0s autopkgtest [15:35:05]: starting date and time: 2024-03-26 15:35:05+0000 0s autopkgtest [15:35:05]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [15:35:05]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.hrwx2cdz/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed --apt-upgrade ataqv --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ataqv/1.3.1+ds-2build2 python3-defaults/3.12.2-0ubuntu1' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-ppc64el-6.secgroup --name adt-noble-ppc64el-ataqv-20240326-153505-juju-7f2275-prod-proposed-migration-environment-2-daed3416-811e-417b-b09e-dce4a20b3c43 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 340s autopkgtest [15:40:45]: testbed dpkg architecture: ppc64el 340s autopkgtest [15:40:45]: testbed apt version: 2.7.12 340s autopkgtest [15:40:45]: @@@@@@@@@@@@@@@@@@@@ test bed setup 341s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 342s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [56.0 kB] 342s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [4015 kB] 343s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [496 kB] 344s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [8504 B] 344s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [698 kB] 344s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 344s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 344s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 344s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [4222 kB] 345s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 345s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [61.7 kB] 345s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 348s Fetched 9688 kB in 4s (2266 kB/s) 348s Reading package lists... 350s Reading package lists... 350s Building dependency tree... 350s Reading state information... 350s Calculating upgrade... 350s The following packages will be upgraded: 350s psmisc 351s 1 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 351s Need to get 192 kB of archives. 351s After this operation, 28.7 kB disk space will be freed. 351s Get:1 http://ftpmaster.internal/ubuntu noble/main ppc64el psmisc ppc64el 23.7-1 [192 kB] 351s Fetched 192 kB in 0s (538 kB/s) 351s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 351s Preparing to unpack .../psmisc_23.7-1_ppc64el.deb ... 351s Unpacking psmisc (23.7-1) over (23.6-2) ... 351s Setting up psmisc (23.7-1) ... 351s Processing triggers for man-db (2.12.0-3) ... 352s Reading package lists... 352s Building dependency tree... 352s Reading state information... 353s 0 upgraded, 0 newly installed, 0 to remove and 247 not upgraded. 353s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 353s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 353s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 353s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 355s Reading package lists... 355s Reading package lists... 355s Building dependency tree... 355s Reading state information... 355s Calculating upgrade... 356s The following packages were automatically installed and are no longer required: 356s libaio1 libnetplan0 python3-distutils python3-lib2to3 356s Use 'sudo apt autoremove' to remove them. 356s The following packages will be REMOVED: 356s libapt-pkg6.0 libarchive13 libatm1 libcurl3-gnutls libcurl4 libdb5.3 libelf1 356s libext2fs2 libgdbm-compat4 libgdbm6 libglib2.0-0 libgnutls30 libgpgme11 356s libhogweed6 libmagic1 libnettle8 libnpth0 libnvme1 libparted2 libperl5.38 356s libpng16-16 libpsl5 libreadline8 libreiserfscore0 libssl3 libtirpc3 liburcu8 356s libuv1 356s The following NEW packages will be installed: 356s bpfcc-tools bpftrace fontconfig-config fonts-dejavu-core fonts-dejavu-mono 356s ieee-data libaio1t64 libapt-pkg6.0t64 libarchive13t64 libatm1t64 libbpfcc 356s libc-dev-bin libc-devtools libc6-dev libclang-cpp18 libclang1-18 356s libcrypt-dev libcurl3t64-gnutls libcurl4t64 libdb5.3t64 libdeflate0 356s libdw1t64 libelf1t64 libext2fs2t64 libfontconfig1 libgd3 libgdbm-compat4t64 356s libgdbm6t64 libglib2.0-0t64 libgnutls30t64 libgpgme11t64 libhogweed6t64 356s libjbig0 libjpeg-turbo8 libjpeg8 liblerc4 libllvm18 libmagic1t64 libnetplan1 356s libnettle8t64 libnpth0t64 libnvme1t64 libparted2t64 libperl5.38t64 356s libpng16-16t64 libpsl5t64 libreadline8t64 libreiserfscore0t64 libsharpyuv0 356s libssl3t64 libtiff6 libtirpc3t64 libunwind8 liburcu8t64 libuv1t64 libwebp7 356s libxpm4 linux-headers-6.8.0-20 linux-headers-6.8.0-20-generic 356s linux-image-6.8.0-20-generic linux-libc-dev linux-modules-6.8.0-20-generic 356s linux-modules-extra-6.8.0-20-generic linux-tools-6.8.0-20 356s linux-tools-6.8.0-20-generic linux-tools-common manpages manpages-dev 356s python3-bpfcc python3-netaddr rpcsvc-proto ubuntu-kernel-accessories 356s xdg-user-dirs 356s The following packages will be upgraded: 356s apparmor apt apt-utils base-files bc bind9-dnsutils bind9-host bind9-libs 356s binutils binutils-common binutils-powerpc64le-linux-gnu bolt bsdextrautils 356s bsdutils btrfs-progs coreutils cryptsetup-bin curl dbus dbus-bin dbus-daemon 356s dbus-session-bus-common dbus-system-bus-common dbus-user-session dhcpcd-base 356s dirmngr dmsetup dpkg dpkg-dev e2fsprogs e2fsprogs-l10n eject fdisk file ftp 356s fwupd gawk gcc-13-base gcc-14-base gir1.2-girepository-2.0 gir1.2-glib-2.0 356s gnupg gnupg-l10n gnupg-utils gpg gpg-agent gpg-wks-client gpgconf gpgsm gpgv 356s groff-base grub-common grub-ieee1275 grub-ieee1275-bin grub2-common 356s ibverbs-providers inetutils-telnet info initramfs-tools initramfs-tools-bin 356s initramfs-tools-core install-info iproute2 jq keyboxd kmod kpartx 356s krb5-locales libapparmor1 libaudit-common libaudit1 libbinutils libblkid1 356s libblockdev-crypto3 libblockdev-fs3 libblockdev-loop3 libblockdev-mdraid3 356s libblockdev-nvme3 libblockdev-part3 libblockdev-swap3 libblockdev-utils3 356s libblockdev3 libbpf1 libbrotli1 libcap-ng0 libcom-err2 libcryptsetup12 356s libctf-nobfd0 libctf0 libdbus-1-3 libdebconfclient0 libdevmapper1.02.1 356s libdpkg-perl libevent-core-2.1-7 libexpat1 libfdisk1 libfido2-1 libfreetype6 356s libftdi1-2 libfwupd2 libgcc-s1 libgirepository-1.0-1 libglib2.0-data 356s libgssapi-krb5-2 libgudev-1.0-0 libgusb2 libibverbs1 libjcat1 libjq1 356s libjson-glib-1.0-0 libjson-glib-1.0-common libk5crypto3 libkmod2 libkrb5-3 356s libkrb5support0 libldap-common libldap2 liblocale-gettext-perl liblzma5 356s libmagic-mgc libmbim-glib4 libmbim-proxy libmm-glib0 libmount1 libnghttp2-14 356s libnsl2 libnss-systemd libpam-modules libpam-modules-bin libpam-runtime 356s libpam-systemd libpam0g libplymouth5 libpolkit-agent-1-0 356s libpolkit-gobject-1-0 libproc2-0 libprotobuf-c1 libpython3-stdlib 356s libpython3.11-minimal libpython3.11-stdlib libpython3.12-minimal 356s libpython3.12-stdlib libqmi-glib5 libqmi-proxy libqrtr-glib0 librtmp1 356s libsasl2-2 libsasl2-modules libsasl2-modules-db libseccomp2 libselinux1 356s libsemanage-common libsemanage2 libsframe1 libslang2 libsmartcols1 356s libsqlite3-0 libss2 libssh-4 libstdc++6 libsystemd-shared libsystemd0 356s libtext-charwidth-perl libtext-iconv-perl libtirpc-common libudev1 356s libudisks2-0 libusb-1.0-0 libuuid1 libvolume-key1 libxml2 libxmlb2 libxmuu1 356s linux-generic linux-headers-generic linux-headers-virtual 356s linux-image-generic linux-image-virtual linux-virtual logsave lshw lsof 356s man-db motd-news-config mount mtr-tiny multipath-tools netplan-generator 356s netplan.io openssh-client openssh-server openssh-sftp-server openssl parted 356s perl perl-base perl-modules-5.38 pinentry-curses plymouth 356s plymouth-theme-ubuntu-text procps python-apt-common python3 python3-apt 356s python3-cryptography python3-dbus python3-distutils python3-gdbm python3-gi 356s python3-lib2to3 python3-minimal python3-netplan python3-pkg-resources 356s python3-pyrsistent python3-setuptools python3-typing-extensions python3-yaml 356s python3.11 python3.11-minimal python3.12 python3.12-minimal readline-common 356s rsync rsyslog shared-mime-info sudo systemd systemd-dev systemd-resolved 356s systemd-sysv systemd-timesyncd tcpdump telnet tnftp ubuntu-pro-client 356s ubuntu-pro-client-l10n udev udisks2 usb.ids util-linux uuid-runtime 356s vim-common vim-tiny wget xxd xz-utils zlib1g 356s 247 upgraded, 73 newly installed, 28 to remove and 0 not upgraded. 356s Need to get 389 MB of archives. 356s After this operation, 640 MB of additional disk space will be used. 356s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el motd-news-config all 13ubuntu8 [5098 B] 356s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el base-files ppc64el 13ubuntu8 [74.5 kB] 356s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bsdutils ppc64el 1:2.39.3-9ubuntu2 [98.3 kB] 356s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el coreutils ppc64el 9.4-3ubuntu3 [1523 kB] 356s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libudisks2-0 ppc64el 2.10.1-6 [182 kB] 356s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el udisks2 ppc64el 2.10.1-6 [344 kB] 357s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el shared-mime-info ppc64el 2.4-1build1 [481 kB] 357s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gir1.2-girepository-2.0 ppc64el 1.79.1-1ubuntu6 [24.8 kB] 357s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gir1.2-glib-2.0 ppc64el 2.79.3-3ubuntu5 [182 kB] 357s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgirepository-1.0-1 ppc64el 1.79.1-1ubuntu6 [93.8 kB] 357s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-gi ppc64el 3.47.0-3build1 [261 kB] 357s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-dbus ppc64el 1.3.2-5build2 [107 kB] 357s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnetplan1 ppc64el 1.0-1 [136 kB] 357s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-netplan ppc64el 1.0-1 [21.8 kB] 357s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el netplan-generator ppc64el 1.0-1 [59.2 kB] 357s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el initramfs-tools-bin ppc64el 0.142ubuntu23 [21.0 kB] 357s Get:17 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el initramfs-tools-core all 0.142ubuntu23 [50.1 kB] 357s Get:18 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el initramfs-tools all 0.142ubuntu23 [9058 B] 357s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el netplan.io ppc64el 1.0-1 [66.2 kB] 357s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libxmlb2 ppc64el 0.3.15-1build1 [82.6 kB] 357s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgpgme11t64 ppc64el 1.18.0-4.1ubuntu3 [173 kB] 357s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libvolume-key1 ppc64el 0.3.12-7build1 [47.9 kB] 357s Get:23 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libqrtr-glib0 ppc64el 1.2.2-1ubuntu3 [18.3 kB] 357s Get:24 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libqmi-glib5 ppc64el 1.35.2-0ubuntu1 [966 kB] 357s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libqmi-proxy ppc64el 1.35.2-0ubuntu1 [6208 B] 357s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpolkit-agent-1-0 ppc64el 124-1ubuntu1 [18.8 kB] 357s Get:27 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpolkit-gobject-1-0 ppc64el 124-1ubuntu1 [52.7 kB] 357s Get:28 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmm-glib0 ppc64el 1.23.4-0ubuntu1 [282 kB] 357s Get:29 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmbim-glib4 ppc64el 1.31.2-0ubuntu2 [253 kB] 357s Get:30 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmbim-proxy ppc64el 1.31.2-0ubuntu2 [6274 B] 357s Get:31 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libjson-glib-1.0-common all 1.8.0-2build1 [4210 B] 357s Get:32 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libjson-glib-1.0-0 ppc64el 1.8.0-2build1 [73.6 kB] 357s Get:33 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgusb2 ppc64el 0.4.8-1build1 [43.0 kB] 357s Get:34 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgudev-1.0-0 ppc64el 1:238-3ubuntu2 [15.8 kB] 357s Get:35 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el tnftp ppc64el 20230507-2build1 [116 kB] 357s Get:36 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el tcpdump ppc64el 4.99.4-3ubuntu2 [543 kB] 357s Get:37 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsystemd0 ppc64el 255.4-1ubuntu5 [526 kB] 357s Get:38 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el systemd-dev all 255.4-1ubuntu5 [103 kB] 357s Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnss-systemd ppc64el 255.4-1ubuntu5 [208 kB] 357s Get:40 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libudev1 ppc64el 255.4-1ubuntu5 [200 kB] 357s Get:41 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libssl3t64 ppc64el 3.0.13-0ubuntu2 [2125 kB] 357s Get:42 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el systemd ppc64el 255.4-1ubuntu5 [3771 kB] 358s Get:43 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el udev ppc64el 255.4-1ubuntu5 [2038 kB] 358s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el systemd-sysv ppc64el 255.4-1ubuntu5 [11.9 kB] 358s Get:45 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpam-systemd ppc64el 255.4-1ubuntu5 [304 kB] 358s Get:46 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el systemd-timesyncd ppc64el 255.4-1ubuntu5 [37.9 kB] 358s Get:47 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsystemd-shared ppc64el 255.4-1ubuntu5 [2351 kB] 358s Get:48 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el systemd-resolved ppc64el 255.4-1ubuntu5 [346 kB] 358s Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el sudo ppc64el 1.9.15p5-3ubuntu3 [1005 kB] 359s Get:50 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el rsync ppc64el 3.2.7-1build1 [487 kB] 359s Get:51 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-cryptography ppc64el 41.0.7-4build2 [860 kB] 359s Get:52 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssl ppc64el 3.0.13-0ubuntu2 [1026 kB] 359s Get:53 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssh-sftp-server ppc64el 1:9.6p1-3ubuntu11 [43.7 kB] 359s Get:54 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssh-client ppc64el 1:9.6p1-3ubuntu11 [1112 kB] 359s Get:55 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssh-server ppc64el 1:9.6p1-3ubuntu11 [627 kB] 359s Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libssh-4 ppc64el 0.10.6-2build1 [234 kB] 359s Get:57 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsasl2-modules ppc64el 2.1.28+dfsg1-5ubuntu1 [83.1 kB] 359s Get:58 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3.12 ppc64el 3.12.2-4build3 [645 kB] 359s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3.12-minimal ppc64el 3.12.2-4build3 [2447 kB] 359s Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpython3.12-minimal ppc64el 3.12.2-4build3 [836 kB] 359s Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el grub-ieee1275 ppc64el 2.12-1ubuntu5 [63.1 kB] 359s Get:62 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el grub2-common ppc64el 2.12-1ubuntu5 [752 kB] 360s Get:63 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el grub-common ppc64el 2.12-1ubuntu5 [2356 kB] 360s Get:64 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el grub-ieee1275-bin ppc64el 2.12-1ubuntu5 [687 kB] 360s Get:65 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libparted2t64 ppc64el 3.6-3.1build2 [184 kB] 360s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el parted ppc64el 3.6-3.1build2 [58.9 kB] 360s Get:67 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3.11 ppc64el 3.11.8-1build4 [589 kB] 360s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3.11-minimal ppc64el 3.11.8-1build4 [2292 kB] 360s Get:69 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpython3.11-minimal ppc64el 3.11.8-1build4 [846 kB] 360s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpython3.11-stdlib ppc64el 3.11.8-1build4 [1977 kB] 360s Get:71 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gnupg-utils ppc64el 2.4.4-2ubuntu15 [123 kB] 360s Get:72 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpg-agent ppc64el 2.4.4-2ubuntu15 [275 kB] 361s Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpg-wks-client ppc64el 2.4.4-2ubuntu15 [85.0 kB] 361s Get:74 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpg ppc64el 2.4.4-2ubuntu15 [706 kB] 361s Get:75 http://ftpmaster.internal/ubuntu noble/main ppc64el libnpth0t64 ppc64el 1.6-3.1 [8864 B] 361s Get:76 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpgv ppc64el 2.4.4-2ubuntu15 [198 kB] 361s Get:77 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dirmngr ppc64el 2.4.4-2ubuntu15 [391 kB] 361s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gnupg all 2.4.4-2ubuntu15 [359 kB] 361s Get:79 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el keyboxd ppc64el 2.4.4-2ubuntu15 [94.3 kB] 361s Get:80 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpgconf ppc64el 2.4.4-2ubuntu15 [115 kB] 361s Get:81 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gpgsm ppc64el 2.4.4-2ubuntu15 [292 kB] 361s Get:82 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libreadline8t64 ppc64el 8.2-4 [182 kB] 361s Get:83 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gawk ppc64el 1:5.2.1-2build2 [528 kB] 361s Get:84 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el fdisk ppc64el 2.39.3-9ubuntu2 [132 kB] 361s Get:85 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bc ppc64el 1.07.1-3ubuntu2 [93.2 kB] 361s Get:86 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpython3.12-stdlib ppc64el 3.12.2-4build3 [2082 kB] 361s Get:87 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-base ppc64el 5.38.2-3.2 [1916 kB] 361s Get:88 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 362s Get:89 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-gdbm ppc64el 3.12.2-3ubuntu1.1 [19.8 kB] 362s Get:90 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el man-db ppc64el 2.12.0-3build4 [1274 kB] 362s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm6t64 ppc64el 1.23-5.1 [41.9 kB] 362s Get:92 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgdbm-compat4t64 ppc64el 1.23-5.1 [6972 B] 362s Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libperl5.38t64 ppc64el 5.38.2-3.2 [4957 kB] 362s Get:94 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el perl ppc64el 5.38.2-3.2 [231 kB] 362s Get:95 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdb5.3t64 ppc64el 5.3.28+dfsg2-6 [875 kB] 362s Get:96 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsasl2-modules-db ppc64el 2.1.28+dfsg1-5ubuntu1 [23.4 kB] 362s Get:97 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsasl2-2 ppc64el 2.1.28+dfsg1-5ubuntu1 [68.0 kB] 362s Get:98 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnvme1t64 ppc64el 1.8-3 [98.2 kB] 362s Get:99 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el wget ppc64el 1.21.4-1ubuntu2 [382 kB] 362s Get:100 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libcurl4t64 ppc64el 8.5.0-2ubuntu8 [428 kB] 362s Get:101 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el curl ppc64el 8.5.0-2ubuntu8 [234 kB] 363s Get:102 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpsl5t64 ppc64el 0.21.2-1.1 [59.0 kB] 363s Get:103 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libarchive13t64 ppc64el 3.7.2-1.1ubuntu2 [518 kB] 363s Get:104 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el fwupd ppc64el 1.9.15-2 [4634 kB] 364s Get:105 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libcurl3t64-gnutls ppc64el 8.5.0-2ubuntu8 [419 kB] 364s Get:106 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libfwupd2 ppc64el 1.9.15-2 [136 kB] 364s Get:107 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev3 ppc64el 3.1.0-1build1 [55.2 kB] 364s Get:108 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-utils3 ppc64el 3.1.0-1build1 [20.3 kB] 364s Get:109 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-swap3 ppc64el 3.1.0-1build1 [8616 B] 364s Get:110 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-part3 ppc64el 3.1.0-1build1 [17.5 kB] 364s Get:111 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-nvme3 ppc64el 3.1.0-1build1 [20.1 kB] 364s Get:112 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-mdraid3 ppc64el 3.1.0-1build1 [14.3 kB] 364s Get:113 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-loop3 ppc64el 3.1.0-1build1 [7742 B] 364s Get:114 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el e2fsprogs-l10n all 1.47.0-2.4~exp1ubuntu2 [5996 B] 364s Get:115 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el logsave ppc64el 1.47.0-2.4~exp1ubuntu2 [22.9 kB] 364s Get:116 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libext2fs2t64 ppc64el 1.47.0-2.4~exp1ubuntu2 [270 kB] 364s Get:117 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el e2fsprogs ppc64el 1.47.0-2.4~exp1ubuntu2 [663 kB] 365s Get:118 http://ftpmaster.internal/ubuntu noble/main ppc64el libreiserfscore0t64 ppc64el 1:3.6.27-7.1 [92.7 kB] 365s Get:119 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el btrfs-progs ppc64el 6.6.3-1.1build1 [1352 kB] 365s Get:120 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-fs3 ppc64el 3.1.0-1build1 [41.2 kB] 365s Get:121 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblockdev-crypto3 ppc64el 3.1.0-1build1 [22.5 kB] 365s Get:122 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bolt ppc64el 0.9.6-2build1 [171 kB] 365s Get:123 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libglib2.0-0t64 ppc64el 2.79.3-3ubuntu5 [1773 kB] 365s Get:124 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libjcat1 ppc64el 0.2.0-2build2 [40.0 kB] 365s Get:125 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libldap2 ppc64el 2.6.7+dfsg-1~exp1ubuntu6 [233 kB] 365s Get:126 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el ubuntu-pro-client-l10n ppc64el 31.2.2 [19.4 kB] 365s Get:127 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el ubuntu-pro-client ppc64el 31.2.2 [215 kB] 365s Get:128 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-apt ppc64el 2.7.7 [181 kB] 365s Get:129 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el apt-utils ppc64el 2.7.14 [226 kB] 365s Get:130 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libapt-pkg6.0t64 ppc64el 2.7.14 [1063 kB] 365s Get:131 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnettle8t64 ppc64el 3.9.1-2.2 [226 kB] 365s Get:132 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libhogweed6t64 ppc64el 3.9.1-2.2 [208 kB] 365s Get:133 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgnutls30t64 ppc64el 3.8.3-1.1ubuntu2 [1154 kB] 365s Get:134 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el apt ppc64el 2.7.14 [1401 kB] 365s Get:135 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el librtmp1 ppc64el 2.4+20151223.gitfa8646d.1-2build6 [64.4 kB] 365s Get:136 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el liblzma5 ppc64el 5.6.0-0.2 [156 kB] 365s Get:137 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libblkid1 ppc64el 2.39.3-9ubuntu2 [155 kB] 365s Get:138 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el kmod ppc64el 31+20240202-2ubuntu4 [122 kB] 365s Get:139 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libkmod2 ppc64el 31+20240202-2ubuntu4 [64.4 kB] 365s Get:140 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libselinux1 ppc64el 3.5-2ubuntu1 [101 kB] 365s Get:141 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libaudit-common all 1:3.1.2-2.1 [5674 B] 365s Get:142 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libcap-ng0 ppc64el 0.8.4-2build1 [16.2 kB] 365s Get:143 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libaudit1 ppc64el 1:3.1.2-2.1 [52.8 kB] 365s Get:144 