdeflate0:ppc64el. 558s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69714 files and directories currently installed.) 558s Preparing to unpack .../0-libdeflate0_1.19-1_ppc64el.deb ... 558s Unpacking libdeflate0:ppc64el (1.19-1) ... 558s Selecting previously unselected package libhtscodecs2:ppc64el. 558s Preparing to unpack .../1-libhtscodecs2_1.6.0-1_ppc64el.deb ... 558s Unpacking libhtscodecs2:ppc64el (1.6.0-1) ... 558s Selecting previously unselected package libhts3:ppc64el. 558s Preparing to unpack .../2-libhts3_1.18+ds-1_ppc64el.deb ... 558s Unpacking libhts3:ppc64el (1.18+ds-1) ... 558s Selecting previously unselected package samtools. 558s Preparing to unpack .../3-samtools_1.19.2-1_ppc64el.deb ... 558s Unpacking samtools (1.19.2-1) ... 558s Selecting previously unselected package fastaq. 558s Preparing to unpack .../4-fastaq_3.17.0-6_all.deb ... 558s Unpacking fastaq (3.17.0-6) ... 558s Selecting previously unselected package autopkgtest-satdep. 558s Preparing to unpack .../5-1-autopkgtest-satdep.deb ... 558s Unpacking autopkgtest-satdep (0) ... 558s Setting up libhtscodecs2:ppc64el (1.6.0-1) ... 558s Setting up libdeflate0:ppc64el (1.19-1) ... 558s Setting up libhts3:ppc64el (1.18+ds-1) ... 558s Setting up samtools (1.19.2-1) ... 558s Setting up fastaq (3.17.0-6) ... 558s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:37: SyntaxWarning: invalid escape sequence '\s' 558s phylip_regex = re.compile('^\s*[0-9]+\s+[0-9]+$') 558s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:38: SyntaxWarning: invalid escape sequence '\s' 558s gbk_regex = re.compile('^LOCUS\s+\S') 558s Setting up autopkgtest-satdep (0) ... 558s Processing triggers for man-db (2.12.0-3) ... 559s Processing triggers for libc-bin (2.39-0ubuntu6) ... 561s (Reading database ... 69920 files and directories currently installed.) 561s Removing autopkgtest-satdep (0) ... 562s autopkgtest [15:55:40]: test run: [----------------------- 562s >test 562s TCGTAGCCGGCTCGCATCGACTG 562s autopkgtest [15:55:40]: test run: -----------------------] 563s run PASS 563s autopkgtest [15:55:41]: test run: - - - - - - - - - - results - - - - - - - - - - 563s autopkgtest [15:55:41]: test python-test: preparing testbed 579s Reading package lists... 579s Building dependency tree... 579s Reading state information... 580s Starting pkgProblemResolver with broken count: 0 580s Starting 2 pkgProblemResolver with broken count: 0 580s Done 580s The following NEW packages will be installed: 580s autopkgtest-satdep 580s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 580s Need to get 0 B/720 B of archives. 580s After this operation, 0 B of additional disk space will be used. 580s Get:1 /tmp/autopkgtest.9mLAYx/2-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [720 B] 580s Selecting previously unselected package autopkgtest-satdep. 580s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69920 files and directories currently installed.) 580s Preparing to unpack .../2-autopkgtest-satdep.deb ... 580s Unpacking autopkgtest-satdep (0) ... 580s Setting up autopkgtest-satdep (0) ... 582s (Reading database ... 69920 files and directories currently installed.) 582s Removing autopkgtest-satdep (0) ... 582s autopkgtest [15:56:00]: test python-test: [----------------------- 583s autopkgtest [15:56:01]: test python-test: -----------------------] 583s autopkgtest [15:56:01]: test python-test: - - - - - - - - - - results - - - - - - - - - - 583s python-test PASS 584s autopkgtest [15:56:02]: @@@@@@@@@@@@@@@@@@@@ summary 584s run PASS 584s python-test PASS 623s Creating nova instance adt-noble-ppc64el-fastaq-20240323-154618-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-ppc64el-server-20240323.img (UUID ff8abf95-5243-4ea5-b7f5-3bf690534a1d)...