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpam0g ppc64el 1.5.3-5ubuntu3 [75.7 kB] 366s Get:145 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpam-modules-bin ppc64el 1.5.3-5ubuntu3 [57.9 kB] 366s Get:146 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpam-modules ppc64el 1.5.3-5ubuntu3 [320 kB] 366s Get:147 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpam-runtime all 1.5.3-5ubuntu3 [40.8 kB] 366s Get:148 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus-session-bus-common all 1.14.10-4ubuntu2 [80.3 kB] 366s Get:149 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus-user-session ppc64el 1.14.10-4ubuntu2 [9960 B] 366s Get:150 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libapparmor1 ppc64el 4.0.0-beta3-0ubuntu2 [55.0 kB] 366s Get:151 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libexpat1 ppc64el 2.6.1-2 [101 kB] 366s Get:152 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus-system-bus-common all 1.14.10-4ubuntu2 [81.5 kB] 366s Get:153 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus-bin ppc64el 1.14.10-4ubuntu2 [48.1 kB] 366s Get:154 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus ppc64el 1.14.10-4ubuntu2 [26.9 kB] 366s Get:155 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dbus-daemon ppc64el 1.14.10-4ubuntu2 [136 kB] 366s Get:156 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdbus-1-3 ppc64el 1.14.10-4ubuntu2 [244 kB] 366s Get:157 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdevmapper1.02.1 ppc64el 2:1.02.185-3ubuntu2 [182 kB] 366s Get:158 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libuuid1 ppc64el 2.39.3-9ubuntu2 [39.3 kB] 366s Get:159 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libcryptsetup12 ppc64el 2:2.7.0-1ubuntu2 [376 kB] 366s Get:160 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libfdisk1 ppc64el 2.39.3-9ubuntu2 [171 kB] 366s Get:161 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libseccomp2 ppc64el 2.5.5-1ubuntu2 [62.5 kB] 366s Get:162 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el mount ppc64el 2.39.3-9ubuntu2 [125 kB] 366s Get:163 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmount1 ppc64el 2.39.3-9ubuntu2 [169 kB] 366s Get:164 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el zlib1g ppc64el 1:1.3.dfsg-3.1ubuntu1 [72.8 kB] 366s Get:165 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-minimal ppc64el 3.12.2-0ubuntu1 [27.1 kB] 366s Get:166 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3 ppc64el 3.12.2-0ubuntu1 [24.1 kB] 366s Get:167 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libplymouth5 ppc64el 24.004.60-1ubuntu6 [166 kB] 366s Get:168 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpng16-16t64 ppc64el 1.6.43-3 [242 kB] 366s Get:169 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libbrotli1 ppc64el 1.1.0-2build1 [410 kB] 366s Get:170 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libfreetype6 ppc64el 2.13.2+dfsg-1build2 [545 kB] 366s Get:171 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsqlite3-0 ppc64el 3.45.1-1ubuntu1 [804 kB] 366s Get:172 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el pinentry-curses ppc64el 1.2.1-3ubuntu4 [38.7 kB] 366s Get:173 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gcc-14-base ppc64el 14-20240315-1ubuntu1 [47.0 kB] 366s Get:174 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgcc-s1 ppc64el 14-20240315-1ubuntu1 [39.2 kB] 366s Get:175 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libstdc++6 ppc64el 14-20240315-1ubuntu1 [897 kB] 366s Get:176 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python-apt-common all 2.7.7 [19.8 kB] 366s Get:177 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsmartcols1 ppc64el 2.39.3-9ubuntu2 [79.0 kB] 366s Get:178 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el readline-common all 8.2-4 [56.4 kB] 366s Get:179 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bsdextrautils ppc64el 2.39.3-9ubuntu2 [78.6 kB] 366s Get:180 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el groff-base ppc64el 1.23.0-3build1 [1112 kB] 366s Get:181 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libpython3-stdlib ppc64el 3.12.2-0ubuntu1 [9798 B] 366s Get:182 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libfido2-1 ppc64el 1.14.0-1build1 [111 kB] 366s Get:183 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgssapi-krb5-2 ppc64el 1.20.1-6ubuntu1 [185 kB] 366s Get:184 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libkrb5-3 ppc64el 1.20.1-6ubuntu1 [432 kB] 366s Get:185 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libkrb5support0 ppc64el 1.20.1-6ubuntu1 [38.5 kB] 366s Get:186 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libk5crypto3 ppc64el 1.20.1-6ubuntu1 [108 kB] 366s Get:187 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libcom-err2 ppc64el 1.47.0-2.4~exp1ubuntu2 [22.9 kB] 366s Get:188 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libproc2-0 ppc64el 2:4.0.4-4ubuntu2 [68.8 kB] 366s Get:189 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el procps ppc64el 2:4.0.4-4ubuntu2 [736 kB] 366s Get:190 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnghttp2-14 ppc64el 1.59.0-1build1 [89.0 kB] 366s Get:191 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dpkg ppc64el 1.22.6ubuntu4 [1342 kB] 366s Get:192 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el util-linux ppc64el 2.39.3-9ubuntu2 [1195 kB] 366s Get:193 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libxml2 ppc64el 2.9.14+dfsg-1.3ubuntu2 [840 kB] 366s Get:194 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libbpf1 ppc64el 1:1.3.0-2build1 [216 kB] 366s Get:195 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el iproute2 ppc64el 6.1.0-1ubuntu5 [1384 kB] 366s Get:196 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libelf1t64 ppc64el 0.190-1.1build2 [69.3 kB] 366s Get:197 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dhcpcd-base ppc64el 1:10.0.6-1ubuntu2 [276 kB] 367s Get:198 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el file ppc64el 1:5.45-3 [22.7 kB] 367s Get:199 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmagic-mgc ppc64el 1:5.45-3 [307 kB] 367s Get:200 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libmagic1t64 ppc64el 1:5.45-3 [106 kB] 367s Get:201 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libtirpc-common all 1.3.4+ds-1.1 [8018 B] 367s Get:202 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el lsof ppc64el 4.95.0-1build2 [256 kB] 367s Get:203 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libnsl2 ppc64el 1.3.0-3build2 [48.9 kB] 368s Get:204 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libtirpc3t64 ppc64el 1.3.4+ds-1.1 [102 kB] 368s Get:205 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el multipath-tools ppc64el 0.9.4-5ubuntu6 [341 kB] 369s Get:206 http://ftpmaster.internal/ubuntu noble/main ppc64el liburcu8t64 ppc64el 0.14.0-3.1 [73.6 kB] 369s Get:207 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bind9-host ppc64el 1:9.18.24-0ubuntu3 [54.5 kB] 369s Get:208 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bind9-dnsutils ppc64el 1:9.18.24-0ubuntu3 [167 kB] 369s Get:209 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el bind9-libs ppc64el 1:9.18.24-0ubuntu3 [1436 kB] 371s Get:210 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libuv1t64 ppc64el 1.48.0-1.1 [117 kB] 371s Get:211 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el liblocale-gettext-perl ppc64el 1.07-6ubuntu4 [16.1 kB] 371s Get:212 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el uuid-runtime ppc64el 2.39.3-9ubuntu2 [33.8 kB] 371s Get:213 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdebconfclient0 ppc64el 0.271ubuntu2 [11.2 kB] 371s Get:214 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsemanage-common all 3.5-1build4 [10.1 kB] 371s Get:215 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsemanage2 ppc64el 3.5-1build4 [115 kB] 371s Get:216 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el install-info ppc64el 7.1-3build1 [64.5 kB] 371s Get:217 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gcc-13-base ppc64el 13.2.0-21ubuntu1 [48.3 kB] 371s Get:218 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libss2 ppc64el 1.47.0-2.4~exp1ubuntu2 [18.0 kB] 371s Get:219 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dmsetup ppc64el 2:1.02.185-3ubuntu2 [91.8 kB] 371s Get:220 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el eject ppc64el 2.39.3-9ubuntu2 [28.2 kB] 371s Get:221 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el krb5-locales all 1.20.1-6ubuntu1 [13.8 kB] 371s Get:222 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libglib2.0-data all 2.79.3-3ubuntu5 [46.6 kB] 371s Get:223 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libslang2 ppc64el 2.3.3-3build1 [501 kB] 371s Get:224 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libtext-charwidth-perl ppc64el 0.04-11build2 [9506 B] 371s Get:225 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libtext-iconv-perl ppc64el 1.7-8build2 [13.7 kB] 371s Get:226 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-yaml ppc64el 6.0.1-2build1 [123 kB] 371s Get:227 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-setuptools all 68.1.2-2ubuntu1 [396 kB] 371s Get:228 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-pkg-resources all 68.1.2-2ubuntu1 [168 kB] 371s Get:229 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el rsyslog ppc64el 8.2312.0-3ubuntu7 [629 kB] 371s Get:230 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el vim-tiny ppc64el 2:9.1.0016-1ubuntu6 [1042 kB] 371s Get:231 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el vim-common all 2:9.1.0016-1ubuntu6 [385 kB] 371s Get:232 http://ftpmaster.internal/ubuntu noble/main ppc64el xdg-user-dirs ppc64el 0.18-1 [20.0 kB] 371s Get:233 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el xxd ppc64el 2:9.1.0016-1ubuntu6 [63.7 kB] 371s Get:234 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el apparmor ppc64el 4.0.0-beta3-0ubuntu2 [747 kB] 372s Get:235 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el ftp all 20230507-2build1 [4724 B] 372s Get:236 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el inetutils-telnet ppc64el 2:2.5-3ubuntu3 [115 kB] 372s Get:237 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el info ppc64el 7.1-3build1 [188 kB] 372s Get:238 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libusb-1.0-0 ppc64el 2:1.0.27-1 [64.0 kB] 372s Get:239 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libxmuu1 ppc64el 2:1.1.3-3build1 [9488 B] 372s Get:240 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el lshw ppc64el 02.19.git.2021.06.19.996aaad9c7-2build2 [334 kB] 372s Get:241 http://ftpmaster.internal/ubuntu noble/main ppc64el manpages all 6.05.01-1 [1340 kB] 372s Get:242 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el mtr-tiny ppc64el 0.95-1.1build1 [62.8 kB] 372s Get:243 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el plymouth-theme-ubuntu-text ppc64el 24.004.60-1ubuntu6 [11.1 kB] 372s Get:244 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el plymouth ppc64el 24.004.60-1ubuntu6 [155 kB] 372s Get:245 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el telnet all 0.17+2.5-3ubuntu3 [3682 B] 372s Get:246 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el usb.ids all 2024.03.18-1 [223 kB] 372s Get:247 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el xz-utils ppc64el 5.6.0-0.2 [281 kB] 372s Get:248 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libctf0 ppc64el 2.42-4ubuntu1 [112 kB] 372s Get:249 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libctf-nobfd0 ppc64el 2.42-4ubuntu1 [112 kB] 372s Get:250 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el binutils-powerpc64le-linux-gnu ppc64el 2.42-4ubuntu1 [2473 kB] 373s Get:251 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libbinutils ppc64el 2.42-4ubuntu1 [699 kB] 373s Get:252 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el binutils ppc64el 2.42-4ubuntu1 [3078 B] 373s Get:253 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el binutils-common ppc64el 2.42-4ubuntu1 [217 kB] 373s Get:254 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsframe1 ppc64el 2.42-4ubuntu1 [16.0 kB] 373s Get:255 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libllvm18 ppc64el 1:18.1.2-1ubuntu2 [28.9 MB] 380s Get:256 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libclang-cpp18 ppc64el 1:18.1.2-1ubuntu2 [14.6 MB] 384s Get:257 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el libbpfcc ppc64el 0.29.1+ds-1ubuntu4 [707 kB] 384s Get:258 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el python3-bpfcc all 0.29.1+ds-1ubuntu4 [40.2 kB] 384s Get:259 http://ftpmaster.internal/ubuntu noble/main ppc64el ieee-data all 20220827.1 [2113 kB] 385s Get:260 http://ftpmaster.internal/ubuntu noble/main ppc64el python3-netaddr all 0.8.0-2ubuntu1 [319 kB] 385s Get:261 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el bpfcc-tools all 0.29.1+ds-1ubuntu4 [687 kB] 385s Get:262 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libclang1-18 ppc64el 1:18.1.2-1ubuntu2 [8725 kB] 388s Get:263 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdw1t64 ppc64el 0.190-1.1build2 [301 kB] 388s Get:264 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el bpftrace ppc64el 0.20.2-1ubuntu1 [1058 kB] 388s Get:265 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el cryptsetup-bin ppc64el 2:2.7.0-1ubuntu2 [227 kB] 388s Get:266 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el dpkg-dev all 1.22.6ubuntu4 [1074 kB] 389s Get:267 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libdpkg-perl all 1.22.6ubuntu4 [268 kB] 389s Get:268 http://ftpmaster.internal/ubuntu noble/main ppc64el fonts-dejavu-mono all 2.37-8 [502 kB] 389s Get:269 http://ftpmaster.internal/ubuntu noble/main ppc64el fonts-dejavu-core all 2.37-8 [835 kB] 389s Get:270 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el fontconfig-config ppc64el 2.15.0-1.1ubuntu1 [37.4 kB] 389s Get:271 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libprotobuf-c1 ppc64el 1.4.1-1ubuntu3 [25.9 kB] 389s Get:272 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el gnupg-l10n all 2.4.4-2ubuntu15 [65.8 kB] 389s Get:273 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libibverbs1 ppc64el 50.0-2build1 [74.4 kB] 389s Get:274 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el ibverbs-providers ppc64el 50.0-2build1 [420 kB] 389s Get:275 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el jq ppc64el 1.7.1-3 [66.1 kB] 389s Get:276 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libjq1 ppc64el 1.7.1-3 [173 kB] 389s Get:277 http://ftpmaster.internal/ubuntu noble/main ppc64el libaio1t64 ppc64el 0.3.113-6 [8188 B] 389s Get:278 http://ftpmaster.internal/ubuntu noble/main ppc64el libatm1t64 ppc64el 1:2.5.1-5.1 [26.9 kB] 389s Get:279 http://ftpmaster.internal/ubuntu noble/main ppc64el libc-dev-bin ppc64el 2.39-0ubuntu6 [21.3 kB] 389s Get:280 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libfontconfig1 ppc64el 2.15.0-1.1ubuntu1 [190 kB] 389s Get:281 http://ftpmaster.internal/ubuntu noble/main ppc64el libjpeg-turbo8 ppc64el 2.1.5-2ubuntu1 [212 kB] 389s Get:282 http://ftpmaster.internal/ubuntu noble/main ppc64el libjpeg8 ppc64el 8c-2ubuntu11 [2148 B] 389s Get:283 http://ftpmaster.internal/ubuntu noble/main ppc64el libdeflate0 ppc64el 1.19-1 [61.9 kB] 389s Get:284 http://ftpmaster.internal/ubuntu noble/main ppc64el libjbig0 ppc64el 2.1-6.1ubuntu1 [34.7 kB] 389s Get:285 http://ftpmaster.internal/ubuntu noble/main ppc64el liblerc4 ppc64el 4.0.0+ds-4ubuntu1 [266 kB] 389s Get:286 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libsharpyuv0 ppc64el 1.3.2-0.4build2 [28.8 kB] 389s Get:287 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libwebp7 ppc64el 1.3.2-0.4build2 [312 kB] 389s Get:288 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libtiff6 ppc64el 4.5.1+git230720-4ubuntu1 [274 kB] 389s Get:289 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libxpm4 ppc64el 1:3.5.17-1build1 [50.2 kB] 389s Get:290 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libgd3 ppc64el 2.3.3-9ubuntu3 [162 kB] 390s Get:291 http://ftpmaster.internal/ubuntu noble/main ppc64el libc-devtools ppc64el 2.39-0ubuntu6 [29.6 kB] 390s Get:292 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-libc-dev ppc64el 6.8.0-20.20 [1586 kB] 390s Get:293 http://ftpmaster.internal/ubuntu noble/main ppc64el libcrypt-dev ppc64el 1:4.4.36-4 [167 kB] 390s Get:294 http://ftpmaster.internal/ubuntu noble/main ppc64el rpcsvc-proto ppc64el 1.4.2-0ubuntu6 [82.3 kB] 390s Get:295 http://ftpmaster.internal/ubuntu noble/main ppc64el libc6-dev ppc64el 2.39-0ubuntu6 [2102 kB] 391s Get:296 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libevent-core-2.1-7 ppc64el 2.1.12-stable-9build1 [110 kB] 391s Get:297 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libftdi1-2 ppc64el 1.5-6build4 [32.5 kB] 391s Get:298 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libldap-common all 2.6.7+dfsg-1~exp1ubuntu6 [31.3 kB] 391s Get:299 http://ftpmaster.internal/ubuntu noble/main ppc64el libunwind8 ppc64el 1.6.2-3 [59.9 kB] 391s Get:300 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-modules-6.8.0-20-generic ppc64el 6.8.0-20.20 [31.3 MB] 395s Get:301 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-image-6.8.0-20-generic ppc64el 6.8.0-20.20 [63.9 MB] 400s Get:302 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-modules-extra-6.8.0-20-generic ppc64el 6.8.0-20.20 [103 MB] 406s Get:303 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-generic ppc64el 6.8.0-20.20+1 [1734 B] 406s Get:304 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-image-generic ppc64el 6.8.0-20.20+1 [9698 B] 406s Get:305 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-virtual ppc64el 6.8.0-20.20+1 [1686 B] 406s Get:306 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-image-virtual ppc64el 6.8.0-20.20+1 [9702 B] 406s Get:307 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-headers-virtual ppc64el 6.8.0-20.20+1 [1648 B] 406s Get:308 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-headers-6.8.0-20 all 6.8.0-20.20 [13.6 MB] 413s Get:309 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-headers-6.8.0-20-generic ppc64el 6.8.0-20.20 [3728 kB] 415s Get:310 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-headers-generic ppc64el 6.8.0-20.20+1 [9612 B] 415s Get:311 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-tools-common all 6.8.0-20.20 [437 kB] 415s Get:312 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-tools-6.8.0-20 ppc64el 6.8.0-20.20 [2924 kB] 416s Get:313 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el linux-tools-6.8.0-20-generic ppc64el 6.8.0-20.20 [1730 B] 416s Get:314 http://ftpmaster.internal/ubuntu noble/main ppc64el manpages-dev all 6.05.01-1 [2018 kB] 417s Get:315 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-distutils all 3.12.2-3ubuntu1.1 [133 kB] 417s Get:316 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-lib2to3 all 3.12.2-3ubuntu1.1 [79.1 kB] 417s Get:317 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-pyrsistent ppc64el 0.20.0-1build1 [60.4 kB] 417s Get:318 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el python3-typing-extensions all 4.10.0-1 [60.7 kB] 417s Get:319 http://ftpmaster.internal/ubuntu noble/main ppc64el ubuntu-kernel-accessories ppc64el 1.536build1 [10.5 kB] 417s Get:320 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el kpartx ppc64el 0.9.4-5ubuntu6 [34.4 kB] 417s Preconfiguring packages ... 418s Fetched 389 MB in 1min 1s (6384 kB/s) 418s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70153 files and directories currently installed.) 418s Preparing to unpack .../motd-news-config_13ubuntu8_all.deb ... 418s Unpacking motd-news-config (13ubuntu8) over (13ubuntu7) ... 418s Preparing to unpack .../base-files_13ubuntu8_ppc64el.deb ... 418s Unpacking base-files (13ubuntu8) over (13ubuntu7) ... 418s Setting up base-files (13ubuntu8) ... 419s motd-news.service is a disabled or a static unit not running, not starting it. 419s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70153 files and directories currently installed.) 419s Preparing to unpack .../bsdutils_1%3a2.39.3-9ubuntu2_ppc64el.deb ... 419s Unpacking bsdutils (1:2.39.3-9ubuntu2) over (1:2.39.3-6ubuntu2) ... 419s Setting up bsdutils (1:2.39.3-9ubuntu2) ... 419s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70153 files and directories currently installed.) 419s Preparing to unpack .../coreutils_9.4-3ubuntu3_ppc64el.deb ... 419s Unpacking coreutils (9.4-3ubuntu3) over (9.4-2ubuntu4) ... 419s Setting up coreutils (9.4-3ubuntu3) ... 419s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70153 files and directories currently installed.) 419s Preparing to unpack .../00-libudisks2-0_2.10.1-6_ppc64el.deb ... 419s Unpacking libudisks2-0:ppc64el (2.10.1-6) over (2.10.1-1ubuntu2) ... 419s Preparing to unpack .../01-udisks2_2.10.1-6_ppc64el.deb ... 419s Unpacking udisks2 (2.10.1-6) over (2.10.1-1ubuntu2) ... 419s Preparing to unpack .../02-shared-mime-info_2.4-1build1_ppc64el.deb ... 419s Unpacking shared-mime-info (2.4-1build1) over (2.4-1) ... 419s Preparing to unpack .../03-gir1.2-girepository-2.0_1.79.1-1ubuntu6_ppc64el.deb ... 419s Unpacking gir1.2-girepository-2.0:ppc64el (1.79.1-1ubuntu6) over (1.79.1-1) ... 419s Preparing to unpack .../04-gir1.2-glib-2.0_2.79.3-3ubuntu5_ppc64el.deb ... 419s Unpacking gir1.2-glib-2.0:ppc64el (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 419s Preparing to unpack .../05-libgirepository-1.0-1_1.79.1-1ubuntu6_ppc64el.deb ... 419s Unpacking libgirepository-1.0-1:ppc64el (1.79.1-1ubuntu6) over (1.79.1-1) ... 419s Preparing to unpack .../06-python3-gi_3.47.0-3build1_ppc64el.deb ... 419s Unpacking python3-gi (3.47.0-3build1) over (3.47.0-3) ... 419s Preparing to unpack .../07-python3-dbus_1.3.2-5build2_ppc64el.deb ... 419s Unpacking python3-dbus (1.3.2-5build2) over (1.3.2-5build1) ... 419s Selecting previously unselected package libnetplan1:ppc64el. 419s Preparing to unpack .../08-libnetplan1_1.0-1_ppc64el.deb ... 419s Unpacking libnetplan1:ppc64el (1.0-1) ... 419s Preparing to unpack .../09-python3-netplan_1.0-1_ppc64el.deb ... 419s Unpacking python3-netplan (1.0-1) over (0.107.1-3) ... 419s Preparing to unpack .../10-netplan-generator_1.0-1_ppc64el.deb ... 419s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 419s Unpacking netplan-generator (1.0-1) over (0.107.1-3) ... 419s Preparing to unpack .../11-initramfs-tools-bin_0.142ubuntu23_ppc64el.deb ... 419s Unpacking initramfs-tools-bin (0.142ubuntu23) over (0.142ubuntu20) ... 420s Preparing to unpack .../12-initramfs-tools-core_0.142ubuntu23_all.deb ... 420s Unpacking initramfs-tools-core (0.142ubuntu23) over (0.142ubuntu20) ... 420s Preparing to unpack .../13-initramfs-tools_0.142ubuntu23_all.deb ... 420s Unpacking initramfs-tools (0.142ubuntu23) over (0.142ubuntu20) ... 420s Preparing to unpack .../14-netplan.io_1.0-1_ppc64el.deb ... 420s Unpacking netplan.io (1.0-1) over (0.107.1-3) ... 420s Preparing to unpack .../15-libxmlb2_0.3.15-1build1_ppc64el.deb ... 420s Unpacking libxmlb2:ppc64el (0.3.15-1build1) over (0.3.15-1) ... 420s dpkg: libgpgme11:ppc64el: dependency problems, but removing anyway as you requested: 420s libvolume-key1:ppc64el depends on libgpgme11 (>= 1.4.1). 420s libjcat1:ppc64el depends on libgpgme11 (>= 1.2.0). 420s 420s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70157 files and directories currently installed.) 420s Removing libgpgme11:ppc64el (1.18.0-4ubuntu1) ... 420s Selecting previously unselected package libgpgme11t64:ppc64el. 420s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70151 files and directories currently installed.) 420s Preparing to unpack .../00-libgpgme11t64_1.18.0-4.1ubuntu3_ppc64el.deb ... 420s Unpacking libgpgme11t64:ppc64el (1.18.0-4.1ubuntu3) ... 420s Preparing to unpack .../01-libvolume-key1_0.3.12-7build1_ppc64el.deb ... 420s Unpacking libvolume-key1:ppc64el (0.3.12-7build1) over (0.3.12-5build2) ... 420s Preparing to unpack .../02-libqrtr-glib0_1.2.2-1ubuntu3_ppc64el.deb ... 420s Unpacking libqrtr-glib0:ppc64el (1.2.2-1ubuntu3) over (1.2.2-1ubuntu2) ... 420s Preparing to unpack .../03-libqmi-glib5_1.35.2-0ubuntu1_ppc64el.deb ... 420s Unpacking libqmi-glib5:ppc64el (1.35.2-0ubuntu1) over (1.34.0-2) ... 420s Preparing to unpack .../04-libqmi-proxy_1.35.2-0ubuntu1_ppc64el.deb ... 420s Unpacking libqmi-proxy (1.35.2-0ubuntu1) over (1.34.0-2) ... 420s Preparing to unpack .../05-libpolkit-agent-1-0_124-1ubuntu1_ppc64el.deb ... 420s Unpacking libpolkit-agent-1-0:ppc64el (124-1ubuntu1) over (124-1) ... 420s Preparing to unpack .../06-libpolkit-gobject-1-0_124-1ubuntu1_ppc64el.deb ... 420s Unpacking libpolkit-gobject-1-0:ppc64el (124-1ubuntu1) over (124-1) ... 420s Preparing to unpack .../07-libmm-glib0_1.23.4-0ubuntu1_ppc64el.deb ... 420s Unpacking libmm-glib0:ppc64el (1.23.4-0ubuntu1) over (1.22.0-3) ... 420s Preparing to unpack .../08-libmbim-glib4_1.31.2-0ubuntu2_ppc64el.deb ... 420s Unpacking libmbim-glib4:ppc64el (1.31.2-0ubuntu2) over (1.30.0-1) ... 420s Preparing to unpack .../09-libmbim-proxy_1.31.2-0ubuntu2_ppc64el.deb ... 420s Unpacking libmbim-proxy (1.31.2-0ubuntu2) over (1.30.0-1) ... 420s Preparing to unpack .../10-libjson-glib-1.0-common_1.8.0-2build1_all.deb ... 420s Unpacking libjson-glib-1.0-common (1.8.0-2build1) over (1.8.0-2) ... 420s Preparing to unpack .../11-libjson-glib-1.0-0_1.8.0-2build1_ppc64el.deb ... 420s Unpacking libjson-glib-1.0-0:ppc64el (1.8.0-2build1) over (1.8.0-2) ... 420s Preparing to unpack .../12-libgusb2_0.4.8-1build1_ppc64el.deb ... 420s Unpacking libgusb2:ppc64el (0.4.8-1build1) over (0.4.8-1) ... 420s Preparing to unpack .../13-libgudev-1.0-0_1%3a238-3ubuntu2_ppc64el.deb ... 420s Unpacking libgudev-1.0-0:ppc64el (1:238-3ubuntu2) over (1:238-3) ... 420s Preparing to unpack .../14-tnftp_20230507-2build1_ppc64el.deb ... 420s Unpacking tnftp (20230507-2build1) over (20230507-2) ... 420s Preparing to unpack .../15-tcpdump_4.99.4-3ubuntu2_ppc64el.deb ... 420s Unpacking tcpdump (4.99.4-3ubuntu2) over (4.99.4-3ubuntu1) ... 420s Preparing to unpack .../16-libsystemd0_255.4-1ubuntu5_ppc64el.deb ... 420s Unpacking libsystemd0:ppc64el (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 420s Setting up libsystemd0:ppc64el (255.4-1ubuntu5) ... 420s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70158 files and directories currently installed.) 420s Preparing to unpack .../systemd-dev_255.4-1ubuntu5_all.deb ... 420s Unpacking systemd-dev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 420s Preparing to unpack .../libnss-systemd_255.4-1ubuntu5_ppc64el.deb ... 420s Unpacking libnss-systemd:ppc64el (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 420s Preparing to unpack .../libudev1_255.4-1ubuntu5_ppc64el.deb ... 420s Unpacking libudev1:ppc64el (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 420s Setting up libudev1:ppc64el (255.4-1ubuntu5) ... 420s dpkg: libssl3:ppc64el: dependency problems, but removing anyway as you requested: 420s wget depends on libssl3 (>= 3.0.0). 420s systemd-resolved depends on libssl3 (>= 3.0.0). 420s systemd depends on libssl3 (>= 3.0.0). 420s sudo depends on libssl3 (>= 3.0.0). 420s rsync depends on libssl3 (>= 3.0.0). 420s python3-cryptography depends on libssl3 (>= 3.0.0). 420s openssl depends on libssl3 (>= 3.0.9). 420s openssh-server depends on libssl3 (>= 3.0.10). 420s openssh-client depends on libssl3 (>= 3.0.10). 420s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 420s libsystemd-shared:ppc64el depends on libssl3 (>= 3.0.0). 420s libssh-4:ppc64el depends on libssl3 (>= 3.0.0). 420s libsasl2-modules:ppc64el depends on libssl3 (>= 3.0.0). 420s libsasl2-2:ppc64el depends on libssl3 (>= 3.0.0). 420s libpython3.12-minimal:ppc64el depends on libssl3 (>= 3.0.0). 420s libpython3.11-minimal:ppc64el depends on libssl3 (>= 3.0.0). 420s libnvme1 depends on libssl3 (>= 3.0.0). 420s libkrb5-3:ppc64el depends on libssl3 (>= 3.0.0). 420s libkmod2:ppc64el depends on libssl3 (>= 3.0.0). 420s libfido2-1:ppc64el depends on libssl3 (>= 3.0.0). 420s libcurl4:ppc64el depends on libssl3 (>= 3.0.0). 420s libcryptsetup12:ppc64el depends on libssl3 (>= 3.0.0). 420s kmod depends on libssl3 (>= 3.0.0). 420s dhcpcd-base depends on libssl3 (>= 3.0.0). 420s coreutils depends on libssl3 (>= 3.0.0). 420s bind9-libs:ppc64el depends on libssl3 (>= 3.0.0). 420s 420s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70158 files and directories currently installed.) 420s Removing libssl3:ppc64el (3.0.10-1ubuntu4) ... 420s Selecting previously unselected package libssl3t64:ppc64el. 420s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70147 files and directories currently installed.) 420s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_ppc64el.deb ... 420s Unpacking libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 421s Setting up libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 421s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 421s Preparing to unpack .../systemd_255.4-1ubuntu5_ppc64el.deb ... 421s Unpacking systemd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 421s Preparing to unpack .../udev_255.4-1ubuntu5_ppc64el.deb ... 421s Unpacking udev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 421s Preparing to unpack .../libsystemd-shared_255.4-1ubuntu5_ppc64el.deb ... 421s Unpacking libsystemd-shared:ppc64el (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 421s Setting up libsystemd-shared:ppc64el (255.4-1ubuntu5) ... 421s Setting up systemd-dev (255.4-1ubuntu5) ... 421s Setting up systemd (255.4-1ubuntu5) ... 422s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 422s Preparing to unpack .../00-systemd-sysv_255.4-1ubuntu5_ppc64el.deb ... 422s Unpacking systemd-sysv (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 422s Preparing to unpack .../01-libpam-systemd_255.4-1ubuntu5_ppc64el.deb ... 422s Unpacking libpam-systemd:ppc64el (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 422s Preparing to unpack .../02-systemd-timesyncd_255.4-1ubuntu5_ppc64el.deb ... 422s Unpacking systemd-timesyncd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 422s Preparing to unpack .../03-systemd-resolved_255.4-1ubuntu5_ppc64el.deb ... 422s Unpacking systemd-resolved (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 422s Preparing to unpack .../04-sudo_1.9.15p5-3ubuntu3_ppc64el.deb ... 422s Unpacking sudo (1.9.15p5-3ubuntu3) over (1.9.15p5-3ubuntu1) ... 422s Preparing to unpack .../05-rsync_3.2.7-1build1_ppc64el.deb ... 422s Unpacking rsync (3.2.7-1build1) over (3.2.7-1) ... 422s Preparing to unpack .../06-python3-cryptography_41.0.7-4build2_ppc64el.deb ... 422s Unpacking python3-cryptography (41.0.7-4build2) over (41.0.7-3) ... 423s Preparing to unpack .../07-openssl_3.0.13-0ubuntu2_ppc64el.deb ... 423s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 423s Preparing to unpack .../08-openssh-sftp-server_1%3a9.6p1-3ubuntu11_ppc64el.deb ... 423s Unpacking openssh-sftp-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 423s Preparing to unpack .../09-openssh-client_1%3a9.6p1-3ubuntu11_ppc64el.deb ... 423s Unpacking openssh-client (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 423s Preparing to unpack .../10-openssh-server_1%3a9.6p1-3ubuntu11_ppc64el.deb ... 423s Unpacking openssh-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 423s Preparing to unpack .../11-libssh-4_0.10.6-2build1_ppc64el.deb ... 423s Unpacking libssh-4:ppc64el (0.10.6-2build1) over (0.10.6-2) ... 423s Preparing to unpack .../12-libsasl2-modules_2.1.28+dfsg1-5ubuntu1_ppc64el.deb ... 423s Unpacking libsasl2-modules:ppc64el (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 423s Preparing to unpack .../13-python3.12_3.12.2-4build3_ppc64el.deb ... 423s Unpacking python3.12 (3.12.2-4build3) over (3.12.2-1) ... 423s Preparing to unpack .../14-python3.12-minimal_3.12.2-4build3_ppc64el.deb ... 423s Unpacking python3.12-minimal (3.12.2-4build3) over (3.12.2-1) ... 423s Preparing to unpack .../15-libpython3.12-minimal_3.12.2-4build3_ppc64el.deb ... 423s Unpacking libpython3.12-minimal:ppc64el (3.12.2-4build3) over (3.12.2-1) ... 423s Preparing to unpack .../16-grub-ieee1275_2.12-1ubuntu5_ppc64el.deb ... 423s Unpacking grub-ieee1275 (2.12-1ubuntu5) over (2.12-1ubuntu4) ... 423s Preparing to unpack .../17-grub2-common_2.12-1ubuntu5_ppc64el.deb ... 423s Unpacking grub2-common (2.12-1ubuntu5) over (2.12-1ubuntu4) ... 423s Preparing to unpack .../18-grub-common_2.12-1ubuntu5_ppc64el.deb ... 423s Unpacking grub-common (2.12-1ubuntu5) over (2.12-1ubuntu4) ... 424s Preparing to unpack .../19-grub-ieee1275-bin_2.12-1ubuntu5_ppc64el.deb ... 424s Unpacking grub-ieee1275-bin (2.12-1ubuntu5) over (2.12-1ubuntu4) ... 424s dpkg: libparted2:ppc64el: dependency problems, but removing anyway as you requested: 424s parted depends on libparted2 (= 3.6-3). 424s 424s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 424s Removing libparted2:ppc64el (3.6-3) ... 424s Selecting previously unselected package libparted2t64:ppc64el. 424s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70154 files and directories currently installed.) 424s Preparing to unpack .../0-libparted2t64_3.6-3.1build2_ppc64el.deb ... 424s Unpacking libparted2t64:ppc64el (3.6-3.1build2) ... 424s Preparing to unpack .../1-parted_3.6-3.1build2_ppc64el.deb ... 424s Unpacking parted (3.6-3.1build2) over (3.6-3) ... 424s Preparing to unpack .../2-python3.11_3.11.8-1build4_ppc64el.deb ... 424s Unpacking python3.11 (3.11.8-1build4) over (3.11.8-1) ... 424s Preparing to unpack .../3-python3.11-minimal_3.11.8-1build4_ppc64el.deb ... 424s Unpacking python3.11-minimal (3.11.8-1build4) over (3.11.8-1) ... 424s Preparing to unpack .../4-libpython3.11-minimal_3.11.8-1build4_ppc64el.deb ... 424s Unpacking libpython3.11-minimal:ppc64el (3.11.8-1build4) over (3.11.8-1) ... 424s Preparing to unpack .../5-libpython3.11-stdlib_3.11.8-1build4_ppc64el.deb ... 424s Unpacking libpython3.11-stdlib:ppc64el (3.11.8-1build4) over (3.11.8-1) ... 424s Preparing to unpack .../6-gnupg-utils_2.4.4-2ubuntu15_ppc64el.deb ... 424s Unpacking gnupg-utils (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 424s Preparing to unpack .../7-gpg-agent_2.4.4-2ubuntu15_ppc64el.deb ... 424s Unpacking gpg-agent (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 424s Preparing to unpack .../8-gpg-wks-client_2.4.4-2ubuntu15_ppc64el.deb ... 424s Unpacking gpg-wks-client (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 424s Preparing to unpack .../9-gpg_2.4.4-2ubuntu15_ppc64el.deb ... 424s Unpacking gpg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s dpkg: libnpth0:ppc64el: dependency problems, but removing anyway as you requested: 425s keyboxd depends on libnpth0 (>= 0.90). 425s gpgv depends on libnpth0 (>= 0.90). 425s gpgsm depends on libnpth0 (>= 0.90). 425s dirmngr depends on libnpth0 (>= 0.90). 425s 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70159 files and directories currently installed.) 425s Removing libnpth0:ppc64el (1.6-3build2) ... 425s Selecting previously unselected package libnpth0t64:ppc64el. 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70154 files and directories currently installed.) 425s Preparing to unpack .../libnpth0t64_1.6-3.1_ppc64el.deb ... 425s Unpacking libnpth0t64:ppc64el (1.6-3.1) ... 425s Setting up libnpth0t64:ppc64el (1.6-3.1) ... 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 425s Preparing to unpack .../gpgv_2.4.4-2ubuntu15_ppc64el.deb ... 425s Unpacking gpgv (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s Setting up gpgv (2.4.4-2ubuntu15) ... 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 425s Preparing to unpack .../dirmngr_2.4.4-2ubuntu15_ppc64el.deb ... 425s Unpacking dirmngr (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s Preparing to unpack .../gnupg_2.4.4-2ubuntu15_all.deb ... 425s Unpacking gnupg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s Preparing to unpack .../keyboxd_2.4.4-2ubuntu15_ppc64el.deb ... 425s Unpacking keyboxd (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s Preparing to unpack .../gpgconf_2.4.4-2ubuntu15_ppc64el.deb ... 425s Unpacking gpgconf (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s Preparing to unpack .../gpgsm_2.4.4-2ubuntu15_ppc64el.deb ... 425s Unpacking gpgsm (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 425s dpkg: libreadline8:ppc64el: dependency problems, but removing anyway as you requested: 425s libpython3.12-stdlib:ppc64el depends on libreadline8 (>= 7.0~beta). 425s gawk depends on libreadline8 (>= 6.0). 425s fdisk depends on libreadline8 (>= 6.0). 425s bc depends on libreadline8 (>= 6.0). 425s 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70160 files and directories currently installed.) 425s Removing libreadline8:ppc64el (8.2-3) ... 425s Selecting previously unselected package libreadline8t64:ppc64el. 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70148 files and directories currently installed.) 425s Preparing to unpack .../libreadline8t64_8.2-4_ppc64el.deb ... 425s Adding 'diversion of /lib/powerpc64le-linux-gnu/libhistory.so.8 to /lib/powerpc64le-linux-gnu/libhistory.so.8.usr-is-merged by libreadline8t64' 425s Adding 'diversion of /lib/powerpc64le-linux-gnu/libhistory.so.8.2 to /lib/powerpc64le-linux-gnu/libhistory.so.8.2.usr-is-merged by libreadline8t64' 425s Adding 'diversion of /lib/powerpc64le-linux-gnu/libreadline.so.8 to /lib/powerpc64le-linux-gnu/libreadline.so.8.usr-is-merged by libreadline8t64' 425s Adding 'diversion of /lib/powerpc64le-linux-gnu/libreadline.so.8.2 to /lib/powerpc64le-linux-gnu/libreadline.so.8.2.usr-is-merged by libreadline8t64' 425s Unpacking libreadline8t64:ppc64el (8.2-4) ... 425s Setting up libreadline8t64:ppc64el (8.2-4) ... 425s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70168 files and directories currently installed.) 425s Preparing to unpack .../gawk_1%3a5.2.1-2build2_ppc64el.deb ... 425s Unpacking gawk (1:5.2.1-2build2) over (1:5.2.1-2) ... 425s Preparing to unpack .../fdisk_2.39.3-9ubuntu2_ppc64el.deb ... 425s Unpacking fdisk (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 425s Preparing to unpack .../bc_1.07.1-3ubuntu2_ppc64el.deb ... 425s Unpacking bc (1.07.1-3ubuntu2) over (1.07.1-3build1) ... 425s Preparing to unpack .../libpython3.12-stdlib_3.12.2-4build3_ppc64el.deb ... 425s Unpacking libpython3.12-stdlib:ppc64el (3.12.2-4build3) over (3.12.2-1) ... 425s Preparing to unpack .../perl-base_5.38.2-3.2_ppc64el.deb ... 425s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 426s Setting up perl-base (5.38.2-3.2) ... 426s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70166 files and directories currently installed.) 426s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ... 426s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 426s Preparing to unpack .../python3-gdbm_3.12.2-3ubuntu1.1_ppc64el.deb ... 426s Unpacking python3-gdbm:ppc64el (3.12.2-3ubuntu1.1) over (3.11.5-1) ... 426s Preparing to unpack .../man-db_2.12.0-3build4_ppc64el.deb ... 426s Unpacking man-db (2.12.0-3build4) over (2.12.0-3) ... 426s dpkg: libgdbm-compat4:ppc64el: dependency problems, but removing anyway as you requested: 426s libperl5.38:ppc64el depends on libgdbm-compat4 (>= 1.18-3). 426s 426s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70166 files and directories currently installed.) 426s Removing libgdbm-compat4:ppc64el (1.23-5) ... 426s dpkg: libgdbm6:ppc64el: dependency problems, but removing anyway as you requested: 426s libperl5.38:ppc64el depends on libgdbm6 (>= 1.21). 426s 426s Removing libgdbm6:ppc64el (1.23-5) ... 426s Selecting previously unselected package libgdbm6t64:ppc64el. 426s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 426s Preparing to unpack .../libgdbm6t64_1.23-5.1_ppc64el.deb ... 426s Unpacking libgdbm6t64:ppc64el (1.23-5.1) ... 427s Selecting previously unselected package libgdbm-compat4t64:ppc64el. 427s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_ppc64el.deb ... 427s Unpacking libgdbm-compat4t64:ppc64el (1.23-5.1) ... 427s dpkg: libperl5.38:ppc64el: dependency problems, but removing anyway as you requested: 427s perl depends on libperl5.38 (= 5.38.2-3). 427s 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70168 files and directories currently installed.) 427s Removing libperl5.38:ppc64el (5.38.2-3) ... 427s Selecting previously unselected package libperl5.38t64:ppc64el. 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69645 files and directories currently installed.) 427s Preparing to unpack .../libperl5.38t64_5.38.2-3.2_ppc64el.deb ... 427s Unpacking libperl5.38t64:ppc64el (5.38.2-3.2) ... 427s Preparing to unpack .../perl_5.38.2-3.2_ppc64el.deb ... 427s Unpacking perl (5.38.2-3.2) over (5.38.2-3) ... 427s dpkg: libdb5.3:ppc64el: dependency problems, but removing anyway as you requested: 427s libsasl2-modules-db:ppc64el depends on libdb5.3. 427s libpam-modules:ppc64el depends on libdb5.3. 427s iproute2 depends on libdb5.3. 427s apt-utils depends on libdb5.3. 427s 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70168 files and directories currently installed.) 427s Removing libdb5.3:ppc64el (5.3.28+dfsg2-4) ... 427s Selecting previously unselected package libdb5.3t64:ppc64el. 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70162 files and directories currently installed.) 427s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-6_ppc64el.deb ... 427s Unpacking libdb5.3t64:ppc64el (5.3.28+dfsg2-6) ... 427s Preparing to unpack .../libsasl2-modules-db_2.1.28+dfsg1-5ubuntu1_ppc64el.deb ... 427s Unpacking libsasl2-modules-db:ppc64el (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 427s Preparing to unpack .../libsasl2-2_2.1.28+dfsg1-5ubuntu1_ppc64el.deb ... 427s Unpacking libsasl2-2:ppc64el (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 427s dpkg: libnvme1: dependency problems, but removing anyway as you requested: 427s libblockdev-nvme3:ppc64el depends on libnvme1 (>= 1.7.1). 427s 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70168 files and directories currently installed.) 427s Removing libnvme1 (1.8-2) ... 427s Selecting previously unselected package libnvme1t64. 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70161 files and directories currently installed.) 427s Preparing to unpack .../libnvme1t64_1.8-3_ppc64el.deb ... 427s Unpacking libnvme1t64 (1.8-3) ... 427s Preparing to unpack .../wget_1.21.4-1ubuntu2_ppc64el.deb ... 427s Unpacking wget (1.21.4-1ubuntu2) over (1.21.4-1ubuntu1) ... 427s dpkg: libcurl4:ppc64el: dependency problems, but removing anyway as you requested: 427s curl depends on libcurl4 (= 8.5.0-2ubuntu2). 427s 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70169 files and directories currently installed.) 427s Removing libcurl4:ppc64el (8.5.0-2ubuntu2) ... 427s Selecting previously unselected package libcurl4t64:ppc64el. 427s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70164 files and directories currently installed.) 427s Preparing to unpack .../libcurl4t64_8.5.0-2ubuntu8_ppc64el.deb ... 427s Unpacking libcurl4t64:ppc64el (8.5.0-2ubuntu8) ... 427s Preparing to unpack .../curl_8.5.0-2ubuntu8_ppc64el.deb ... 427s Unpacking curl (8.5.0-2ubuntu8) over (8.5.0-2ubuntu2) ... 428s dpkg: libpsl5:ppc64el: dependency problems, but removing anyway as you requested: 428s libcurl3-gnutls:ppc64el depends on libpsl5 (>= 0.16.0). 428s 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70170 files and directories currently installed.) 428s Removing libpsl5:ppc64el (0.21.2-1build1) ... 428s Selecting previously unselected package libpsl5t64:ppc64el. 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70165 files and directories currently installed.) 428s Preparing to unpack .../libpsl5t64_0.21.2-1.1_ppc64el.deb ... 428s Unpacking libpsl5t64:ppc64el (0.21.2-1.1) ... 428s dpkg: libarchive13:ppc64el: dependency problems, but removing anyway as you requested: 428s fwupd depends on libarchive13 (>= 3.2.1). 428s 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70171 files and directories currently installed.) 428s Removing libarchive13:ppc64el (3.7.2-1ubuntu2) ... 428s Selecting previously unselected package libarchive13t64:ppc64el. 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70165 files and directories currently installed.) 428s Preparing to unpack .../libarchive13t64_3.7.2-1.1ubuntu2_ppc64el.deb ... 428s Unpacking libarchive13t64:ppc64el (3.7.2-1.1ubuntu2) ... 428s Preparing to unpack .../fwupd_1.9.15-2_ppc64el.deb ... 428s Unpacking fwupd (1.9.15-2) over (1.9.14-1) ... 428s dpkg: libcurl3-gnutls:ppc64el: dependency problems, but removing anyway as you requested: 428s libfwupd2:ppc64el depends on libcurl3-gnutls (>= 7.63.0). 428s 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70172 files and directories currently installed.) 428s Removing libcurl3-gnutls:ppc64el (8.5.0-2ubuntu2) ... 428s Selecting previously unselected package libcurl3t64-gnutls:ppc64el. 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70165 files and directories currently installed.) 428s Preparing to unpack .../00-libcurl3t64-gnutls_8.5.0-2ubuntu8_ppc64el.deb ... 428s Unpacking libcurl3t64-gnutls:ppc64el (8.5.0-2ubuntu8) ... 428s Preparing to unpack .../01-libfwupd2_1.9.15-2_ppc64el.deb ... 428s Unpacking libfwupd2:ppc64el (1.9.15-2) over (1.9.14-1) ... 428s Preparing to unpack .../02-libblockdev3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../03-libblockdev-utils3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-utils3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../04-libblockdev-swap3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-swap3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../05-libblockdev-part3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-part3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../06-libblockdev-nvme3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-nvme3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../07-libblockdev-mdraid3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-mdraid3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../08-libblockdev-loop3_3.1.0-1build1_ppc64el.deb ... 428s Unpacking libblockdev-loop3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 428s Preparing to unpack .../09-e2fsprogs-l10n_1.47.0-2.4~exp1ubuntu2_all.deb ... 428s Unpacking e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 428s Preparing to unpack .../10-logsave_1.47.0-2.4~exp1ubuntu2_ppc64el.deb ... 428s Unpacking logsave (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 428s dpkg: libext2fs2:ppc64el: dependency problems, but removing anyway as you requested: 428s libblockdev-fs3:ppc64el depends on libext2fs2 (>= 1.42.11). 428s e2fsprogs depends on libext2fs2 (= 1.47.0-2ubuntu1). 428s btrfs-progs depends on libext2fs2 (>= 1.42). 428s 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70172 files and directories currently installed.) 428s Removing libext2fs2:ppc64el (1.47.0-2ubuntu1) ... 428s Selecting previously unselected package libext2fs2t64:ppc64el. 428s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70165 files and directories currently installed.) 428s Preparing to unpack .../libext2fs2t64_1.47.0-2.4~exp1ubuntu2_ppc64el.deb ... 428s Adding 'diversion of /lib/powerpc64le-linux-gnu/libe2p.so.2 to /lib/powerpc64le-linux-gnu/libe2p.so.2.usr-is-merged by libext2fs2t64' 428s Adding 'diversion of /lib/powerpc64le-linux-gnu/libe2p.so.2.3 to /lib/powerpc64le-linux-gnu/libe2p.so.2.3.usr-is-merged by libext2fs2t64' 428s Adding 'diversion of /lib/powerpc64le-linux-gnu/libext2fs.so.2 to /lib/powerpc64le-linux-gnu/libext2fs.so.2.usr-is-merged by libext2fs2t64' 428s Adding 'diversion of /lib/powerpc64le-linux-gnu/libext2fs.so.2.4 to /lib/powerpc64le-linux-gnu/libext2fs.so.2.4.usr-is-merged by libext2fs2t64' 428s Unpacking libext2fs2t64:ppc64el (1.47.0-2.4~exp1ubuntu2) ... 429s Setting up libext2fs2t64:ppc64el (1.47.0-2.4~exp1ubuntu2) ... 429s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70181 files and directories currently installed.) 429s Preparing to unpack .../e2fsprogs_1.47.0-2.4~exp1ubuntu2_ppc64el.deb ... 429s Unpacking e2fsprogs (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 429s dpkg: libreiserfscore0: dependency problems, but removing anyway as you requested: 429s btrfs-progs depends on libreiserfscore0 (>= 1:3.6.27). 429s 429s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70181 files and directories currently installed.) 429s Removing libreiserfscore0 (1:3.6.27-7) ... 429s Selecting previously unselected package libreiserfscore0t64. 429s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70176 files and directories currently installed.) 429s Preparing to unpack .../libreiserfscore0t64_1%3a3.6.27-7.1_ppc64el.deb ... 429s Unpacking libreiserfscore0t64 (1:3.6.27-7.1) ... 429s Preparing to unpack .../btrfs-progs_6.6.3-1.1build1_ppc64el.deb ... 429s Unpacking btrfs-progs (6.6.3-1.1build1) over (6.6.3-1.1) ... 429s Preparing to unpack .../libblockdev-fs3_3.1.0-1build1_ppc64el.deb ... 429s Unpacking libblockdev-fs3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 429s Preparing to unpack .../libblockdev-crypto3_3.1.0-1build1_ppc64el.deb ... 429s Unpacking libblockdev-crypto3:ppc64el (3.1.0-1build1) over (3.1.0-1) ... 429s Preparing to unpack .../bolt_0.9.6-2build1_ppc64el.deb ... 429s Unpacking bolt (0.9.6-2build1) over (0.9.6-2) ... 429s dpkg: libglib2.0-0:ppc64el: dependency problems, but removing anyway as you requested: 429s libnetplan0:ppc64el depends on libglib2.0-0 (>= 2.75.3). 429s libjcat1:ppc64el depends on libglib2.0-0 (>= 2.75.3). 429s 429s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70182 files and directories currently installed.) 429s Removing libglib2.0-0:ppc64el (2.79.2-1~ubuntu1) ... 429s Selecting previously unselected package libglib2.0-0t64:ppc64el. 429s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70157 files and directories currently installed.) 429s Preparing to unpack .../0-libglib2.0-0t64_2.79.3-3ubuntu5_ppc64el.deb ... 429s libglib2.0-0t64.preinst: Removing /var/lib/dpkg/info/libglib2.0-0:ppc64el.postrm to avoid loss of /usr/share/glib-2.0/schemas/gschemas.compiled... 429s removed '/var/lib/dpkg/info/libglib2.0-0:ppc64el.postrm' 429s Unpacking libglib2.0-0t64:ppc64el (2.79.3-3ubuntu5) ... 429s Preparing to unpack .../1-libjcat1_0.2.0-2build2_ppc64el.deb ... 429s Unpacking libjcat1:ppc64el (0.2.0-2build2) over (0.2.0-2) ... 429s Preparing to unpack .../2-libldap2_2.6.7+dfsg-1~exp1ubuntu6_ppc64el.deb ... 429s Unpacking libldap2:ppc64el (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 429s Preparing to unpack .../3-ubuntu-pro-client-l10n_31.2.2_ppc64el.deb ... 429s Unpacking ubuntu-pro-client-l10n (31.2.2) over (31.1) ... 429s Preparing to unpack .../4-ubuntu-pro-client_31.2.2_ppc64el.deb ... 430s Unpacking ubuntu-pro-client (31.2.2) over (31.1) ... 430s Preparing to unpack .../5-python3-apt_2.7.7_ppc64el.deb ... 430s Unpacking python3-apt (2.7.7) over (2.7.6) ... 430s Preparing to unpack .../6-apt-utils_2.7.14_ppc64el.deb ... 430s Unpacking apt-utils (2.7.14) over (2.7.12) ... 430s dpkg: libapt-pkg6.0:ppc64el: dependency problems, but removing anyway as you requested: 430s apt depends on libapt-pkg6.0 (>= 2.7.12). 430s 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70180 files and directories currently installed.) 430s Removing libapt-pkg6.0:ppc64el (2.7.12) ... 430s dpkg: libnettle8:ppc64el: dependency problems, but removing anyway as you requested: 430s librtmp1:ppc64el depends on libnettle8. 430s libhogweed6:ppc64el depends on libnettle8. 430s libgnutls30:ppc64el depends on libnettle8 (>= 3.9~). 430s 430s Removing libnettle8:ppc64el (3.9.1-2) ... 430s Selecting previously unselected package libapt-pkg6.0t64:ppc64el. 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70124 files and directories currently installed.) 430s Preparing to unpack .../libapt-pkg6.0t64_2.7.14_ppc64el.deb ... 430s Unpacking libapt-pkg6.0t64:ppc64el (2.7.14) ... 430s Setting up libapt-pkg6.0t64:ppc64el (2.7.14) ... 430s Selecting previously unselected package libnettle8t64:ppc64el. 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70174 files and directories currently installed.) 430s Preparing to unpack .../libnettle8t64_3.9.1-2.2_ppc64el.deb ... 430s Unpacking libnettle8t64:ppc64el (3.9.1-2.2) ... 430s Setting up libnettle8t64:ppc64el (3.9.1-2.2) ... 430s dpkg: libhogweed6:ppc64el: dependency problems, but removing anyway as you requested: 430s librtmp1:ppc64el depends on libhogweed6. 430s libgnutls30:ppc64el depends on libhogweed6 (>= 3.6). 430s 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70182 files and directories currently installed.) 430s Removing libhogweed6:ppc64el (3.9.1-2) ... 430s Selecting previously unselected package libhogweed6t64:ppc64el. 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70177 files and directories currently installed.) 430s Preparing to unpack .../libhogweed6t64_3.9.1-2.2_ppc64el.deb ... 430s Unpacking libhogweed6t64:ppc64el (3.9.1-2.2) ... 430s Setting up libhogweed6t64:ppc64el (3.9.1-2.2) ... 430s dpkg: libgnutls30:ppc64el: dependency problems, but removing anyway as you requested: 430s librtmp1:ppc64el depends on libgnutls30 (>= 3.7.2). 430s apt depends on libgnutls30 (>= 3.8.1). 430s 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70183 files and directories currently installed.) 430s Removing libgnutls30:ppc64el (3.8.3-1ubuntu1) ... 430s Selecting previously unselected package libgnutls30t64:ppc64el. 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70174 files and directories currently installed.) 430s Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu2_ppc64el.deb ... 430s Unpacking libgnutls30t64:ppc64el (3.8.3-1.1ubuntu2) ... 430s Setting up libgnutls30t64:ppc64el (3.8.3-1.1ubuntu2) ... 430s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 430s Preparing to unpack .../apt_2.7.14_ppc64el.deb ... 430s Unpacking apt (2.7.14) over (2.7.12) ... 431s Setting up apt (2.7.14) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../librtmp1_2.4+20151223.gitfa8646d.1-2build6_ppc64el.deb ... 432s Unpacking librtmp1:ppc64el (2.4+20151223.gitfa8646d.1-2build6) over (2.4+20151223.gitfa8646d.1-2build4) ... 432s Preparing to unpack .../liblzma5_5.6.0-0.2_ppc64el.deb ... 432s Unpacking liblzma5:ppc64el (5.6.0-0.2) over (5.4.5-0.3) ... 432s Setting up liblzma5:ppc64el (5.6.0-0.2) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libblkid1_2.39.3-9ubuntu2_ppc64el.deb ... 432s Unpacking libblkid1:ppc64el (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 432s Setting up libblkid1:ppc64el (2.39.3-9ubuntu2) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../kmod_31+20240202-2ubuntu4_ppc64el.deb ... 432s Unpacking kmod (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 432s Preparing to unpack .../libkmod2_31+20240202-2ubuntu4_ppc64el.deb ... 432s Unpacking libkmod2:ppc64el (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 432s Preparing to unpack .../libselinux1_3.5-2ubuntu1_ppc64el.deb ... 432s Unpacking libselinux1:ppc64el (3.5-2ubuntu1) over (3.5-2build1) ... 432s Setting up libselinux1:ppc64el (3.5-2ubuntu1) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libaudit-common_1%3a3.1.2-2.1_all.deb ... 432s Unpacking libaudit-common (1:3.1.2-2.1) over (1:3.1.2-2) ... 432s Setting up libaudit-common (1:3.1.2-2.1) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libcap-ng0_0.8.4-2build1_ppc64el.deb ... 432s Unpacking libcap-ng0:ppc64el (0.8.4-2build1) over (0.8.4-2) ... 432s Setting up libcap-ng0:ppc64el (0.8.4-2build1) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libaudit1_1%3a3.1.2-2.1_ppc64el.deb ... 432s Unpacking libaudit1:ppc64el (1:3.1.2-2.1) over (1:3.1.2-2) ... 432s Setting up libaudit1:ppc64el (1:3.1.2-2.1) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libpam0g_1.5.3-5ubuntu3_ppc64el.deb ... 432s Unpacking libpam0g:ppc64el (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 432s Setting up libpam0g:ppc64el (1.5.3-5ubuntu3) ... 432s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 432s Preparing to unpack .../libpam-modules-bin_1.5.3-5ubuntu3_ppc64el.deb ... 432s Unpacking libpam-modules-bin (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 432s Setting up libpam-modules-bin (1.5.3-5ubuntu3) ... 433s pam_namespace.service is a disabled or a static unit not running, not starting it. 433s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 433s Preparing to unpack .../libpam-modules_1.5.3-5ubuntu3_ppc64el.deb ... 433s Unpacking libpam-modules:ppc64el (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 433s Setting up libpam-modules:ppc64el (1.5.3-5ubuntu3) ... 433s Installing new version of config file /etc/security/namespace.init ... 433s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 433s Preparing to unpack .../libpam-runtime_1.5.3-5ubuntu3_all.deb ... 433s Unpacking libpam-runtime (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 433s Setting up libpam-runtime (1.5.3-5ubuntu3) ... 433s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 433s Preparing to unpack .../00-dbus-session-bus-common_1.14.10-4ubuntu2_all.deb ... 433s Unpacking dbus-session-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 433s Preparing to unpack .../01-dbus-user-session_1.14.10-4ubuntu2_ppc64el.deb ... 433s Unpacking dbus-user-session (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 433s Preparing to unpack .../02-libapparmor1_4.0.0-beta3-0ubuntu2_ppc64el.deb ... 433s Unpacking libapparmor1:ppc64el (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 433s Preparing to unpack .../03-libexpat1_2.6.1-2_ppc64el.deb ... 433s Unpacking libexpat1:ppc64el (2.6.1-2) over (2.6.0-1) ... 433s Preparing to unpack .../04-dbus-system-bus-common_1.14.10-4ubuntu2_all.deb ... 433s Unpacking dbus-system-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 433s Preparing to unpack .../05-dbus-bin_1.14.10-4ubuntu2_ppc64el.deb ... 433s Unpacking dbus-bin (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 434s Preparing to unpack .../06-dbus_1.14.10-4ubuntu2_ppc64el.deb ... 434s Unpacking dbus (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 434s Preparing to unpack .../07-dbus-daemon_1.14.10-4ubuntu2_ppc64el.deb ... 434s Unpacking dbus-daemon (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 434s Preparing to unpack .../08-libdbus-1-3_1.14.10-4ubuntu2_ppc64el.deb ... 434s Unpacking libdbus-1-3:ppc64el (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 434s Preparing to unpack .../09-libdevmapper1.02.1_2%3a1.02.185-3ubuntu2_ppc64el.deb ... 434s Unpacking libdevmapper1.02.1:ppc64el (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 434s Preparing to unpack .../10-libuuid1_2.39.3-9ubuntu2_ppc64el.deb ... 434s Unpacking libuuid1:ppc64el (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 434s Setting up libuuid1:ppc64el (2.39.3-9ubuntu2) ... 434s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 434s Preparing to unpack .../libcryptsetup12_2%3a2.7.0-1ubuntu2_ppc64el.deb ... 434s Unpacking libcryptsetup12:ppc64el (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 434s Preparing to unpack .../libfdisk1_2.39.3-9ubuntu2_ppc64el.deb ... 434s Unpacking libfdisk1:ppc64el (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 434s Preparing to unpack .../libseccomp2_2.5.5-1ubuntu2_ppc64el.deb ... 434s Unpacking libseccomp2:ppc64el (2.5.5-1ubuntu2) over (2.5.5-1ubuntu1) ... 434s Setting up libseccomp2:ppc64el (2.5.5-1ubuntu2) ... 434s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 434s Preparing to unpack .../mount_2.39.3-9ubuntu2_ppc64el.deb ... 434s Unpacking mount (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 434s Preparing to unpack .../libmount1_2.39.3-9ubuntu2_ppc64el.deb ... 434s Unpacking libmount1:ppc64el (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 434s Setting up libmount1:ppc64el (2.39.3-9ubuntu2) ... 434s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 434s Preparing to unpack .../zlib1g_1%3a1.3.dfsg-3.1ubuntu1_ppc64el.deb ... 434s Unpacking zlib1g:ppc64el (1:1.3.dfsg-3.1ubuntu1) over (1:1.3.dfsg-3ubuntu1) ... 434s Setting up zlib1g:ppc64el (1:1.3.dfsg-3.1ubuntu1) ... 434s Setting up libpython3.12-minimal:ppc64el (3.12.2-4build3) ... 434s Setting up libexpat1:ppc64el (2.6.1-2) ... 434s Setting up python3.12-minimal (3.12.2-4build3) ... 435s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 435s Preparing to unpack .../python3-minimal_3.12.2-0ubuntu1_ppc64el.deb ... 435s Unpacking python3-minimal (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 435s Setting up python3-minimal (3.12.2-0ubuntu1) ... 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 436s Preparing to unpack .../python3_3.12.2-0ubuntu1_ppc64el.deb ... 436s Unpacking python3 (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 436s Preparing to unpack .../libplymouth5_24.004.60-1ubuntu6_ppc64el.deb ... 436s Unpacking libplymouth5:ppc64el (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 436s dpkg: libpng16-16:ppc64el: dependency problems, but removing anyway as you requested: 436s libfreetype6:ppc64el depends on libpng16-16 (>= 1.6.2-1). 436s 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70200 files and directories currently installed.) 436s Removing libpng16-16:ppc64el (1.6.43-1) ... 436s Selecting previously unselected package libpng16-16t64:ppc64el. 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70190 files and directories currently installed.) 436s Preparing to unpack .../0-libpng16-16t64_1.6.43-3_ppc64el.deb ... 436s Unpacking libpng16-16t64:ppc64el (1.6.43-3) ... 436s Preparing to unpack .../1-libbrotli1_1.1.0-2build1_ppc64el.deb ... 436s Unpacking libbrotli1:ppc64el (1.1.0-2build1) over (1.1.0-2) ... 436s Preparing to unpack .../2-libfreetype6_2.13.2+dfsg-1build2_ppc64el.deb ... 436s Unpacking libfreetype6:ppc64el (2.13.2+dfsg-1build2) over (2.13.2+dfsg-1) ... 436s Preparing to unpack .../3-libsqlite3-0_3.45.1-1ubuntu1_ppc64el.deb ... 436s Unpacking libsqlite3-0:ppc64el (3.45.1-1ubuntu1) over (3.45.1-1) ... 436s Preparing to unpack .../4-pinentry-curses_1.2.1-3ubuntu4_ppc64el.deb ... 436s Unpacking pinentry-curses (1.2.1-3ubuntu4) over (1.2.1-3ubuntu1) ... 436s Preparing to unpack .../5-gcc-14-base_14-20240315-1ubuntu1_ppc64el.deb ... 436s Unpacking gcc-14-base:ppc64el (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 436s Setting up gcc-14-base:ppc64el (14-20240315-1ubuntu1) ... 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70201 files and directories currently installed.) 436s Preparing to unpack .../libgcc-s1_14-20240315-1ubuntu1_ppc64el.deb ... 436s Unpacking libgcc-s1:ppc64el (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 436s Setting up libgcc-s1:ppc64el (14-20240315-1ubuntu1) ... 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70201 files and directories currently installed.) 436s Preparing to unpack .../libstdc++6_14-20240315-1ubuntu1_ppc64el.deb ... 436s Unpacking libstdc++6:ppc64el (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 436s Setting up libstdc++6:ppc64el (14-20240315-1ubuntu1) ... 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70201 files and directories currently installed.) 436s Preparing to unpack .../python-apt-common_2.7.7_all.deb ... 436s Unpacking python-apt-common (2.7.7) over (2.7.6) ... 436s Preparing to unpack .../libsmartcols1_2.39.3-9ubuntu2_ppc64el.deb ... 436s Unpacking libsmartcols1:ppc64el (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 436s Setting up libsmartcols1:ppc64el (2.39.3-9ubuntu2) ... 436s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70201 files and directories currently installed.) 436s Preparing to unpack .../00-readline-common_8.2-4_all.deb ... 436s Unpacking readline-common (8.2-4) over (8.2-3) ... 436s Preparing to unpack .../01-bsdextrautils_2.39.3-9ubuntu2_ppc64el.deb ... 436s Unpacking bsdextrautils (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 436s Preparing to unpack .../02-groff-base_1.23.0-3build1_ppc64el.deb ... 436s Unpacking groff-base (1.23.0-3build1) over (1.23.0-3) ... 436s Preparing to unpack .../03-libpython3-stdlib_3.12.2-0ubuntu1_ppc64el.deb ... 436s Unpacking libpython3-stdlib:ppc64el (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 436s Preparing to unpack .../04-libfido2-1_1.14.0-1build1_ppc64el.deb ... 436s Unpacking libfido2-1:ppc64el (1.14.0-1build1) over (1.14.0-1) ... 436s Preparing to unpack .../05-libgssapi-krb5-2_1.20.1-6ubuntu1_ppc64el.deb ... 436s Unpacking libgssapi-krb5-2:ppc64el (1.20.1-6ubuntu1) over (1.20.1-5build1) ... 436s Preparing to unpack .../06-libkrb5-3_1.20.1-6ubuntu1_ppc64el.deb ... 436s Unpacking libkrb5-3:ppc64el (1.20.1-6ubuntu1) over (1.20.1-5build1) ... 436s Preparing to unpack .../07-libkrb5support0_1.20.1-6ubuntu1_ppc64el.deb ... 436s Unpacking libkrb5support0:ppc64el (1.20.1-6ubuntu1) over (1.20.1-5build1) ... 436s Preparing to unpack .../08-libk5crypto3_1.20.1-6ubuntu1_ppc64el.deb ... 436s Unpacking libk5crypto3:ppc64el (1.20.1-6ubuntu1) over (1.20.1-5build1) ... 436s Preparing to unpack .../09-libcom-err2_1.47.0-2.4~exp1ubuntu2_ppc64el.deb ... 436s Unpacking libcom-err2:ppc64el (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 437s Preparing to unpack .../10-libproc2-0_2%3a4.0.4-4ubuntu2_ppc64el.deb ... 437s Unpacking libproc2-0:ppc64el (2:4.0.4-4ubuntu2) over (2:4.0.4-4ubuntu1) ... 437s Preparing to unpack .../11-procps_2%3a4.0.4-4ubuntu2_ppc64el.deb ... 437s Unpacking procps (2:4.0.4-4ubuntu2) over (2:4.0.4-4ubuntu1) ... 437s Preparing to unpack .../12-libnghttp2-14_1.59.0-1build1_ppc64el.deb ... 437s Unpacking libnghttp2-14:ppc64el (1.59.0-1build1) over (1.59.0-1) ... 437s Preparing to unpack .../13-dpkg_1.22.6ubuntu4_ppc64el.deb ... 437s Unpacking dpkg (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 437s Setting up dpkg (1.22.6ubuntu4) ... 437s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 437s Preparing to unpack .../util-linux_2.39.3-9ubuntu2_ppc64el.deb ... 437s Unpacking util-linux (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 438s Setting up util-linux (2.39.3-9ubuntu2) ... 439s fstrim.service is a disabled or a static unit not running, not starting it. 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 439s Preparing to unpack .../libxml2_2.9.14+dfsg-1.3ubuntu2_ppc64el.deb ... 439s Unpacking libxml2:ppc64el (2.9.14+dfsg-1.3ubuntu2) over (2.9.14+dfsg-1.3ubuntu1) ... 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 439s Removing libatm1:ppc64el (1:2.5.1-5) ... 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70197 files and directories currently installed.) 439s Preparing to unpack .../libbpf1_1%3a1.3.0-2build1_ppc64el.deb ... 439s Unpacking libbpf1:ppc64el (1:1.3.0-2build1) over (1:1.3.0-2) ... 439s Preparing to unpack .../iproute2_6.1.0-1ubuntu5_ppc64el.deb ... 439s Unpacking iproute2 (6.1.0-1ubuntu5) over (6.1.0-1ubuntu2) ... 439s dpkg: libelf1:ppc64el: dependency problems, but removing anyway as you requested: 439s linux-headers-6.8.0-11-generic depends on libelf1 (>= 0.144). 439s 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70197 files and directories currently installed.) 439s Removing libelf1:ppc64el (0.190-1) ... 439s Selecting previously unselected package libelf1t64:ppc64el. 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70192 files and directories currently installed.) 439s Preparing to unpack .../libelf1t64_0.190-1.1build2_ppc64el.deb ... 439s Unpacking libelf1t64:ppc64el (0.190-1.1build2) ... 439s Preparing to unpack .../dhcpcd-base_1%3a10.0.6-1ubuntu2_ppc64el.deb ... 439s Unpacking dhcpcd-base (1:10.0.6-1ubuntu2) over (1:10.0.6-1ubuntu1) ... 439s Preparing to unpack .../file_1%3a5.45-3_ppc64el.deb ... 439s Unpacking file (1:5.45-3) over (1:5.45-2) ... 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70197 files and directories currently installed.) 439s Removing libmagic1:ppc64el (1:5.45-2) ... 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70187 files and directories currently installed.) 439s Preparing to unpack .../libmagic-mgc_1%3a5.45-3_ppc64el.deb ... 439s Unpacking libmagic-mgc (1:5.45-3) over (1:5.45-2) ... 439s Selecting previously unselected package libmagic1t64:ppc64el. 439s Preparing to unpack .../libmagic1t64_1%3a5.45-3_ppc64el.deb ... 439s Unpacking libmagic1t64:ppc64el (1:5.45-3) ... 439s Preparing to unpack .../libtirpc-common_1.3.4+ds-1.1_all.deb ... 439s Unpacking libtirpc-common (1.3.4+ds-1.1) over (1.3.4+ds-1build1) ... 439s Preparing to unpack .../lsof_4.95.0-1build2_ppc64el.deb ... 439s Unpacking lsof (4.95.0-1build2) over (4.95.0-1build1) ... 439s Preparing to unpack .../libnsl2_1.3.0-3build2_ppc64el.deb ... 439s Unpacking libnsl2:ppc64el (1.3.0-3build2) over (1.3.0-3) ... 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70198 files and directories currently installed.) 439s Removing libtirpc3:ppc64el (1.3.4+ds-1build1) ... 439s Selecting previously unselected package libtirpc3t64:ppc64el. 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70192 files and directories currently installed.) 439s Preparing to unpack .../libtirpc3t64_1.3.4+ds-1.1_ppc64el.deb ... 439s Adding 'diversion of /lib/powerpc64le-linux-gnu/libtirpc.so.3 to /lib/powerpc64le-linux-gnu/libtirpc.so.3.usr-is-merged by libtirpc3t64' 439s Adding 'diversion of /lib/powerpc64le-linux-gnu/libtirpc.so.3.0.0 to /lib/powerpc64le-linux-gnu/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' 439s Unpacking libtirpc3t64:ppc64el (1.3.4+ds-1.1) ... 439s Preparing to unpack .../multipath-tools_0.9.4-5ubuntu6_ppc64el.deb ... 439s Unpacking multipath-tools (0.9.4-5ubuntu6) over (0.9.4-5ubuntu3) ... 439s dpkg: liburcu8:ppc64el: dependency problems, but removing anyway as you requested: 439s xfsprogs depends on liburcu8 (>= 0.13.0). 439s 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70202 files and directories currently installed.) 439s Removing liburcu8:ppc64el (0.14.0-3) ... 439s Selecting previously unselected package liburcu8t64:ppc64el. 439s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70183 files and directories currently installed.) 439s Preparing to unpack .../liburcu8t64_0.14.0-3.1_ppc64el.deb ... 439s Unpacking liburcu8t64:ppc64el (0.14.0-3.1) ... 440s Preparing to unpack .../bind9-host_1%3a9.18.24-0ubuntu3_ppc64el.deb ... 440s Unpacking bind9-host (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 440s Preparing to unpack .../bind9-dnsutils_1%3a9.18.24-0ubuntu3_ppc64el.deb ... 440s Unpacking bind9-dnsutils (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 440s Preparing to unpack .../bind9-libs_1%3a9.18.24-0ubuntu3_ppc64el.deb ... 440s Unpacking bind9-libs:ppc64el (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70203 files and directories currently installed.) 440s Removing libuv1:ppc64el (1.48.0-1) ... 440s Selecting previously unselected package libuv1t64:ppc64el. 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70198 files and directories currently installed.) 440s Preparing to unpack .../libuv1t64_1.48.0-1.1_ppc64el.deb ... 440s Unpacking libuv1t64:ppc64el (1.48.0-1.1) ... 440s Preparing to unpack .../liblocale-gettext-perl_1.07-6ubuntu4_ppc64el.deb ... 440s Unpacking liblocale-gettext-perl (1.07-6ubuntu4) over (1.07-6build1) ... 440s Preparing to unpack .../uuid-runtime_2.39.3-9ubuntu2_ppc64el.deb ... 440s Unpacking uuid-runtime (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 440s Preparing to unpack .../libdebconfclient0_0.271ubuntu2_ppc64el.deb ... 440s Unpacking libdebconfclient0:ppc64el (0.271ubuntu2) over (0.271ubuntu1) ... 440s Setting up libdebconfclient0:ppc64el (0.271ubuntu2) ... 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70204 files and directories currently installed.) 440s Preparing to unpack .../libsemanage-common_3.5-1build4_all.deb ... 440s Unpacking libsemanage-common (3.5-1build4) over (3.5-1build2) ... 440s Setting up libsemanage-common (3.5-1build4) ... 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70204 files and directories currently installed.) 440s Preparing to unpack .../libsemanage2_3.5-1build4_ppc64el.deb ... 440s Unpacking libsemanage2:ppc64el (3.5-1build4) over (3.5-1build2) ... 440s Setting up libsemanage2:ppc64el (3.5-1build4) ... 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70204 files and directories currently installed.) 440s Preparing to unpack .../install-info_7.1-3build1_ppc64el.deb ... 440s Unpacking install-info (7.1-3build1) over (7.1-3) ... 440s Setting up install-info (7.1-3build1) ... 440s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70204 files and directories currently installed.) 440s Preparing to unpack .../000-gcc-13-base_13.2.0-21ubuntu1_ppc64el.deb ... 440s Unpacking gcc-13-base:ppc64el (13.2.0-21ubuntu1) over (13.2.0-17ubuntu2) ... 440s Preparing to unpack .../001-libss2_1.47.0-2.4~exp1ubuntu2_ppc64el.deb ... 440s Unpacking libss2:ppc64el (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 440s Preparing to unpack .../002-dmsetup_2%3a1.02.185-3ubuntu2_ppc64el.deb ... 440s Unpacking dmsetup (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 440s Preparing to unpack .../003-eject_2.39.3-9ubuntu2_ppc64el.deb ... 440s Unpacking eject (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 440s Preparing to unpack .../004-krb5-locales_1.20.1-6ubuntu1_all.deb ... 440s Unpacking krb5-locales (1.20.1-6ubuntu1) over (1.20.1-5build1) ... 440s Preparing to unpack .../005-libglib2.0-data_2.79.3-3ubuntu5_all.deb ... 440s Unpacking libglib2.0-data (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 440s Preparing to unpack .../006-libslang2_2.3.3-3build1_ppc64el.deb ... 440s Unpacking libslang2:ppc64el (2.3.3-3build1) over (2.3.3-3) ... 440s Preparing to unpack .../007-libtext-charwidth-perl_0.04-11build2_ppc64el.deb ... 440s Unpacking libtext-charwidth-perl:ppc64el (0.04-11build2) over (0.04-11build1) ... 440s Preparing to unpack .../008-libtext-iconv-perl_1.7-8build2_ppc64el.deb ... 440s Unpacking libtext-iconv-perl:ppc64el (1.7-8build2) over (1.7-8build1) ... 440s Preparing to unpack .../009-python3-yaml_6.0.1-2build1_ppc64el.deb ... 440s Unpacking python3-yaml (6.0.1-2build1) over (6.0.1-2) ... 440s Preparing to unpack .../010-python3-setuptools_68.1.2-2ubuntu1_all.deb ... 441s Unpacking python3-setuptools (68.1.2-2ubuntu1) over (68.1.2-2) ... 441s Preparing to unpack .../011-python3-pkg-resources_68.1.2-2ubuntu1_all.deb ... 441s Unpacking python3-pkg-resources (68.1.2-2ubuntu1) over (68.1.2-2) ... 441s Preparing to unpack .../012-rsyslog_8.2312.0-3ubuntu7_ppc64el.deb ... 441s Unpacking rsyslog (8.2312.0-3ubuntu7) over (8.2312.0-3ubuntu3) ... 441s Preparing to unpack .../013-vim-tiny_2%3a9.1.0016-1ubuntu6_ppc64el.deb ... 441s Unpacking vim-tiny (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ... 441s Preparing to unpack .../014-vim-common_2%3a9.1.0016-1ubuntu6_all.deb ... 441s Unpacking vim-common (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ... 441s Selecting previously unselected package xdg-user-dirs. 441s Preparing to unpack .../015-xdg-user-dirs_0.18-1_ppc64el.deb ... 441s Unpacking xdg-user-dirs (0.18-1) ... 441s Preparing to unpack .../016-xxd_2%3a9.1.0016-1ubuntu6_ppc64el.deb ... 441s Unpacking xxd (2:9.1.0016-1ubuntu6) over (2:9.1.0016-1ubuntu2) ... 441s Preparing to unpack .../017-apparmor_4.0.0-beta3-0ubuntu2_ppc64el.deb ... 441s Unpacking apparmor (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 442s Preparing to unpack .../018-ftp_20230507-2build1_all.deb ... 442s Unpacking ftp (20230507-2build1) over (20230507-2) ... 442s Preparing to unpack .../019-inetutils-telnet_2%3a2.5-3ubuntu3_ppc64el.deb ... 442s Unpacking inetutils-telnet (2:2.5-3ubuntu3) over (2:2.5-3ubuntu1) ... 442s Preparing to unpack .../020-info_7.1-3build1_ppc64el.deb ... 442s Unpacking info (7.1-3build1) over (7.1-3) ... 442s Preparing to unpack .../021-libusb-1.0-0_2%3a1.0.27-1_ppc64el.deb ... 442s Unpacking libusb-1.0-0:ppc64el (2:1.0.27-1) over (2:1.0.26-1) ... 442s Preparing to unpack .../022-libxmuu1_2%3a1.1.3-3build1_ppc64el.deb ... 442s Unpacking libxmuu1:ppc64el (2:1.1.3-3build1) over (2:1.1.3-3) ... 442s Preparing to unpack .../023-lshw_02.19.git.2021.06.19.996aaad9c7-2build2_ppc64el.deb ... 442s Unpacking lshw (02.19.git.2021.06.19.996aaad9c7-2build2) over (02.19.git.2021.06.19.996aaad9c7-2build1) ... 442s Selecting previously unselected package manpages. 442s Preparing to unpack .../024-manpages_6.05.01-1_all.deb ... 442s Unpacking manpages (6.05.01-1) ... 442s Preparing to unpack .../025-mtr-tiny_0.95-1.1build1_ppc64el.deb ... 442s Unpacking mtr-tiny (0.95-1.1build1) over (0.95-1.1) ... 442s Preparing to unpack .../026-plymouth-theme-ubuntu-text_24.004.60-1ubuntu6_ppc64el.deb ... 442s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 442s Preparing to unpack .../027-plymouth_24.004.60-1ubuntu6_ppc64el.deb ... 442s Unpacking plymouth (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 442s Preparing to unpack .../028-telnet_0.17+2.5-3ubuntu3_all.deb ... 442s Unpacking telnet (0.17+2.5-3ubuntu3) over (0.17+2.5-3ubuntu1) ... 442s Preparing to unpack .../029-usb.ids_2024.03.18-1_all.deb ... 442s Unpacking usb.ids (2024.03.18-1) over (2024.01.30-1) ... 442s Preparing to unpack .../030-xz-utils_5.6.0-0.2_ppc64el.deb ... 442s Unpacking xz-utils (5.6.0-0.2) over (5.4.5-0.3) ... 442s Preparing to unpack .../031-libctf0_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking libctf0:ppc64el (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../032-libctf-nobfd0_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking libctf-nobfd0:ppc64el (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../033-binutils-powerpc64le-linux-gnu_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking binutils-powerpc64le-linux-gnu (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../034-libbinutils_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking libbinutils:ppc64el (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../035-binutils_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking binutils (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../036-binutils-common_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking binutils-common:ppc64el (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Preparing to unpack .../037-libsframe1_2.42-4ubuntu1_ppc64el.deb ... 442s Unpacking libsframe1:ppc64el (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 442s Selecting previously unselected package libllvm18:ppc64el. 442s Preparing to unpack .../038-libllvm18_1%3a18.1.2-1ubuntu2_ppc64el.deb ... 442s Unpacking libllvm18:ppc64el (1:18.1.2-1ubuntu2) ... 444s Selecting previously unselected package libclang-cpp18. 444s Preparing to unpack .../039-libclang-cpp18_1%3a18.1.2-1ubuntu2_ppc64el.deb ... 444s Unpacking libclang-cpp18 (1:18.1.2-1ubuntu2) ... 444s Selecting previously unselected package libbpfcc:ppc64el. 444s Preparing to unpack .../040-libbpfcc_0.29.1+ds-1ubuntu4_ppc64el.deb ... 444s Unpacking libbpfcc:ppc64el (0.29.1+ds-1ubuntu4) ... 444s Selecting previously unselected package python3-bpfcc. 444s Preparing to unpack .../041-python3-bpfcc_0.29.1+ds-1ubuntu4_all.deb ... 444s Unpacking python3-bpfcc (0.29.1+ds-1ubuntu4) ... 444s Selecting previously unselected package ieee-data. 444s Preparing to unpack .../042-ieee-data_20220827.1_all.deb ... 444s Unpacking ieee-data (20220827.1) ... 444s Selecting previously unselected package python3-netaddr. 444s Preparing to unpack .../043-python3-netaddr_0.8.0-2ubuntu1_all.deb ... 444s Unpacking python3-netaddr (0.8.0-2ubuntu1) ... 444s Selecting previously unselected package bpfcc-tools. 444s Preparing to unpack .../044-bpfcc-tools_0.29.1+ds-1ubuntu4_all.deb ... 444s Unpacking bpfcc-tools (0.29.1+ds-1ubuntu4) ... 444s Selecting previously unselected package libclang1-18. 444s Preparing to unpack .../045-libclang1-18_1%3a18.1.2-1ubuntu2_ppc64el.deb ... 444s Unpacking libclang1-18 (1:18.1.2-1ubuntu2) ... 445s Selecting previously unselected package libdw1t64:ppc64el. 445s Preparing to unpack .../046-libdw1t64_0.190-1.1build2_ppc64el.deb ... 445s Unpacking libdw1t64:ppc64el (0.190-1.1build2) ... 445s Selecting previously unselected package bpftrace. 445s Preparing to unpack .../047-bpftrace_0.20.2-1ubuntu1_ppc64el.deb ... 445s Unpacking bpftrace (0.20.2-1ubuntu1) ... 445s Preparing to unpack .../048-cryptsetup-bin_2%3a2.7.0-1ubuntu2_ppc64el.deb ... 445s Unpacking cryptsetup-bin (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 445s Preparing to unpack .../049-dpkg-dev_1.22.6ubuntu4_all.deb ... 445s Unpacking dpkg-dev (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 445s Preparing to unpack .../050-libdpkg-perl_1.22.6ubuntu4_all.deb ... 445s Unpacking libdpkg-perl (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 445s Selecting previously unselected package fonts-dejavu-mono. 445s Preparing to unpack .../051-fonts-dejavu-mono_2.37-8_all.deb ... 445s Unpacking fonts-dejavu-mono (2.37-8) ... 445s Selecting previously unselected package fonts-dejavu-core. 445s Preparing to unpack .../052-fonts-dejavu-core_2.37-8_all.deb ... 445s Unpacking fonts-dejavu-core (2.37-8) ... 445s Selecting previously unselected package fontconfig-config. 445s Preparing to unpack .../053-fontconfig-config_2.15.0-1.1ubuntu1_ppc64el.deb ... 445s Unpacking fontconfig-config (2.15.0-1.1ubuntu1) ... 445s Preparing to unpack .../054-libprotobuf-c1_1.4.1-1ubuntu3_ppc64el.deb ... 445s Unpacking libprotobuf-c1:ppc64el (1.4.1-1ubuntu3) over (1.4.1-1ubuntu2) ... 445s Preparing to unpack .../055-gnupg-l10n_2.4.4-2ubuntu15_all.deb ... 445s Unpacking gnupg-l10n (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 445s Preparing to unpack .../056-libibverbs1_50.0-2build1_ppc64el.deb ... 445s Unpacking libibverbs1:ppc64el (50.0-2build1) over (50.0-2) ... 445s Preparing to unpack .../057-ibverbs-providers_50.0-2build1_ppc64el.deb ... 445s Unpacking ibverbs-providers:ppc64el (50.0-2build1) over (50.0-2) ... 445s Preparing to unpack .../058-jq_1.7.1-3_ppc64el.deb ... 445s Unpacking jq (1.7.1-3) over (1.7.1-2) ... 446s Preparing to unpack .../059-libjq1_1.7.1-3_ppc64el.deb ... 446s Unpacking libjq1:ppc64el (1.7.1-3) over (1.7.1-2) ... 446s Selecting previously unselected package libaio1t64:ppc64el. 446s Preparing to unpack .../060-libaio1t64_0.3.113-6_ppc64el.deb ... 446s Unpacking libaio1t64:ppc64el (0.3.113-6) ... 446s Selecting previously unselected package libatm1t64:ppc64el. 446s Preparing to unpack .../061-libatm1t64_1%3a2.5.1-5.1_ppc64el.deb ... 446s Unpacking libatm1t64:ppc64el (1:2.5.1-5.1) ... 446s Selecting previously unselected package libc-dev-bin. 446s Preparing to unpack .../062-libc-dev-bin_2.39-0ubuntu6_ppc64el.deb ... 446s Unpacking libc-dev-bin (2.39-0ubuntu6) ... 446s Selecting previously unselected package libfontconfig1:ppc64el. 446s Preparing to unpack .../063-libfontconfig1_2.15.0-1.1ubuntu1_ppc64el.deb ... 446s Unpacking libfontconfig1:ppc64el (2.15.0-1.1ubuntu1) ... 446s Selecting previously unselected package libjpeg-turbo8:ppc64el. 446s Preparing to unpack .../064-libjpeg-turbo8_2.1.5-2ubuntu1_ppc64el.deb ... 446s Unpacking libjpeg-turbo8:ppc64el (2.1.5-2ubuntu1) ... 446s Selecting previously unselected package libjpeg8:ppc64el. 446s Preparing to unpack .../065-libjpeg8_8c-2ubuntu11_ppc64el.deb ... 446s Unpacking libjpeg8:ppc64el (8c-2ubuntu11) ... 446s Selecting previously unselected package libdeflate0:ppc64el. 446s Preparing to unpack .../066-libdeflate0_1.19-1_ppc64el.deb ... 446s Unpacking libdeflate0:ppc64el (1.19-1) ... 446s Selecting previously unselected package libjbig0:ppc64el. 446s Preparing to unpack .../067-libjbig0_2.1-6.1ubuntu1_ppc64el.deb ... 446s Unpacking libjbig0:ppc64el (2.1-6.1ubuntu1) ... 446s Selecting previously unselected package liblerc4:ppc64el. 446s Preparing to unpack .../068-liblerc4_4.0.0+ds-4ubuntu1_ppc64el.deb ... 446s Unpacking liblerc4:ppc64el (4.0.0+ds-4ubuntu1) ... 446s Selecting previously unselected package libsharpyuv0:ppc64el. 446s Preparing to unpack .../069-libsharpyuv0_1.3.2-0.4build2_ppc64el.deb ... 446s Unpacking libsharpyuv0:ppc64el (1.3.2-0.4build2) ... 446s Selecting previously unselected package libwebp7:ppc64el. 446s Preparing to unpack .../070-libwebp7_1.3.2-0.4build2_ppc64el.deb ... 446s Unpacking libwebp7:ppc64el (1.3.2-0.4build2) ... 446s Selecting previously unselected package libtiff6:ppc64el. 446s Preparing to unpack .../071-libtiff6_4.5.1+git230720-4ubuntu1_ppc64el.deb ... 446s Unpacking libtiff6:ppc64el (4.5.1+git230720-4ubuntu1) ... 446s Selecting previously unselected package libxpm4:ppc64el. 446s Preparing to unpack .../072-libxpm4_1%3a3.5.17-1build1_ppc64el.deb ... 446s Unpacking libxpm4:ppc64el (1:3.5.17-1build1) ... 446s Selecting previously unselected package libgd3:ppc64el. 446s Preparing to unpack .../073-libgd3_2.3.3-9ubuntu3_ppc64el.deb ... 446s Unpacking libgd3:ppc64el (2.3.3-9ubuntu3) ... 446s Selecting previously unselected package libc-devtools. 446s Preparing to unpack .../074-libc-devtools_2.39-0ubuntu6_ppc64el.deb ... 446s Unpacking libc-devtools (2.39-0ubuntu6) ... 446s Selecting previously unselected package linux-libc-dev:ppc64el. 446s Preparing to unpack .../075-linux-libc-dev_6.8.0-20.20_ppc64el.deb ... 446s Unpacking linux-libc-dev:ppc64el (6.8.0-20.20) ... 446s Selecting previously unselected package libcrypt-dev:ppc64el. 446s Preparing to unpack .../076-libcrypt-dev_1%3a4.4.36-4_ppc64el.deb ... 446s Unpacking libcrypt-dev:ppc64el (1:4.4.36-4) ... 446s Selecting previously unselected package rpcsvc-proto. 446s Preparing to unpack .../077-rpcsvc-proto_1.4.2-0ubuntu6_ppc64el.deb ... 446s Unpacking rpcsvc-proto (1.4.2-0ubuntu6) ... 446s Selecting previously unselected package libc6-dev:ppc64el. 446s Preparing to unpack .../078-libc6-dev_2.39-0ubuntu6_ppc64el.deb ... 446s Unpacking libc6-dev:ppc64el (2.39-0ubuntu6) ... 446s Preparing to unpack .../079-libevent-core-2.1-7_2.1.12-stable-9build1_ppc64el.deb ... 446s Unpacking libevent-core-2.1-7:ppc64el (2.1.12-stable-9build1) over (2.1.12-stable-9) ... 446s Preparing to unpack .../080-libftdi1-2_1.5-6build4_ppc64el.deb ... 446s Unpacking libftdi1-2:ppc64el (1.5-6build4) over (1.5-6build3) ... 446s Preparing to unpack .../081-libldap-common_2.6.7+dfsg-1~exp1ubuntu6_all.deb ... 446s Unpacking libldap-common (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 446s Selecting previously unselected package libunwind8:ppc64el. 446s Preparing to unpack .../082-libunwind8_1.6.2-3_ppc64el.deb ... 446s Unpacking libunwind8:ppc64el (1.6.2-3) ... 446s Selecting previously unselected package linux-modules-6.8.0-20-generic. 446s Preparing to unpack .../083-linux-modules-6.8.0-20-generic_6.8.0-20.20_ppc64el.deb ... 446s Unpacking linux-modules-6.8.0-20-generic (6.8.0-20.20) ... 447s Selecting previously unselected package linux-image-6.8.0-20-generic. 447s Preparing to unpack .../084-linux-image-6.8.0-20-generic_6.8.0-20.20_ppc64el.deb ... 447s Unpacking linux-image-6.8.0-20-generic (6.8.0-20.20) ... 447s Selecting previously unselected package linux-modules-extra-6.8.0-20-generic. 447s Preparing to unpack .../085-linux-modules-extra-6.8.0-20-generic_6.8.0-20.20_ppc64el.deb ... 447s Unpacking linux-modules-extra-6.8.0-20-generic (6.8.0-20.20) ... 449s Preparing to unpack .../086-linux-generic_6.8.0-20.20+1_ppc64el.deb ... 449s Unpacking linux-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 449s Preparing to unpack .../087-linux-image-generic_6.8.0-20.20+1_ppc64el.deb ... 449s Unpacking linux-image-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 449s Preparing to unpack .../088-linux-virtual_6.8.0-20.20+1_ppc64el.deb ... 449s Unpacking linux-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 449s Preparing to unpack .../089-linux-image-virtual_6.8.0-20.20+1_ppc64el.deb ... 449s Unpacking linux-image-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 449s Preparing to unpack .../090-linux-headers-virtual_6.8.0-20.20+1_ppc64el.deb ... 449s Unpacking linux-headers-virtual (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 449s Selecting previously unselected package linux-headers-6.8.0-20. 449s Preparing to unpack .../091-linux-headers-6.8.0-20_6.8.0-20.20_all.deb ... 449s Unpacking linux-headers-6.8.0-20 (6.8.0-20.20) ... 452s Selecting previously unselected package linux-headers-6.8.0-20-generic. 452s Preparing to unpack .../092-linux-headers-6.8.0-20-generic_6.8.0-20.20_ppc64el.deb ... 452s Unpacking linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 454s Preparing to unpack .../093-linux-headers-generic_6.8.0-20.20+1_ppc64el.deb ... 454s Unpacking linux-headers-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 454s Selecting previously unselected package linux-tools-common. 454s Preparing to unpack .../094-linux-tools-common_6.8.0-20.20_all.deb ... 454s Unpacking linux-tools-common (6.8.0-20.20) ... 454s Selecting previously unselected package linux-tools-6.8.0-20. 454s Preparing to unpack .../095-linux-tools-6.8.0-20_6.8.0-20.20_ppc64el.deb ... 454s Unpacking linux-tools-6.8.0-20 (6.8.0-20.20) ... 454s Selecting previously unselected package linux-tools-6.8.0-20-generic. 454s Preparing to unpack .../096-linux-tools-6.8.0-20-generic_6.8.0-20.20_ppc64el.deb ... 454s Unpacking linux-tools-6.8.0-20-generic (6.8.0-20.20) ... 454s Selecting previously unselected package manpages-dev. 454s Preparing to unpack .../097-manpages-dev_6.05.01-1_all.deb ... 454s Unpacking manpages-dev (6.05.01-1) ... 454s Preparing to unpack .../098-python3-distutils_3.12.2-3ubuntu1.1_all.deb ... 454s Unpacking python3-distutils (3.12.2-3ubuntu1.1) over (3.11.5-1) ... 454s Preparing to unpack .../099-python3-lib2to3_3.12.2-3ubuntu1.1_all.deb ... 454s Unpacking python3-lib2to3 (3.12.2-3ubuntu1.1) over (3.11.5-1) ... 454s Preparing to unpack .../100-python3-pyrsistent_0.20.0-1build1_ppc64el.deb ... 454s Unpacking python3-pyrsistent:ppc64el (0.20.0-1build1) over (0.20.0-1) ... 454s Preparing to unpack .../101-python3-typing-extensions_4.10.0-1_all.deb ... 454s Unpacking python3-typing-extensions (4.10.0-1) over (4.9.0-1) ... 455s Selecting previously unselected package ubuntu-kernel-accessories. 455s Preparing to unpack .../102-ubuntu-kernel-accessories_1.536build1_ppc64el.deb ... 455s Unpacking ubuntu-kernel-accessories (1.536build1) ... 455s Preparing to unpack .../103-kpartx_0.9.4-5ubuntu6_ppc64el.deb ... 455s Unpacking kpartx (0.9.4-5ubuntu6) over (0.9.4-5ubuntu3) ... 455s Setting up pinentry-curses (1.2.1-3ubuntu4) ... 455s Setting up motd-news-config (13ubuntu8) ... 455s Setting up libtext-iconv-perl:ppc64el (1.7-8build2) ... 455s Setting up libtext-charwidth-perl:ppc64el (0.04-11build2) ... 455s Setting up libsharpyuv0:ppc64el (1.3.2-0.4build2) ... 455s Setting up liburcu8t64:ppc64el (0.14.0-3.1) ... 455s Setting up tcpdump (4.99.4-3ubuntu2) ... 455s Setting up libibverbs1:ppc64el (50.0-2build1) ... 455s Setting up systemd-sysv (255.4-1ubuntu5) ... 455s Setting up ubuntu-kernel-accessories (1.536build1) ... 455s Setting up libapparmor1:ppc64el (4.0.0-beta3-0ubuntu2) ... 455s Setting up libatm1t64:ppc64el (1:2.5.1-5.1) ... 455s Setting up liblerc4:ppc64el (4.0.0+ds-4ubuntu1) ... 455s Setting up libgdbm6t64:ppc64el (1.23-5.1) ... 455s Setting up bsdextrautils (2.39.3-9ubuntu2) ... 455s Setting up libxpm4:ppc64el (1:3.5.17-1build1) ... 455s Setting up libgdbm-compat4t64:ppc64el (1.23-5.1) ... 455s Setting up xdg-user-dirs (0.18-1) ... 455s Setting up ibverbs-providers:ppc64el (50.0-2build1) ... 455s Setting up linux-headers-6.8.0-20 (6.8.0-20.20) ... 455s Setting up libmagic-mgc (1:5.45-3) ... 455s Setting up gawk (1:5.2.1-2build2) ... 455s Setting up libjq1:ppc64el (1.7.1-3) ... 455s Setting up manpages (6.05.01-1) ... 455s Setting up libtirpc-common (1.3.4+ds-1.1) ... 455s Setting up libbrotli1:ppc64el (1.1.0-2build1) ... 455s Setting up libsqlite3-0:ppc64el (3.45.1-1ubuntu1) ... 455s Setting up libsasl2-modules:ppc64el (2.1.28+dfsg1-5ubuntu1) ... 455s Setting up libuv1t64:ppc64el (1.48.0-1.1) ... 455s Setting up libmagic1t64:ppc64el (1:5.45-3) ... 455s Setting up rsyslog (8.2312.0-3ubuntu7) ... 455s info: The user `syslog' is already a member of `adm'. 456s Setting up binutils-common:ppc64el (2.42-4ubuntu1) ... 456s Setting up libpsl5t64:ppc64el (0.21.2-1.1) ... 456s Setting up libnghttp2-14:ppc64el (1.59.0-1build1) ... 456s Setting up libdeflate0:ppc64el (1.19-1) ... 456s Setting up linux-libc-dev:ppc64el (6.8.0-20.20) ... 456s Setting up bc (1.07.1-3ubuntu2) ... 456s Setting up libctf-nobfd0:ppc64el (2.42-4ubuntu1) ... 456s Setting up libnss-systemd:ppc64el (255.4-1ubuntu5) ... 456s Setting up krb5-locales (1.20.1-6ubuntu1) ... 456s Setting up libcom-err2:ppc64el (1.47.0-2.4~exp1ubuntu2) ... 456s Setting up file (1:5.45-3) ... 456s Setting up lshw (02.19.git.2021.06.19.996aaad9c7-2build2) ... 456s Setting up libldap-common (2.6.7+dfsg-1~exp1ubuntu6) ... 456s Setting up libunwind8:ppc64el (1.6.2-3) ... 456s Setting up libprotobuf-c1:ppc64el (1.4.1-1ubuntu3) ... 456s Setting up libjbig0:ppc64el (2.1-6.1ubuntu1) ... 456s Setting up xxd (2:9.1.0016-1ubuntu6) ... 456s Setting up libsframe1:ppc64el (2.42-4ubuntu1) ... 456s Setting up libelf1t64:ppc64el (0.190-1.1build2) ... 456s Setting up libkrb5support0:ppc64el (1.20.1-6ubuntu1) ... 456s Setting up libdw1t64:ppc64el (0.190-1.1build2) ... 456s Setting up linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 456s Setting up eject (2.39.3-9ubuntu2) ... 456s Setting up apparmor (4.0.0-beta3-0ubuntu2) ... 456s Installing new version of config file /etc/apparmor.d/abstractions/authentication ... 456s Installing new version of config file /etc/apparmor.d/abstractions/crypto ... 456s Installing new version of config file /etc/apparmor.d/abstractions/kde-open5 ... 456s Installing new version of config file /etc/apparmor.d/abstractions/openssl ... 456s Installing new version of config file /etc/apparmor.d/code ... 456s Installing new version of config file /etc/apparmor.d/firefox ... 457s Reloading AppArmor profiles 458s Setting up libglib2.0-0t64:ppc64el (2.79.3-3ubuntu5) ... 458s No schema files found: doing nothing. 458s Setting up libglib2.0-data (2.79.3-3ubuntu5) ... 458s Setting up rpcsvc-proto (1.4.2-0ubuntu6) ... 458s Setting up vim-common (2:9.1.0016-1ubuntu6) ... 458s Setting up gcc-13-base:ppc64el (13.2.0-21ubuntu1) ... 458s Setting up libqrtr-glib0:ppc64el (1.2.2-1ubuntu3) ... 458s Setting up libslang2:ppc64el (2.3.3-3build1) ... 458s Setting up libnvme1t64 (1.8-3) ... 458s Setting up mtr-tiny (0.95-1.1build1) ... 458s Setting up gnupg-l10n (2.4.4-2ubuntu15) ... 458s Setting up librtmp1:ppc64el (2.4+20151223.gitfa8646d.1-2build6) ... 458s Setting up libdbus-1-3:ppc64el (1.14.10-4ubuntu2) ... 458s Setting up xz-utils (5.6.0-0.2) ... 458s Setting up perl-modules-5.38 (5.38.2-3.2) ... 458s Setting up libproc2-0:ppc64el (2:4.0.4-4ubuntu2) ... 458s Setting up fonts-dejavu-mono (2.37-8) ... 458s Setting up libpng16-16t64:ppc64el (1.6.43-3) ... 458s Setting up systemd-timesyncd (255.4-1ubuntu5) ... 459s Setting up libevent-core-2.1-7:ppc64el (2.1.12-stable-9build1) ... 459s Setting up libss2:ppc64el (1.47.0-2.4~exp1ubuntu2) ... 459s Setting up usb.ids (2024.03.18-1) ... 459s Setting up sudo (1.9.15p5-3ubuntu3) ... 459s Setting up fonts-dejavu-core (2.37-8) ... 459s Setting up dhcpcd-base (1:10.0.6-1ubuntu2) ... 459s Setting up gir1.2-glib-2.0:ppc64el (2.79.3-3ubuntu5) ... 459s Setting up libk5crypto3:ppc64el (1.20.1-6ubuntu1) ... 459s Setting up libjpeg-turbo8:ppc64el (2.1.5-2ubuntu1) ... 459s Setting up logsave (1.47.0-2.4~exp1ubuntu2) ... 459s Setting up libwebp7:ppc64el (1.3.2-0.4build2) ... 459s Setting up libfdisk1:ppc64el (2.39.3-9ubuntu2) ... 459s Setting up libdb5.3t64:ppc64el (5.3.28+dfsg2-6) ... 459s Setting up libdevmapper1.02.1:ppc64el (2:1.02.185-3ubuntu2) ... 459s Setting up libaio1t64:ppc64el (0.3.113-6) ... 459s Setting up python-apt-common (2.7.7) ... 459s Setting up mount (2.39.3-9ubuntu2) ... 459s Setting up dmsetup (2:1.02.185-3ubuntu2) ... 459s Setting up uuid-runtime (2.39.3-9ubuntu2) ... 460s uuidd.service is a disabled or a static unit not running, not starting it. 460s Setting up libmm-glib0:ppc64el (1.23.4-0ubuntu1) ... 460s Setting up groff-base (1.23.0-3build1) ... 460s Setting up libcrypt-dev:ppc64el (1:4.4.36-4) ... 460s Setting up libplymouth5:ppc64el (24.004.60-1ubuntu6) ... 460s Setting up dbus-session-bus-common (1.14.10-4ubuntu2) ... 460s Setting up jq (1.7.1-3) ... 460s Setting up procps (2:4.0.4-4ubuntu2) ... 460s Setting up gpgconf (2.4.4-2ubuntu15) ... 460s Setting up libcryptsetup12:ppc64el (2:2.7.0-1ubuntu2) ... 460s Setting up libgirepository-1.0-1:ppc64el (1.79.1-1ubuntu6) ... 460s Setting up libjson-glib-1.0-common (1.8.0-2build1) ... 460s Setting up libkrb5-3:ppc64el (1.20.1-6ubuntu1) ... 460s Setting up libpython3.11-minimal:ppc64el (3.11.8-1build4) ... 460s Setting up libusb-1.0-0:ppc64el (2:1.0.27-1) ... 460s Setting up libperl5.38t64:ppc64el (5.38.2-3.2) ... 460s Setting up tnftp (20230507-2build1) ... 460s Setting up libbinutils:ppc64el (2.42-4ubuntu1) ... 460s Setting up dbus-system-bus-common (1.14.10-4ubuntu2) ... 460s Setting up libfido2-1:ppc64el (1.14.0-1build1) ... 460s Setting up libc-dev-bin (2.39-0ubuntu6) ... 460s Setting up openssl (3.0.13-0ubuntu2) ... 460s Setting up linux-modules-6.8.0-20-generic (6.8.0-20.20) ... 464s Setting up linux-tools-common (6.8.0-20.20) ... 464s Setting up readline-common (8.2-4) ... 464s Setting up libxml2:ppc64el (2.9.14+dfsg-1.3ubuntu2) ... 464s Setting up libxmuu1:ppc64el (2:1.1.3-3build1) ... 464s Setting up dbus-bin (1.14.10-4ubuntu2) ... 464s Setting up info (7.1-3build1) ... 464s Setting up liblocale-gettext-perl (1.07-6ubuntu4) ... 464s Setting up gpg (2.4.4-2ubuntu15) ... 464s Setting up libgudev-1.0-0:ppc64el (1:238-3ubuntu2) ... 464s Setting up libpolkit-gobject-1-0:ppc64el (124-1ubuntu1) ... 464s Setting up libbpf1:ppc64el (1:1.3.0-2build1) ... 464s Setting up libmbim-glib4:ppc64el (1.31.2-0ubuntu2) ... 464s Setting up rsync (3.2.7-1build1) ... 465s rsync.service is a disabled or a static unit not running, not starting it. 465s Setting up libudisks2-0:ppc64el (2.10.1-6) ... 465s Setting up libkmod2:ppc64el (31+20240202-2ubuntu4) ... 465s Setting up bolt (0.9.6-2build1) ... 466s bolt.service is a disabled or a static unit not running, not starting it. 466s Setting up libllvm18:ppc64el (1:18.1.2-1ubuntu2) ... 466s Setting up gnupg-utils (2.4.4-2ubuntu15) ... 466s Setting up initramfs-tools-bin (0.142ubuntu23) ... 466s Setting up libctf0:ppc64el (2.42-4ubuntu1) ... 466s Setting up libjpeg8:ppc64el (8c-2ubuntu11) ... 466s Setting up cryptsetup-bin (2:2.7.0-1ubuntu2) ... 466s Setting up python3.11-minimal (3.11.8-1build4) ... 468s Setting up libclang1-18 (1:18.1.2-1ubuntu2) ... 468s Setting up manpages-dev (6.05.01-1) ... 468s Setting up linux-modules-extra-6.8.0-20-generic (6.8.0-20.20) ... 470s Setting up apt-utils (2.7.14) ... 470s Setting up gpg-agent (2.4.4-2ubuntu15) ... 470s Setting up libpython3.12-stdlib:ppc64el (3.12.2-4build3) ... 470s Setting up wget (1.21.4-1ubuntu2) ... 470s Setting up fontconfig-config (2.15.0-1.1ubuntu1) ... 471s Setting up libxmlb2:ppc64el (0.3.15-1build1) ... 471s Setting up libpython3.11-stdlib:ppc64el (3.11.8-1build4) ... 471s Setting up python3.12 (3.12.2-4build3) ... 472s Setting up gpgsm (2.4.4-2ubuntu15) ... 472s Setting up inetutils-telnet (2:2.5-3ubuntu3) ... 472s Setting up libreiserfscore0t64 (1:3.6.27-7.1) ... 472s Setting up e2fsprogs (1.47.0-2.4~exp1ubuntu2) ... 472s update-initramfs: deferring update (trigger activated) 473s e2scrub_all.service is a disabled or a static unit not running, not starting it. 473s Setting up linux-tools-6.8.0-20 (6.8.0-20.20) ... 473s Setting up libparted2t64:ppc64el (3.6-3.1build2) ... 473s Setting up linux-headers-generic (6.8.0-20.20+1) ... 473s Setting up dbus-daemon (1.14.10-4ubuntu2) ... 473s Setting up libmbim-proxy (1.31.2-0ubuntu2) ... 473s Setting up vim-tiny (2:9.1.0016-1ubuntu6) ... 473s Setting up kmod (31+20240202-2ubuntu4) ... 473s Setting up libnetplan1:ppc64el (1.0-1) ... 473s Setting up man-db (2.12.0-3build4) ... 474s Updating database of manual pages ... 477s man-db.service is a disabled or a static unit not running, not starting it. 477s Setting up fdisk (2.39.3-9ubuntu2) ... 477s Setting up libjson-glib-1.0-0:ppc64el (1.8.0-2build1) ... 477s Setting up libsasl2-modules-db:ppc64el (2.1.28+dfsg1-5ubuntu1) ... 477s Setting up libftdi1-2:ppc64el (1.5-6build4) ... 477s Setting up perl (5.38.2-3.2) ... 477s Setting up libfreetype6:ppc64el (2.13.2+dfsg-1build2) ... 477s Setting up linux-tools-6.8.0-20-generic (6.8.0-20.20) ... 477s Setting up gir1.2-girepository-2.0:ppc64el (1.79.1-1ubuntu6) ... 477s Setting up dbus (1.14.10-4ubuntu2) ... 477s A reboot is required to replace the running dbus-daemon. 477s Please reboot the system when convenient. 477s Setting up shared-mime-info (2.4-1build1) ... 478s Setting up libblockdev-utils3:ppc64el (3.1.0-1build1) ... 478s Setting up libgssapi-krb5-2:ppc64el (1.20.1-6ubuntu1) ... 478s Setting up udev (255.4-1ubuntu5) ... 479s Setting up ftp (20230507-2build1) ... 479s Setting up keyboxd (2.4.4-2ubuntu15) ... 479s Setting up libdpkg-perl (1.22.6ubuntu4) ... 479s Setting up libsasl2-2:ppc64el (2.1.28+dfsg1-5ubuntu1) ... 479s Setting up libssh-4:ppc64el (0.10.6-2build1) ... 479s Setting up libblockdev-nvme3:ppc64el (3.1.0-1build1) ... 479s Setting up libblockdev-fs3:ppc64el (3.1.0-1build1) ... 479s Setting up ieee-data (20220827.1) ... 479s Setting up libtiff6:ppc64el (4.5.1+git230720-4ubuntu1) ... 479s Setting up kpartx (0.9.4-5ubuntu6) ... 479s Setting up libpam-systemd:ppc64el (255.4-1ubuntu5) ... 479s Setting up libpolkit-agent-1-0:ppc64el (124-1ubuntu1) ... 479s Setting up libc6-dev:ppc64el (2.39-0ubuntu6) ... 479s Setting up libgpgme11t64:ppc64el (1.18.0-4.1ubuntu3) ... 479s Setting up libfontconfig1:ppc64el (2.15.0-1.1ubuntu1) ... 479s Setting up binutils-powerpc64le-linux-gnu (2.42-4ubuntu1) ... 479s Setting up netplan-generator (1.0-1) ... 479s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 479s Setting up initramfs-tools-core (0.142ubuntu23) ... 479s Setting up libclang-cpp18 (1:18.1.2-1ubuntu2) ... 479s Setting up libbpfcc:ppc64el (0.29.1+ds-1ubuntu4) ... 479s Setting up libarchive13t64:ppc64el (3.7.2-1.1ubuntu2) ... 479s Setting up libldap2:ppc64el (2.6.7+dfsg-1~exp1ubuntu6) ... 479s Setting up libpython3-stdlib:ppc64el (3.12.2-0ubuntu1) ... 479s Setting up systemd-resolved (255.4-1ubuntu5) ... 480s Setting up python3.11 (3.11.8-1build4) ... 481s Setting up telnet (0.17+2.5-3ubuntu3) ... 481s Setting up initramfs-tools (0.142ubuntu23) ... 481s update-initramfs: deferring update (trigger activated) 481s Setting up libblockdev-mdraid3:ppc64el (3.1.0-1build1) ... 481s Setting up linux-headers-virtual (6.8.0-20.20+1) ... 481s Setting up libcurl4t64:ppc64el (8.5.0-2ubuntu8) ... 481s Setting up bpftrace (0.20.2-1ubuntu1) ... 481s Setting up bind9-libs:ppc64el (1:9.18.24-0ubuntu3) ... 481s Setting up linux-image-6.8.0-20-generic (6.8.0-20.20) ... 485s I: /boot/vmlinux is now a symlink to vmlinux-6.8.0-20-generic 485s I: /boot/initrd.img is now a symlink to initrd.img-6.8.0-20-generic 485s Setting up libtirpc3t64:ppc64el (1.3.4+ds-1.1) ... 485s Setting up e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) ... 485s Setting up libblockdev-swap3:ppc64el (3.1.0-1build1) ... 485s Setting up plymouth (24.004.60-1ubuntu6) ... 485s update-initramfs: Generating /boot/initrd.img-6.8.0-11-generic 485s W: No lz4 in /usr/bin:/sbin:/bin, using gzip 492s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 493s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 493s Setting up iproute2 (6.1.0-1ubuntu5) ... 493s Setting up openssh-client (1:9.6p1-3ubuntu11) ... 493s Setting up libgusb2:ppc64el (0.4.8-1build1) ... 493s Setting up btrfs-progs (6.6.3-1.1build1) ... 493s Setting up libblockdev-loop3:ppc64el (3.1.0-1build1) ... 493s Setting up libcurl3t64-gnutls:ppc64el (8.5.0-2ubuntu8) ... 493s Setting up parted (3.6-3.1build2) ... 494s Setting up libqmi-glib5:ppc64el (1.35.2-0ubuntu1) ... 494s Setting up python3 (3.12.2-0ubuntu1) ... 494s Setting up binutils (2.42-4ubuntu1) ... 494s Setting up libblockdev3:ppc64el (3.1.0-1build1) ... 494s Setting up libjcat1:ppc64el (0.2.0-2build2) ... 494s Setting up multipath-tools (0.9.4-5ubuntu6) ... 495s Setting up dpkg-dev (1.22.6ubuntu4) ... 495s Setting up libblockdev-part3:ppc64el (3.1.0-1build1) ... 495s Setting up dirmngr (2.4.4-2ubuntu15) ... 495s Setting up dbus-user-session (1.14.10-4ubuntu2) ... 495s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) ... 495s update-initramfs: deferring update (trigger activated) 495s Setting up python3-cryptography (41.0.7-4build2) ... 495s Setting up python3-gi (3.47.0-3build1) ... 496s Setting up libgd3:ppc64el (2.3.3-9ubuntu3) ... 496s Setting up python3-typing-extensions (4.10.0-1) ... 496s Setting up lsof (4.95.0-1build2) ... 496s Setting up python3-pyrsistent:ppc64el (0.20.0-1build1) ... 496s Setting up python3-netaddr (0.8.0-2ubuntu1) ... 496s Setting up libnsl2:ppc64el (1.3.0-3build2) ... 496s Setting up gnupg (2.4.4-2ubuntu15) ... 496s Setting up python3-netplan (1.0-1) ... 496s Setting up curl (8.5.0-2ubuntu8) ... 496s Setting up libvolume-key1:ppc64el (0.3.12-7build1) ... 496s Setting up linux-image-virtual (6.8.0-20.20+1) ... 496s Setting up bind9-host (1:9.18.24-0ubuntu3) ... 496s Setting up python3-lib2to3 (3.12.2-3ubuntu1.1) ... 497s Setting up python3-bpfcc (0.29.1+ds-1ubuntu4) ... 497s Setting up libc-devtools (2.39-0ubuntu6) ... 497s Setting up python3-pkg-resources (68.1.2-2ubuntu1) ... 497s Setting up python3-distutils (3.12.2-3ubuntu1.1) ... 497s python3.12: can't get files for byte-compilation 497s Setting up openssh-sftp-server (1:9.6p1-3ubuntu11) ... 497s Setting up linux-image-generic (6.8.0-20.20+1) ... 497s Setting up python3-dbus (1.3.2-5build2) ... 498s Setting up python3-setuptools (68.1.2-2ubuntu1) ... 498s Setting up gpg-wks-client (2.4.4-2ubuntu15) ... 498s Setting up openssh-server (1:9.6p1-3ubuntu11) ... 499s Replacing config file /etc/ssh/sshd_config with new version 501s Created symlink /etc/systemd/system/ssh.service.requires/ssh.socket → /usr/lib/systemd/system/ssh.socket. 502s Setting up linux-generic (6.8.0-20.20+1) ... 502s Setting up libblockdev-crypto3:ppc64el (3.1.0-1build1) ... 502s Setting up python3-gdbm:ppc64el (3.12.2-3ubuntu1.1) ... 502s Setting up python3-apt (2.7.7) ... 503s Setting up libfwupd2:ppc64el (1.9.15-2) ... 503s Setting up python3-yaml (6.0.1-2build1) ... 503s Setting up libqmi-proxy (1.35.2-0ubuntu1) ... 503s Setting up netplan.io (1.0-1) ... 503s Setting up linux-virtual (6.8.0-20.20+1) ... 503s Setting up grub-common (2.12-1ubuntu5) ... 504s Setting up bpfcc-tools (0.29.1+ds-1ubuntu4) ... 504s Setting up bind9-dnsutils (1:9.18.24-0ubuntu3) ... 504s Setting up ubuntu-pro-client (31.2.2) ... 505s Setting up fwupd (1.9.15-2) ... 506s fwupd-offline-update.service is a disabled or a static unit not running, not starting it. 506s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 506s Setting up ubuntu-pro-client-l10n (31.2.2) ... 506s Setting up udisks2 (2.10.1-6) ... 507s Setting up grub2-common (2.12-1ubuntu5) ... 507s Setting up grub-ieee1275-bin (2.12-1ubuntu5) ... 507s Setting up grub-ieee1275 (2.12-1ubuntu5) ... 507s Installing for powerpc-ieee1275 platform. 508s Installation finished. No error reported. 508s Sourcing file `/etc/default/grub' 508s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 508s Generating grub configuration file ... 508s Found linux image: /boot/vmlinux-6.8.0-20-generic 508s Found linux image: /boot/vmlinux-6.8.0-11-generic 508s Found initrd image: /boot/initrd.img-6.8.0-11-generic 508s Warning: os-prober will not be executed to detect other bootable partitions. 508s Systems on them will not be added to the GRUB boot configuration. 508s Check GRUB_DISABLE_OS_PROBER documentation entry. 508s Adding boot menu entry for UEFI Firmware Settings ... 508s done 508s Processing triggers for ufw (0.36.2-5) ... 508s Processing triggers for systemd (255.4-1ubuntu5) ... 508s Processing triggers for install-info (7.1-3build1) ... 508s Processing triggers for libc-bin (2.39-0ubuntu6) ... 508s Processing triggers for initramfs-tools (0.142ubuntu23) ... 508s update-initramfs: Generating /boot/initrd.img-6.8.0-11-generic 508s W: No lz4 in /usr/bin:/sbin:/bin, using gzip 515s Processing triggers for linux-image-6.8.0-20-generic (6.8.0-20.20) ... 515s /etc/kernel/postinst.d/initramfs-tools: 515s update-initramfs: Generating /boot/initrd.img-6.8.0-20-generic 515s W: No lz4 in /usr/bin:/sbin:/bin, using gzip 522s /etc/kernel/postinst.d/zz-update-grub: 522s Sourcing file `/etc/default/grub' 522s Sourcing file `/etc/default/grub.d/50-cloudimg-settings.cfg' 522s Generating grub configuration file ... 522s Found linux image: /boot/vmlinux-6.8.0-20-generic 522s Found initrd image: /boot/initrd.img-6.8.0-20-generic 522s Found linux image: /boot/vmlinux-6.8.0-11-generic 522s Found initrd image: /boot/initrd.img-6.8.0-11-generic 522s Warning: os-prober will not be executed to detect other bootable partitions. 522s Systems on them will not be added to the GRUB boot configuration. 522s Check GRUB_DISABLE_OS_PROBER documentation entry. 522s Adding boot menu entry for UEFI Firmware Settings ... 522s done 524s Reading package lists... 524s Building dependency tree... 524s Reading state information... 524s The following packages will be REMOVED: 524s libaio1* libnetplan0* python3-distutils* python3-lib2to3* 525s 0 upgraded, 0 newly installed, 4 to remove and 0 not upgraded. 525s After this operation, 1613 kB disk space will be freed. 525s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 112169 files and directories currently installed.) 525s Removing libaio1:ppc64el (0.3.113-5) ... 525s Removing libnetplan0:ppc64el (0.107.1-3) ... 525s Removing python3-distutils (3.12.2-3ubuntu1.1) ... 525s Removing python3-lib2to3 (3.12.2-3ubuntu1.1) ... 525s Processing triggers for libc-bin (2.39-0ubuntu6) ... 525s autopkgtest [15:43:50]: rebooting testbed after setup commands that affected boot 563s autopkgtest-virt-ssh: WARNING: ssh connection failed. Retrying in 3 seconds... 577s autopkgtest [15:44:42]: testbed running kernel: Linux 6.8.0-20-generic #20-Ubuntu SMP Mon Mar 18 11:46:05 UTC 2024 580s autopkgtest [15:44:45]: @@@@@@@@@@@@@@@@@@@@ apt-source ataqv 585s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (dsc) [2348 B] 585s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (tar) [4068 kB] 585s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (diff) [9548 B] 585s gpgv: Signature made Fri Mar 22 15:29:42 2024 UTC 585s gpgv: using RSA key 4FB588A84C2DDE79A74C77876FA458DD1DB03F71 585s gpgv: issuer "juliank@ubuntu.com" 585s gpgv: Can't check signature: No public key 585s dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build2.dsc: no acceptable signature found 586s autopkgtest [15:44:51]: testing package ataqv version 1.3.1+ds-2build2 586s autopkgtest [15:44:51]: build not needed 592s autopkgtest [15:44:57]: test run-unit-test: preparing testbed 594s Reading package lists... 594s Building dependency tree... 594s Reading state information... 595s Starting pkgProblemResolver with broken count: 0 595s Starting 2 pkgProblemResolver with broken count: 0 595s Done 595s The following additional packages will be installed: 595s ataqv fonts-font-awesome libboost-chrono1.83.0t64 libboost-filesystem1.83.0 595s libboost-iostreams1.83.0 libhts3t64 libhtscodecs2 libjs-d3-format 595s libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions 595s node-commander node-d3 node-d3-array node-d3-axis node-d3-brush 595s node-d3-chord node-d3-collection node-d3-color node-d3-contour 595s node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch 595s node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 595s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 595s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 595s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 595s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 595s node-iconv-lite node-normalize.css node-rw node-safe-buffer 595s Suggested packages: 595s picard-tools samtools macs libjs-html5shiv 595s Recommended packages: 595s javascript-common 595s The following NEW packages will be installed: 595s ataqv autopkgtest-satdep fonts-font-awesome libboost-chrono1.83.0t64 595s libboost-filesystem1.83.0 libboost-iostreams1.83.0 libhts3t64 libhtscodecs2 595s libjs-d3-format libjs-jquery libjs-jquery-datatables 595s libjs-jquery-datatables-extensions node-commander node-d3 node-d3-array 595s node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color 595s node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease 595s node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 595s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 595s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 595s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 595s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 595s node-iconv-lite node-normalize.css node-rw node-safe-buffer 595s 0 upgraded, 50 newly installed, 0 to remove and 0 not upgraded. 595s Need to get 7872 kB/7872 kB of archives. 595s After this operation, 27.9 MB of additional disk space will be used. 595s Get:1 /tmp/autopkgtest.YDzLT3/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [704 B] 595s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libboost-chrono1.83.0t64 ppc64el 1.83.0-2.1ubuntu2 [245 kB] 596s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libboost-filesystem1.83.0 ppc64el 1.83.0-2.1ubuntu2 [288 kB] 596s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libboost-iostreams1.83.0 ppc64el 1.83.0-2.1ubuntu2 [259 kB] 596s Get:5 http://ftpmaster.internal/ubuntu noble/universe ppc64el libhtscodecs2 ppc64el 1.6.0-1 [110 kB] 597s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el libhts3t64 ppc64el 1.19+ds-1.1build2 [569 kB] 597s Get:7 http://ftpmaster.internal/ubuntu noble/main ppc64el libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] 597s Get:8 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] 597s Get:9 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] 598s Get:10 http://ftpmaster.internal/ubuntu noble/main ppc64el fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] 598s Get:11 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-normalize.css all 8.0.1-5 [10.8 kB] 598s Get:12 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] 598s Get:13 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB] 598s Get:14 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B] 598s Get:15 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB] 598s Get:16 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB] 598s Get:17 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB] 598s Get:18 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB] 598s Get:19 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB] 598s Get:20 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB] 598s Get:21 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB] 598s Get:22 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-brush all 1.1.6+~1.1.5-1 [181 kB] 598s Get:23 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB] 598s Get:24 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB] 598s Get:25 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB] 598s Get:26 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB] 598s Get:27 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] 598s Get:28 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-iconv-lite all 0.6.3-3 [158 kB] 598s Get:29 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-queue all 3.0.7-13 [10.2 kB] 598s Get:30 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-rw all 1.3.3-5 [7570 B] 598s Get:31 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-commander all 9.4.1-1 [50.6 kB] 598s Get:32 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB] 598s Get:33 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB] 598s Get:34 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB] 598s Get:35 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB] 598s Get:36 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB] 598s Get:37 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB] 598s Get:38 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB] 598s Get:39 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB] 598s Get:40 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B] 599s Get:41 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-random all 1.1.2+~1.1.3-1 [9140 B] 599s Get:42 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB] 599s Get:43 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB] 599s Get:44 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB] 599s Get:45 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB] 599s Get:46 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB] 599s Get:47 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB] 599s Get:48 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB] 599s Get:49 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3 all 5.16.0+~cs5.28.10-1 [194 kB] 599s Get:50 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el ataqv ppc64el 1.3.1+ds-2build2 [3411 kB] 600s Fetched 7872 kB in 5s (1718 kB/s) 600s Selecting previously unselected package libboost-chrono1.83.0t64:ppc64el. 600s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 111945 files and directories currently installed.) 600s Preparing to unpack .../00-libboost-chrono1.83.0t64_1.83.0-2.1ubuntu2_ppc64el.deb ... 600s Unpacking libboost-chrono1.83.0t64:ppc64el (1.83.0-2.1ubuntu2) ... 600s Selecting previously unselected package libboost-filesystem1.83.0:ppc64el. 600s Preparing to unpack .../01-libboost-filesystem1.83.0_1.83.0-2.1ubuntu2_ppc64el.deb ... 600s Unpacking libboost-filesystem1.83.0:ppc64el (1.83.0-2.1ubuntu2) ... 600s Selecting previously unselected package libboost-iostreams1.83.0:ppc64el. 600s Preparing to unpack .../02-libboost-iostreams1.83.0_1.83.0-2.1ubuntu2_ppc64el.deb ... 600s Unpacking libboost-iostreams1.83.0:ppc64el (1.83.0-2.1ubuntu2) ... 600s Selecting previously unselected package libhtscodecs2:ppc64el. 600s Preparing to unpack .../03-libhtscodecs2_1.6.0-1_ppc64el.deb ... 600s Unpacking libhtscodecs2:ppc64el (1.6.0-1) ... 600s Selecting previously unselected package libhts3t64:ppc64el. 600s Preparing to unpack .../04-libhts3t64_1.19+ds-1.1build2_ppc64el.deb ... 600s Unpacking libhts3t64:ppc64el (1.19+ds-1.1build2) ... 600s Selecting previously unselected package libjs-jquery. 600s Preparing to unpack .../05-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... 600s Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 601s Selecting previously unselected package libjs-jquery-datatables. 601s Preparing to unpack .../06-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... 601s Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... 601s Selecting previously unselected package libjs-jquery-datatables-extensions. 601s Preparing to unpack .../07-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... 601s Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 601s Selecting previously unselected package fonts-font-awesome. 601s Preparing to unpack .../08-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... 601s Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 601s Selecting previously unselected package node-normalize.css. 601s Preparing to unpack .../09-node-normalize.css_8.0.1-5_all.deb ... 601s Unpacking node-normalize.css (8.0.1-5) ... 601s Selecting previously unselected package node-d3-array. 601s Preparing to unpack .../10-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... 601s Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... 601s Selecting previously unselected package node-d3-axis. 601s Preparing to unpack .../11-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... 601s Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... 601s Selecting previously unselected package node-d3-dispatch. 601s Preparing to unpack .../12-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... 601s Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... 601s Selecting previously unselected package node-d3-selection. 601s Preparing to unpack .../13-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... 601s Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... 601s Selecting previously unselected package node-d3-drag. 601s Preparing to unpack .../14-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... 601s Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... 601s Selecting previously unselected package node-d3-color. 601s Preparing to unpack .../15-node-d3-color_1.4.1+~1.4.2-1_all.deb ... 601s Unpacking node-d3-color (1.4.1+~1.4.2-1) ... 601s Selecting previously unselected package node-d3-interpolate. 601s Preparing to unpack .../16-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... 601s Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... 601s Selecting previously unselected package node-d3-ease. 601s Preparing to unpack .../17-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... 601s Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... 601s Selecting previously unselected package node-d3-timer. 601s Preparing to unpack .../18-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... 601s Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... 601s Selecting previously unselected package node-d3-transition. 601s Preparing to unpack .../19-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... 601s Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... 601s Selecting previously unselected package node-d3-brush. 601s Preparing to unpack .../20-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... 601s Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... 601s Selecting previously unselected package node-d3-path. 601s Preparing to unpack .../21-node-d3-path_1.0.9+~1.0.9-1_all.deb ... 601s Unpacking node-d3-path (1.0.9+~1.0.9-1) ... 601s Selecting previously unselected package node-d3-chord. 601s Preparing to unpack .../22-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... 601s Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... 601s Selecting previously unselected package node-d3-collection. 601s Preparing to unpack .../23-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... 601s Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... 601s Selecting previously unselected package node-d3-contour. 601s Preparing to unpack .../24-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... 601s Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... 601s Selecting previously unselected package node-safe-buffer. 601s Preparing to unpack .../25-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... 601s Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... 601s Selecting previously unselected package node-iconv-lite. 601s Preparing to unpack .../26-node-iconv-lite_0.6.3-3_all.deb ... 601s Unpacking node-iconv-lite (0.6.3-3) ... 601s Selecting previously unselected package node-d3-queue. 601s Preparing to unpack .../27-node-d3-queue_3.0.7-13_all.deb ... 601s Unpacking node-d3-queue (3.0.7-13) ... 601s Selecting previously unselected package node-rw. 601s Preparing to unpack .../28-node-rw_1.3.3-5_all.deb ... 601s Unpacking node-rw (1.3.3-5) ... 601s Selecting previously unselected package node-commander. 601s Preparing to unpack .../29-node-commander_9.4.1-1_all.deb ... 601s Unpacking node-commander (9.4.1-1) ... 601s Selecting previously unselected package node-d3-dsv. 601s Preparing to unpack .../30-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... 601s Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... 601s Selecting previously unselected package node-d3-fetch. 601s Preparing to unpack .../31-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... 601s Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... 601s Selecting previously unselected package node-d3-quadtree. 601s Preparing to unpack .../32-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... 601s Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... 601s Selecting previously unselected package node-d3-force. 601s Preparing to unpack .../33-node-d3-force_2.1.1+~2.1.4-1_all.deb ... 601s Unpacking node-d3-force (2.1.1+~2.1.4-1) ... 601s Selecting previously unselected package libjs-d3-format. 601s Preparing to unpack .../34-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 601s Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... 601s Selecting previously unselected package node-d3-format. 601s Preparing to unpack .../35-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 601s Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... 601s Selecting previously unselected package node-d3-geo. 601s Preparing to unpack .../36-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... 601s Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... 601s Selecting previously unselected package node-d3-hierarchy. 601s Preparing to unpack .../37-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... 601s Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... 601s Selecting previously unselected package node-d3-polygon. 601s Preparing to unpack .../38-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... 601s Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... 601s Selecting previously unselected package node-d3-random. 601s Preparing to unpack .../39-node-d3-random_1.1.2+~1.1.3-1_all.deb ... 601s Unpacking node-d3-random (1.1.2+~1.1.3-1) ... 601s Selecting previously unselected package node-d3-time. 601s Preparing to unpack .../40-node-d3-time_1.1.0+~1.1.1-1_all.deb ... 601s Unpacking node-d3-time (1.1.0+~1.1.1-1) ... 601s Selecting previously unselected package node-d3-time-format. 601s Preparing to unpack .../41-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... 601s Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... 601s Selecting previously unselected package node-d3-scale. 601s Preparing to unpack .../42-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... 601s Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... 601s Selecting previously unselected package node-d3-scale-chromatic. 601s Preparing to unpack .../43-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... 601s Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 601s Selecting previously unselected package node-d3-shape. 601s Preparing to unpack .../44-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... 601s Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... 602s Selecting previously unselected package node-d3-voronoi. 602s Preparing to unpack .../45-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... 602s Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... 602s Selecting previously unselected package node-d3-zoom. 602s Preparing to unpack .../46-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... 602s Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... 602s Selecting previously unselected package node-d3. 602s Preparing to unpack .../47-node-d3_5.16.0+~cs5.28.10-1_all.deb ... 602s Unpacking node-d3 (5.16.0+~cs5.28.10-1) ... 602s Selecting previously unselected package ataqv. 602s Preparing to unpack .../48-ataqv_1.3.1+ds-2build2_ppc64el.deb ... 602s Unpacking ataqv (1.3.1+ds-2build2) ... 602s Selecting previously unselected package autopkgtest-satdep. 602s Preparing to unpack .../49-1-autopkgtest-satdep.deb ... 602s Unpacking autopkgtest-satdep (0) ... 602s Setting up libhtscodecs2:ppc64el (1.6.0-1) ... 602s Setting up node-d3-timer (1.0.10+~1.0.10-1) ... 602s Setting up node-d3-color (1.4.1+~1.4.2-1) ... 602s Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... 602s Setting up node-d3-queue (3.0.7-13) ... 602s Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... 602s Setting up node-d3-ease (1.0.7+~1.0.11-1) ... 602s Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 602s Setting up node-d3-selection (1.4.1+~1.4.3-1) ... 602s Setting up node-d3-axis (1.0.12+~1.0.16-1) ... 602s Setting up libboost-filesystem1.83.0:ppc64el (1.83.0-2.1ubuntu2) ... 602s Setting up node-d3-path (1.0.9+~1.0.9-1) ... 602s Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... 602s Setting up node-rw (1.3.3-5) ... 602s Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... 602s Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... 602s Setting up libboost-chrono1.83.0t64:ppc64el (1.83.0-2.1ubuntu2) ... 602s Setting up libboost-iostreams1.83.0:ppc64el (1.83.0-2.1ubuntu2) ... 602s Setting up node-d3-collection (1.0.7+~1.0.10-1) ... 602s Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... 602s Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... 602s Setting up node-d3-time (1.1.0+~1.1.1-1) ... 602s Setting up node-commander (9.4.1-1) ... 602s Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... 602s Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... 602s Setting up libhts3t64:ppc64el (1.19+ds-1.1build2) ... 602s Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 602s Setting up node-d3-geo (1.12.1+~1.12.4-1) ... 602s Setting up node-normalize.css (8.0.1-5) ... 602s Setting up node-d3-transition (1.3.2+~1.3.2-1) ... 602s Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 602s Setting up node-d3-random (1.1.2+~1.1.3-1) ... 602s Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 602s Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... 602s Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... 602s Setting up node-d3-chord (1.0.6+~1.0.11-1) ... 602s Setting up node-d3-shape (1.3.7+~1.3.8-1) ... 602s Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... 602s Setting up node-d3-drag (1.2.5+~1.2.5-1) ... 602s Setting up node-iconv-lite (0.6.3-3) ... 602s Setting up node-d3-scale (2.2.2+~2.2.6-1) ... 602s Setting up node-d3-force (2.1.1+~2.1.4-1) ... 602s Setting up node-d3-contour (1.3.2+~1.3.3-1) ... 602s Setting up node-d3-brush (1.1.6+~1.1.5-1) ... 602s Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... 602s Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... 602s Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... 602s Setting up node-d3 (5.16.0+~cs5.28.10-1) ... 602s Setting up ataqv (1.3.1+ds-2build2) ... 602s Setting up autopkgtest-satdep (0) ... 602s Processing triggers for man-db (2.12.0-3build4) ... 603s Processing triggers for libc-bin (2.39-0ubuntu6) ... 607s (Reading database ... 113604 files and directories currently installed.) 607s Removing autopkgtest-satdep (0) ... 607s autopkgtest [15:45:12]: test run-unit-test: [----------------------- 609s Reading human autosomal references from autosomal_references.gz. 609s Autosomal references for human: 609s I 609s II 609s III 609s Reading human autosomal references from autosomal_references.gz. 609s Autosomal references for human: 609s I 609s II 609s III 609s Reading human autosomal references from autosomal_references.gz. 609s Autosomal references for human: 609s I 609s II 609s III 611s Read 411 excluded regions from exclude.dac.bed.gz. 611s Read 1649 excluded regions from exclude.duke.bed.gz. 611s Loading TSS file 'hg19.tss.refseq.bed.gz'. 611s Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] 611s Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 611s Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] 611s Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 612s Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] 612s Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] 612s Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] 612s Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] 612s Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] 612s Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] 613s Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] 613s Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] 613s Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] 613s Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] 613s chr1 feature count: 2687 613s chr2 feature count: 1715 613s chr3 feature count: 1490 613s chr4 feature count: 1004 613s chr5 feature count: 1132 613s chr6 feature count: 1368 613s chr7 feature count: 1169 613s chr8 feature count: 913 613s chr9 feature count: 1025 613s chr10 feature count: 1039 613s chr11 feature count: 1642 613s chr12 feature count: 1350 613s chr13 feature count: 433 613s chr14 feature count: 785 613s chr15 feature count: 812 613s chr16 feature count: 1106 613s chr17 feature count: 1528 613s chr18 feature count: 398 613s chr19 feature count: 1785 613s chr20 feature count: 694 613s chr21 feature count: 321 613s chr22 feature count: 593 613s Loaded 24989 TSS in 1.87265 seconds. (13344.2 TSS/second). 613s 613s Collecting metrics from test.bam. 613s 613s Logging problematic reads to SRR891275.problems. 613s 613s Loading peaks for read group SRR891275 from test.peaks.gz. 613s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 613s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 613s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 613s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 613s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 613s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 613s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 613s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 615s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 615s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 615s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 615s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 615s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 615s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 615s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 615s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 615s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 615s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 615s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 615s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 615s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 616s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 616s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 616s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 616s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 616s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 616s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 617s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 617s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 617s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 617s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 617s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 617s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 617s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 617s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 617s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 617s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 617s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 617s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 617s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 618s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 618s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 618s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 618s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 618s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 618s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 618s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 618s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 618s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 618s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 618s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 618s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 618s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 618s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 618s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 618s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 618s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 618s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 618s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 618s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 618s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 619s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 619s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 619s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 619s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 619s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 619s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 619s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 619s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 619s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 619s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 619s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 620s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 620s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 620s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 620s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 620s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 620s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 620s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 620s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 620s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 620s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 620s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 620s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 620s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 621s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 621s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 621s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 621s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 621s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 621s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 621s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 622s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 622s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 622s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 622s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 622s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 622s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 622s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 622s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 622s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 622s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 622s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 622s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 622s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 623s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 623s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 623s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 624s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 624s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 624s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 624s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 624s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 624s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 624s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 624s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 624s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 625s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 625s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 625s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 625s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 625s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 625s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 625s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 625s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 625s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 625s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 625s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 625s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 625s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 625s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 625s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 625s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 625s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 625s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 626s chr1 peak count: 3667 626s chr2 peak count: 3154 626s chr3 peak count: 2528 626s chr4 peak count: 1814 626s chr5 peak count: 2042 626s chr6 peak count: 2483 626s chr7 peak count: 1999 626s chr8 peak count: 1647 626s chr9 peak count: 1475 626s chr10 peak count: 1815 626s chr11 peak count: 1878 626s chr12 peak count: 2078 626s chr13 peak count: 1026 626s chr14 peak count: 1275 626s chr15 peak count: 1140 626s chr16 peak count: 1211 626s chr17 peak count: 1664 626s chr18 peak count: 772 626s chr19 peak count: 1595 626s chr20 peak count: 864 626s chr21 peak count: 487 626s chr22 peak count: 662 626s Loaded 37276 peaks in 12.8046 seconds. (2911.14 peaks/second). 626s 626s Logging problematic reads to SRR891278.problems. 626s 626s Loading peaks for read group SRR891278 from test.peaks.gz. 626s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 626s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 626s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 626s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 626s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 626s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 626s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 626s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 628s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 628s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 628s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 628s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 628s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 628s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 628s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 628s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 628s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 628s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 628s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 628s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 628s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 628s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 629s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 629s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 629s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 629s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 629s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 629s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 630s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 630s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 630s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 630s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 630s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 630s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 630s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 630s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 630s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 630s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 630s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 630s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 631s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 631s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 631s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 631s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 631s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 631s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 631s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 631s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 631s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 631s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 631s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 631s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 631s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 631s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 631s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 631s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 631s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 631s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 631s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 631s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 631s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 632s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 632s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 632s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 632s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 632s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 632s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 632s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 632s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 632s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 632s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 632s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 633s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 633s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 633s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 633s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 633s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 633s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 633s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 633s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 633s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 633s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 633s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 633s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 633s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 633s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 633s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 633s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 633s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 634s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 634s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 634s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 634s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 635s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 635s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 635s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 635s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 635s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 635s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 635s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 635s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 635s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 635s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 635s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 635s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 635s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 635s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 636s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 637s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 637s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 637s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 637s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 637s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 637s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 637s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 637s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 637s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 637s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 637s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 637s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 637s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 637s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 637s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 637s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 638s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 638s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 638s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 638s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 638s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 638s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 638s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 638s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 638s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 638s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 638s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 638s chr1 peak count: 3667 638s chr2 peak count: 3154 638s chr3 peak count: 2528 638s chr4 peak count: 1814 638s chr5 peak count: 2042 638s chr6 peak count: 2483 638s chr7 peak count: 1999 638s chr8 peak count: 1647 638s chr9 peak count: 1475 638s chr10 peak count: 1815 638s chr11 peak count: 1878 638s chr12 peak count: 2078 638s chr13 peak count: 1026 638s chr14 peak count: 1275 638s chr15 peak count: 1140 638s chr16 peak count: 1211 638s chr17 peak count: 1664 638s chr18 peak count: 772 638s chr19 peak count: 1595 638s chr20 peak count: 864 638s chr21 peak count: 487 638s chr22 peak count: 662 638s Loaded 37276 peaks in 12.9007 seconds. (2889.46 peaks/second). 638s 638s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 638s New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 638s New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 638s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 639s 5: 439 (84.423%) 639s 10: 439 (84.423%) 639s 15: 438 (84.231%) 639s 20: 436 (83.846%) 639s 25: 435 (83.654%) 639s 30: 420 (80.769%) 639s 639s Peak Metrics 639s ------------ 639s Peak count: 37276 639s 639s High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) 639s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 639s Top peak: 2 (1.000% of all high quality autosomal alignments) 639s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 639s Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) 639s Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) 639s Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) 639s 639s Read Group 639s ========== 639s ID: SRR891278 639s Library: SRR891278 639s Sample: GSM1155967 639s Description: a library of brutal tests? 639s 639s Sequencing center: 639s Sequencing date: 639s Sequencing platform: ILLUMINA 639s Platform model: 639s Platform unit: 639s Flow order: 639s Key sequence: 639s Predicted median insert size: 639s Programs: 639s 639s Metrics 639s ------- 639s 639s Read Mapping Metrics 639s -------------------- 639s Total reads: 520 639s Total problems: 90 (17.308%) 639s Properly paired and mapped reads: 430 (82.692%) 639s Secondary reads: 10 (1.923%) 639s Supplementary reads: 0 (0.000%) 639s Duplicate reads: 158 (30.385% of all reads) 639s 639s Quality Indicators 639s ------------------ 639s Short to mononucleosomal ratio: 2.357 639s High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 639s as a percentage of autosomal reads: 91.743% 639s as a percentage of all reads: 38.462% 639s TSS enrichment: 3.687 639s 639s Paired Read Metrics 639s ------------------- 639s Paired reads: 520 (100.000%) 639s Paired and mapped reads: 440 (84.615%) 639s FR reads: 430 (82.692308%) 639s First of pair: 259 (49.808%) 639s Second of pair: 261 (50.192%) 639s Forward reads: 261 (50.192%) 639s Reverse reads: 259 (49.808%) 639s Forward mate reads: 260 (50.000%) 639s Reverse mate reads: 260 (50.000%) 639s 639s Unmapped Read Metrics 639s --------------------- 639s Unmapped reads: 8 (1.538%) 639s Unmapped mate reads: 4 (0.769%) 639s Reads not passing quality controls: 0 (0.000%) 639s Unpaired reads: 0 (0.000%) 639s Reads with zero mapping quality: 49 (9.423%) 639s 639s Aberrant Mapping Metrics 639s ------------------------ 639s RF reads: 6 (1.153846%) 639s FF reads: 4 (0.769231%) 639s RR reads: 9 (1.730769%) 639s Reads that paired and mapped but... 639s on different chromosomes: 8 (1.538%) 639s probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) 639s just not properly: 0 (0.000%) 639s 639s Autosomal/Mitochondrial Metrics 639s ------------------------------- 639s Total autosomal reads: 218 (41.923% of all reads) 639s Total mitochondrial reads: 192 (36.923% of all reads) 639s Duplicate autosomal reads: 17 (7.798% of all autosomal reads) 639s Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) 639s 639s 639s Mapping Quality 639s --------------- 639s Mean MAPQ: 48.044 639s Median MAPQ: 60.000 639s Reads with MAPQ >=... 639s 5: 449 (86.346%) 639s 10: 445 (85.577%) 639s 15: 443 (85.192%) 639s 20: 442 (85.000%) 639s 25: 442 (85.000%) 639s 30: 417 (80.192%) 639s 639s Peak Metrics 639s ------------ 639s Peak count: 37276 639s 639s High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) 639s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 639s Top peak: 2 (1.000% of all high quality autosomal alignments) 639s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 639s Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) 639s Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) 639s Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) 639s 639s 639s [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directoryRead 411 excluded regions from exclude.dac.bed.gz. 639s 639s Read 1649 excluded regions from exclude.duke.bed.gz. 639s Collecting metrics from test.bam. 639s 639s Logging problematic reads to Test collector.problems. 639s 639s Loading peaks for read group Test collector from test.peaks.gz. 639s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] 639s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] 639s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] 640s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 640s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 640s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 640s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] 640s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] 641s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 641s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 641s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] 641s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 641s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 641s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 641s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] 642s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] 642s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] 642s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 642s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 642s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 642s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] 642s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] 643s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] 643s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 643s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 643s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 643s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 643s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] 643s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] 644s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] 644s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] 644s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] 644s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 644s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 644s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 644s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 644s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 644s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 644s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 644s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 644s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] 644s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 644s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 644s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] 644s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] 644s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] 644s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] 645s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] 645s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] 645s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 645s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] 645s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] 645s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] 645s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] 646s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 646s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 646s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 646s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] 646s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] 646s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 646s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] 646s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] 646s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] 646s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] 646s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] 647s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] 647s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 647s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] 647s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] 647s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] 647s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] 647s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 647s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 647s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 647s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] 647s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] 647s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] 647s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] 648s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] 648s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 648s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] 648s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] 649s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] 649s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] 649s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 649s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 649s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 649s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 650s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] 651s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] 651s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] 651s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] 651s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] 651s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 651s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 651s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 651s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 651s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] 651s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] 651s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 651s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] 652s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] 652s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 652s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 652s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] 652s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 652s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 652s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] 652s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] 652s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] 652s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] 652s chr1 peak count: 3667 652s chr2 peak count: 3154 652s chr3 peak count: 2528 652s chr4 peak count: 1814 652s chr5 peak count: 2042 652s chr6 peak count: 2483 652s chr7 peak count: 1999 652s chr8 peak count: 1647 652s chr9 peak count: 1475 652s chr10 peak count: 1815 652s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 652s New maximum proper pair fragment length: 330 from [chr11 peak count: 1878 652s chr12 peak count: 2078 652s chr13 peak count: 1026 652s chr14 peak count: 1275 652s chr15 peak count: 1140 652s chr16 peak count: 1211 652s chr17 peak count: 1664 652s chr18 peak count: 772 652s chr19 peak count: 1595 652s chr20 peak count: 864 652s chr21 peak count: 487 652s chr22 peak count: 662 652s Loaded 37276 peaks in 12.810 seconds. (2909.914 peaks/second). 652s 652s Analyzed 1040 reads in 0.036 seconds (28965.963 reads/second). 652s 652s ataqv 1.3.1 652s 652s Operating parameters 652s ==================== 652s Thread limit: 1 652s Ignoring read groups: yes 652s Is single nucleus: no 652s 652s Experiment information 652s ====================== 652s Organism: human 652s Description: a collector for unit tests 652s URL: https://theparkerlab.org 652s 652s Reference genome configuration 652s ============================== 652s Mitochondrial reference: chrM 652s Autosomal references: 652s 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 652s 20, 21, 22, chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, 652s chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, 652s chr19, chr20, chr21, chr22 652s 652s 652s Read Group 652s ========== 652s ID: Test collector 652s Library: Test collector 652s Sample: Test collector 652s Description: a library of brutal tests? 652s 652s Sequencing center: 652s Sequencing date: 652s Sequencing platform: 652s Platform model: 652s Platform unit: 652s Flow order: 652s Key sequence: 652s Predicted median insert size: 652s Programs: 652s 652s Metrics 652s ------- 652s 652s Read Mapping Metrics 652s -------------------- 652s Total reads: 1040 652s Total problems: 194 (18.654%) 652s Properly paired and mapped reads: 846 (81.346%) 652s Secondary reads: 20 (1.923%) 652s Supplementary reads: 0 (0.000%) 652s Duplicate reads: 313 (30.096% of all reads) 652s 652s Quality Indicators 652s ------------------ 652s Short to mononucleosomal ratio: 1.783 652s High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 400 652s as a percentage of autosomal reads: 91.533% 652s as a percentage of all reads: 38.462% 652s 652s Paired Read Metrics 652s ------------------- 652s Paired reads: 1040 (100.000%) 652s Paired and mapped reads: 864 (83.077%) 652s FR reads: 846 (81.346154%) 652s First of pair: 519 (49.904%) 652s Second of pair: 521 (50.096%) 652s Forward reads: 529 (50.865%) 652s Reverse reads: 511 (49.135%) 652s Forward mate reads: 521 (50.096%) 652s Reverse mate reads: 519 (49.904%) 652s 652s Unmapped Read Metrics 652s --------------------- 652s Unmapped reads: 17 (1.635%) 652s Unmapped mate reads: 6 (0.577%) 652s Reads not passing quality controls: 0 (0.000%) 652s Unpaired reads: 0 (0.000%) 652s Reads with zero mapping quality: 111 (10.673%) 652s 652s Aberrant Mapping Metrics 652s ------------------------ 652s RF reads: 15 (1.442308%) 652s FF reads: 10 (0.961538%) 652s RR reads: 17 (1.634615%) 652s Reads that paired and mapped but... 652s on different chromosomes: 14 (1.346%) 652s probably too far from their mates: 4 (0.385%) (longest proper fragment seems to be 649) 652s just not properly: 0 (0.000%) 652s 652s Autosomal/Mitochondrial Metrics 652s ------------------------------- 652s Total autosomal reads: 437 (42.019% of all reads) 652s Total mitochondrial reads: 369 (35.481% of all reads) 652s Duplicate autosomal reads: 35 (8.009% of all autosomal reads) 652s Duplicate mitochondrial reads: 185 (50.136% of all mitochondrial reads) 652s 652s 652s Mapping Quality 652s --------------- 652s Mean MAPQ: 47.538 652s Median MAPQ: 60.000 652s Reads with MAPQ >=... 652s 5: 888 (85.385%) 652s 10: 884 (85.000%) 652s 15: 881 (84.712%) 652s 20: 878 (84.423%) 652s 25: 877 (84.327%) 652s 30: 837 (80.481%) 652s 652s Peak Metrics 652s ------------ 652s Peak count: 37276 652s 652s High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) 652s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 652s Top peak: 2 (0.500% of all high quality autosomal alignments) 652s Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) 652s Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) 652s Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) 652s Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) 652s 652s 652s SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 652s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 652s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 652s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH