0s autopkgtest [18:43:00]: starting date and time: 2024-03-25 18:43:00+0000 0s autopkgtest [18:43:00]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [18:43:00]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.k65tok15/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:ataqv,src:boost1.83,src:curl,src:gnutls28,src:htslib,src:libpsl,src:nettle,src:openssl --apt-upgrade ataqv --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ataqv/1.3.1+ds-2build2 boost1.83/1.83.0-2.1ubuntu2 curl/8.5.0-2ubuntu8 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-ppc64el-10.secgroup --name adt-noble-ppc64el-ataqv-20240325-184300-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-ppc64el-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 156s autopkgtest [18:45:36]: testbed dpkg architecture: ppc64el 156s autopkgtest [18:45:36]: testbed apt version: 2.7.12 156s autopkgtest [18:45:36]: @@@@@@@@@@@@@@@@@@@@ test bed setup 157s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 158s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [4045 kB] 159s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [7608 B] 159s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [56.0 kB] 159s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [497 kB] 159s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el Packages [700 kB] 159s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el c-n-f Metadata [3116 B] 159s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el Packages [1372 B] 159s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted ppc64el c-n-f Metadata [116 B] 159s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el Packages [4269 kB] 159s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe ppc64el c-n-f Metadata [8652 B] 159s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el Packages [61.7 kB] 159s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse ppc64el c-n-f Metadata [116 B] 163s Fetched 9767 kB in 3s (3052 kB/s) 163s Reading package lists... 167s Reading package lists... 167s Building dependency tree... 167s Reading state information... 167s Calculating upgrade... 167s The following packages will be REMOVED: 167s libssl3 167s The following NEW packages will be installed: 167s libssl3t64 167s The following packages have been kept back: 167s curl 167s The following packages will be upgraded: 167s openssl 167s 1 upgraded, 1 newly installed, 1 to remove and 1 not upgraded. 167s Need to get 3151 kB of archives. 167s After this operation, 73.7 kB of additional disk space will be used. 167s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el openssl ppc64el 3.0.13-0ubuntu2 [1026 kB] 168s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main ppc64el libssl3t64 ppc64el 3.0.13-0ubuntu2 [2125 kB] 169s Fetched 3151 kB in 1s (3187 kB/s) 169s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 169s Preparing to unpack .../openssl_3.0.13-0ubuntu2_ppc64el.deb ... 169s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 169s dpkg: libssl3:ppc64el: dependency problems, but removing anyway as you requested: 169s wget depends on libssl3 (>= 3.0.0). 169s tnftp depends on libssl3 (>= 3.0.0). 169s tcpdump depends on libssl3 (>= 3.0.0). 169s systemd-resolved depends on libssl3 (>= 3.0.0). 169s systemd depends on libssl3 (>= 3.0.0). 169s sudo depends on libssl3 (>= 3.0.0). 169s rsync depends on libssl3 (>= 3.0.0). 169s python3-cryptography depends on libssl3 (>= 3.0.0). 169s openssh-server depends on libssl3 (>= 3.0.10). 169s openssh-client depends on libssl3 (>= 3.0.10). 169s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 169s libsystemd-shared:ppc64el depends on libssl3 (>= 3.0.0). 169s libssh-4:ppc64el depends on libssl3 (>= 3.0.0). 169s libsasl2-modules:ppc64el depends on libssl3 (>= 3.0.0). 169s libsasl2-2:ppc64el depends on libssl3 (>= 3.0.0). 169s libpython3.12-minimal:ppc64el depends on libssl3 (>= 3.0.0). 169s libpython3.11-minimal:ppc64el depends on libssl3 (>= 3.0.0). 169s libnvme1 depends on libssl3 (>= 3.0.0). 169s libkrb5-3:ppc64el depends on libssl3 (>= 3.0.0). 169s libkmod2:ppc64el depends on libssl3 (>= 3.0.0). 169s libfido2-1:ppc64el depends on libssl3 (>= 3.0.0). 169s libcurl4:ppc64el depends on libssl3 (>= 3.0.0). 169s libcryptsetup12:ppc64el depends on libssl3 (>= 3.0.0). 169s kmod depends on libssl3 (>= 3.0.0). 169s dhcpcd-base depends on libssl3 (>= 3.0.0). 169s bind9-libs:ppc64el depends on libssl3 (>= 3.0.0). 169s 169s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70156 files and directories currently installed.) 169s Removing libssl3:ppc64el (3.0.10-1ubuntu4) ... 169s Selecting previously unselected package libssl3t64:ppc64el. 169s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70145 files and directories currently installed.) 169s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_ppc64el.deb ... 169s Unpacking libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 169s Setting up libssl3t64:ppc64el (3.0.13-0ubuntu2) ... 169s Setting up openssl (3.0.13-0ubuntu2) ... 169s Processing triggers for man-db (2.12.0-3) ... 170s Processing triggers for libc-bin (2.39-0ubuntu6) ... 170s Reading package lists... 170s Building dependency tree... 170s Reading state information... 170s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 171s sh: Attempting to set up Debian/Ubuntu apt sources automatically 171s sh: Distribution appears to be Ubuntu 172s Reading package lists... 172s Building dependency tree... 172s Reading state information... 173s eatmydata is already the newest version (131-1). 173s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 173s Reading package lists... 173s Building dependency tree... 173s Reading state information... 173s dbus is already the newest version (1.14.10-4ubuntu1). 173s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 173s Reading package lists... 173s Building dependency tree... 173s Reading state information... 173s rng-tools-debian is already the newest version (2.4). 173s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 174s Reading package lists... 174s Building dependency tree... 174s Reading state information... 174s The following packages will be REMOVED: 174s cloud-init* python3-configobj* python3-debconf* 174s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 174s After this operation, 3256 kB disk space will be freed. 174s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 70158 files and directories currently installed.) 174s Removing cloud-init (24.1.2-0ubuntu1) ... 175s Removing python3-configobj (5.0.8-3) ... 175s Removing python3-debconf (1.5.86) ... 175s Processing triggers for man-db (2.12.0-3) ... 175s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69769 files and directories currently installed.) 175s Purging configuration files for cloud-init (24.1.2-0ubuntu1) ... 176s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 176s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 176s invoke-rc.d: policy-rc.d denied execution of try-restart. 176s Reading package lists... 176s Building dependency tree... 176s Reading state information... 177s linux-generic is already the newest version (6.8.0-11.11+1). 177s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 177s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 177s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 177s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 180s Reading package lists... 180s Reading package lists... 180s Building dependency tree... 180s Reading state information... 181s Calculating upgrade... 181s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 181s Reading package lists... 181s Building dependency tree... 181s Reading state information... 181s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 181s autopkgtest [18:46:01]: rebooting testbed after setup commands that affected boot 351s autopkgtest [18:48:51]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP Wed Feb 14 00:33:03 UTC 2024 354s autopkgtest [18:48:54]: @@@@@@@@@@@@@@@@@@@@ apt-source ataqv 359s Get:1 http://ftpmaster.internal/ubuntu noble/universe ataqv 1.3.1+ds-2build1 (dsc) [2240 B] 359s Get:2 http://ftpmaster.internal/ubuntu noble/universe ataqv 1.3.1+ds-2build1 (tar) [4068 kB] 359s Get:3 http://ftpmaster.internal/ubuntu noble/universe ataqv 1.3.1+ds-2build1 (diff) [9444 B] 359s gpgv: Signature made Tue Dec 19 15:00:37 2023 UTC 359s gpgv: using RSA key 568BF22A66337CBFC9A6B9B72C83DBC8E9BD0E37 359s gpgv: Can't check signature: No public key 359s dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build1.dsc: no acceptable signature found 359s autopkgtest [18:48:57]: testing package ataqv version 1.3.1+ds-2build1 359s autopkgtest [18:48:59]: build not needed 362s autopkgtest [18:49:02]: test run-unit-test: preparing testbed 367s Reading package lists... 368s Building dependency tree... 368s Reading state information... 368s Starting pkgProblemResolver with broken count: 0 368s Starting 2 pkgProblemResolver with broken count: 0 368s Done 368s The following additional packages will be installed: 368s ataqv fonts-font-awesome libboost-chrono1.83.0 libboost-filesystem1.83.0 368s libboost-iostreams1.83.0 libdeflate0 libhts3 libhtscodecs2 libjs-d3-format 368s libjs-jquery libjs-jquery-datatables libjs-jquery-datatables-extensions 368s node-commander node-d3 node-d3-array node-d3-axis node-d3-brush 368s node-d3-chord node-d3-collection node-d3-color node-d3-contour 368s node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch 368s node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 368s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 368s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 368s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 368s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 368s node-iconv-lite node-normalize.css node-rw node-safe-buffer 368s Suggested packages: 368s picard-tools samtools macs libjs-html5shiv 368s Recommended packages: 368s javascript-common 369s The following NEW packages will be installed: 369s ataqv autopkgtest-satdep fonts-font-awesome libboost-chrono1.83.0 369s libboost-filesystem1.83.0 libboost-iostreams1.83.0 libdeflate0 libhts3 369s libhtscodecs2 libjs-d3-format libjs-jquery libjs-jquery-datatables 369s libjs-jquery-datatables-extensions node-commander node-d3 node-d3-array 369s node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color 369s node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease 369s node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 369s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 369s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 369s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 369s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 369s node-iconv-lite node-normalize.css node-rw node-safe-buffer 369s 0 upgraded, 51 newly installed, 0 to remove and 0 not upgraded. 369s Need to get 8157 kB/8158 kB of archives. 369s After this operation, 28.0 MB of additional disk space will be used. 369s Get:1 /tmp/autopkgtest.RW5TLa/1-autopkgtest-satdep.deb autopkgtest-satdep ppc64el 0 [704 B] 369s Get:2 http://ftpmaster.internal/ubuntu noble/main ppc64el libboost-chrono1.83.0 ppc64el 1.83.0-2ubuntu1 [322 kB] 369s Get:3 http://ftpmaster.internal/ubuntu noble/main ppc64el libboost-filesystem1.83.0 ppc64el 1.83.0-2ubuntu1 [373 kB] 369s Get:4 http://ftpmaster.internal/ubuntu noble/main ppc64el libboost-iostreams1.83.0 ppc64el 1.83.0-2ubuntu1 [340 kB] 369s Get:5 http://ftpmaster.internal/ubuntu noble/main ppc64el libdeflate0 ppc64el 1.19-1 [61.9 kB] 369s Get:6 http://ftpmaster.internal/ubuntu noble/universe ppc64el libhtscodecs2 ppc64el 1.6.0-1 [110 kB] 369s Get:7 http://ftpmaster.internal/ubuntu noble/universe ppc64el libhts3 ppc64el 1.18+ds-1 [553 kB] 372s Get:8 http://ftpmaster.internal/ubuntu noble/main ppc64el libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] 372s Get:9 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] 372s Get:10 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] 372s Get:11 http://ftpmaster.internal/ubuntu noble/main ppc64el fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] 372s Get:12 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-normalize.css all 8.0.1-5 [10.8 kB] 372s Get:13 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] 372s Get:14 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB] 372s Get:15 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B] 372s Get:16 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB] 372s Get:17 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB] 372s Get:18 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB] 372s Get:19 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB] 372s Get:20 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB] 372s Get:21 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB] 372s Get:22 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB] 372s Get:23 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-brush all 1.1.6+~1.1.5-1 [181 kB] 372s Get:24 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB] 372s Get:25 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB] 372s Get:26 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB] 372s Get:27 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB] 372s Get:28 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] 372s Get:29 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-iconv-lite all 0.6.3-3 [158 kB] 372s Get:30 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-queue all 3.0.7-13 [10.2 kB] 372s Get:31 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-rw all 1.3.3-5 [7570 B] 372s Get:32 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-commander all 9.4.1-1 [50.6 kB] 372s Get:33 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB] 372s Get:34 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB] 372s Get:35 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB] 372s Get:36 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB] 372s Get:37 http://ftpmaster.internal/ubuntu noble/universe ppc64el libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB] 372s Get:38 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB] 372s Get:39 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB] 372s Get:40 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB] 372s Get:41 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B] 372s Get:42 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-random all 1.1.2+~1.1.3-1 [9140 B] 372s Get:43 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB] 372s Get:44 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB] 372s Get:45 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB] 372s Get:46 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB] 372s Get:47 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB] 372s Get:48 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB] 372s Get:49 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB] 372s Get:50 http://ftpmaster.internal/ubuntu noble/universe ppc64el node-d3 all 5.16.0+~cs5.28.10-1 [194 kB] 372s Get:51 http://ftpmaster.internal/ubuntu noble/universe ppc64el ataqv ppc64el 1.3.1+ds-2build1 [3408 kB] 372s Fetched 8157 kB in 2s (3682 kB/s) 372s Selecting previously unselected package libboost-chrono1.83.0:ppc64el. 372s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 69714 files and directories currently installed.) 372s Preparing to unpack .../00-libboost-chrono1.83.0_1.83.0-2ubuntu1_ppc64el.deb ... 372s Unpacking libboost-chrono1.83.0:ppc64el (1.83.0-2ubuntu1) ... 372s Selecting previously unselected package libboost-filesystem1.83.0:ppc64el. 372s Preparing to unpack .../01-libboost-filesystem1.83.0_1.83.0-2ubuntu1_ppc64el.deb ... 372s Unpacking libboost-filesystem1.83.0:ppc64el (1.83.0-2ubuntu1) ... 372s Selecting previously unselected package libboost-iostreams1.83.0:ppc64el. 372s Preparing to unpack .../02-libboost-iostreams1.83.0_1.83.0-2ubuntu1_ppc64el.deb ... 372s Unpacking libboost-iostreams1.83.0:ppc64el (1.83.0-2ubuntu1) ... 372s Selecting previously unselected package libdeflate0:ppc64el. 372s Preparing to unpack .../03-libdeflate0_1.19-1_ppc64el.deb ... 372s Unpacking libdeflate0:ppc64el (1.19-1) ... 372s Selecting previously unselected package libhtscodecs2:ppc64el. 372s Preparing to unpack .../04-libhtscodecs2_1.6.0-1_ppc64el.deb ... 372s Unpacking libhtscodecs2:ppc64el (1.6.0-1) ... 372s Selecting previously unselected package libhts3:ppc64el. 372s Preparing to unpack .../05-libhts3_1.18+ds-1_ppc64el.deb ... 372s Unpacking libhts3:ppc64el (1.18+ds-1) ... 372s Selecting previously unselected package libjs-jquery. 372s Preparing to unpack .../06-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... 372s Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 372s Selecting previously unselected package libjs-jquery-datatables. 372s Preparing to unpack .../07-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... 372s Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... 372s Selecting previously unselected package libjs-jquery-datatables-extensions. 372s Preparing to unpack .../08-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... 372s Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 372s Selecting previously unselected package fonts-font-awesome. 372s Preparing to unpack .../09-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... 372s Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 372s Selecting previously unselected package node-normalize.css. 372s Preparing to unpack .../10-node-normalize.css_8.0.1-5_all.deb ... 372s Unpacking node-normalize.css (8.0.1-5) ... 372s Selecting previously unselected package node-d3-array. 372s Preparing to unpack .../11-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... 372s Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... 372s Selecting previously unselected package node-d3-axis. 372s Preparing to unpack .../12-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... 372s Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... 372s Selecting previously unselected package node-d3-dispatch. 372s Preparing to unpack .../13-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... 372s Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... 372s Selecting previously unselected package node-d3-selection. 372s Preparing to unpack .../14-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... 372s Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... 372s Selecting previously unselected package node-d3-drag. 372s Preparing to unpack .../15-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... 372s Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... 372s Selecting previously unselected package node-d3-color. 372s Preparing to unpack .../16-node-d3-color_1.4.1+~1.4.2-1_all.deb ... 372s Unpacking node-d3-color (1.4.1+~1.4.2-1) ... 372s Selecting previously unselected package node-d3-interpolate. 372s Preparing to unpack .../17-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... 372s Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... 372s Selecting previously unselected package node-d3-ease. 372s Preparing to unpack .../18-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... 372s Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... 372s Selecting previously unselected package node-d3-timer. 372s Preparing to unpack .../19-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... 372s Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... 372s Selecting previously unselected package node-d3-transition. 372s Preparing to unpack .../20-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... 372s Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... 372s Selecting previously unselected package node-d3-brush. 372s Preparing to unpack .../21-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... 372s Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... 372s Selecting previously unselected package node-d3-path. 372s Preparing to unpack .../22-node-d3-path_1.0.9+~1.0.9-1_all.deb ... 372s Unpacking node-d3-path (1.0.9+~1.0.9-1) ... 372s Selecting previously unselected package node-d3-chord. 372s Preparing to unpack .../23-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... 372s Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... 372s Selecting previously unselected package node-d3-collection. 372s Preparing to unpack .../24-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... 372s Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... 372s Selecting previously unselected package node-d3-contour. 372s Preparing to unpack .../25-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... 372s Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... 372s Selecting previously unselected package node-safe-buffer. 372s Preparing to unpack .../26-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... 372s Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... 372s Selecting previously unselected package node-iconv-lite. 372s Preparing to unpack .../27-node-iconv-lite_0.6.3-3_all.deb ... 372s Unpacking node-iconv-lite (0.6.3-3) ... 372s Selecting previously unselected package node-d3-queue. 372s Preparing to unpack .../28-node-d3-queue_3.0.7-13_all.deb ... 372s Unpacking node-d3-queue (3.0.7-13) ... 372s Selecting previously unselected package node-rw. 372s Preparing to unpack .../29-node-rw_1.3.3-5_all.deb ... 372s Unpacking node-rw (1.3.3-5) ... 372s Selecting previously unselected package node-commander. 372s Preparing to unpack .../30-node-commander_9.4.1-1_all.deb ... 372s Unpacking node-commander (9.4.1-1) ... 372s Selecting previously unselected package node-d3-dsv. 372s Preparing to unpack .../31-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... 372s Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... 372s Selecting previously unselected package node-d3-fetch. 372s Preparing to unpack .../32-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... 372s Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... 372s Selecting previously unselected package node-d3-quadtree. 372s Preparing to unpack .../33-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... 372s Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... 372s Selecting previously unselected package node-d3-force. 372s Preparing to unpack .../34-node-d3-force_2.1.1+~2.1.4-1_all.deb ... 372s Unpacking node-d3-force (2.1.1+~2.1.4-1) ... 372s Selecting previously unselected package libjs-d3-format. 372s Preparing to unpack .../35-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 372s Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... 372s Selecting previously unselected package node-d3-format. 372s Preparing to unpack .../36-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 372s Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... 372s Selecting previously unselected package node-d3-geo. 372s Preparing to unpack .../37-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... 372s Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... 372s Selecting previously unselected package node-d3-hierarchy. 372s Preparing to unpack .../38-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... 372s Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... 372s Selecting previously unselected package node-d3-polygon. 372s Preparing to unpack .../39-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... 372s Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... 372s Selecting previously unselected package node-d3-random. 372s Preparing to unpack .../40-node-d3-random_1.1.2+~1.1.3-1_all.deb ... 372s Unpacking node-d3-random (1.1.2+~1.1.3-1) ... 372s Selecting previously unselected package node-d3-time. 372s Preparing to unpack .../41-node-d3-time_1.1.0+~1.1.1-1_all.deb ... 372s Unpacking node-d3-time (1.1.0+~1.1.1-1) ... 372s Selecting previously unselected package node-d3-time-format. 372s Preparing to unpack .../42-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... 372s Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... 372s Selecting previously unselected package node-d3-scale. 372s Preparing to unpack .../43-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... 372s Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... 372s Selecting previously unselected package node-d3-scale-chromatic. 372s Preparing to unpack .../44-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... 372s Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 372s Selecting previously unselected package node-d3-shape. 372s Preparing to unpack .../45-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... 372s Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... 372s Selecting previously unselected package node-d3-voronoi. 372s Preparing to unpack .../46-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... 372s Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... 372s Selecting previously unselected package node-d3-zoom. 372s Preparing to unpack .../47-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... 372s Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... 372s Selecting previously unselected package node-d3. 372s Preparing to unpack .../48-node-d3_5.16.0+~cs5.28.10-1_all.deb ... 372s Unpacking node-d3 (5.16.0+~cs5.28.10-1) ... 373s Selecting previously unselected package ataqv. 373s Preparing to unpack .../49-ataqv_1.3.1+ds-2build1_ppc64el.deb ... 373s Unpacking ataqv (1.3.1+ds-2build1) ... 373s Selecting previously unselected package autopkgtest-satdep. 373s Preparing to unpack .../50-1-autopkgtest-satdep.deb ... 373s Unpacking autopkgtest-satdep (0) ... 373s Setting up libhtscodecs2:ppc64el (1.6.0-1) ... 373s Setting up node-d3-timer (1.0.10+~1.0.10-1) ... 373s Setting up node-d3-color (1.4.1+~1.4.2-1) ... 373s Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... 373s Setting up node-d3-queue (3.0.7-13) ... 373s Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... 373s Setting up node-d3-ease (1.0.7+~1.0.11-1) ... 373s Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 373s Setting up libdeflate0:ppc64el (1.19-1) ... 373s Setting up node-d3-selection (1.4.1+~1.4.3-1) ... 373s Setting up node-d3-axis (1.0.12+~1.0.16-1) ... 373s Setting up libboost-filesystem1.83.0:ppc64el (1.83.0-2ubuntu1) ... 373s Setting up node-d3-path (1.0.9+~1.0.9-1) ... 373s Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... 373s Setting up node-rw (1.3.3-5) ... 373s Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... 373s Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... 373s Setting up libboost-iostreams1.83.0:ppc64el (1.83.0-2ubuntu1) ... 373s Setting up node-d3-collection (1.0.7+~1.0.10-1) ... 373s Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... 373s Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... 373s Setting up node-d3-time (1.1.0+~1.1.1-1) ... 373s Setting up node-commander (9.4.1-1) ... 373s Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... 373s Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... 373s Setting up libboost-chrono1.83.0:ppc64el (1.83.0-2ubuntu1) ... 373s Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 373s Setting up node-d3-geo (1.12.1+~1.12.4-1) ... 373s Setting up node-normalize.css (8.0.1-5) ... 373s Setting up node-d3-transition (1.3.2+~1.3.2-1) ... 373s Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 373s Setting up node-d3-random (1.1.2+~1.1.3-1) ... 373s Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 373s Setting up libhts3:ppc64el (1.18+ds-1) ... 373s Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... 373s Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... 373s Setting up node-d3-chord (1.0.6+~1.0.11-1) ... 373s Setting up node-d3-shape (1.3.7+~1.3.8-1) ... 373s Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... 373s Setting up node-d3-drag (1.2.5+~1.2.5-1) ... 373s Setting up node-iconv-lite (0.6.3-3) ... 373s Setting up node-d3-scale (2.2.2+~2.2.6-1) ... 373s Setting up node-d3-force (2.1.1+~2.1.4-1) ... 373s Setting up node-d3-contour (1.3.2+~1.3.3-1) ... 373s Setting up node-d3-brush (1.1.6+~1.1.5-1) ... 373s Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... 373s Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... 373s Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... 373s Setting up node-d3 (5.16.0+~cs5.28.10-1) ... 373s Setting up ataqv (1.3.1+ds-2build1) ... 373s Setting up autopkgtest-satdep (0) ... 373s Processing triggers for man-db (2.12.0-3) ... 373s Processing triggers for libc-bin (2.39-0ubuntu6) ... 377s (Reading database ... 71378 files and directories currently installed.) 377s Removing autopkgtest-satdep (0) ... 378s autopkgtest [18:49:18]: test run-unit-test: [----------------------- 379s Reading human autosomal references from autosomal_references.gz. 379s Autosomal references for human: 379s I 379s II 379s III 379s Reading human autosomal references from autosomal_references.gz. 379s Autosomal references for human: 379s I 379s II 379s III 379s Reading human autosomal references from autosomal_references.gz. 379s Autosomal references for human: 379s I 379s II 379s III 381s Read 411 excluded regions from exclude.dac.bed.gz. 381s Read 1649 excluded regions from exclude.duke.bed.gz. 381s Loading TSS file 'hg19.tss.refseq.bed.gz'. 382s Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] 382s Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 382s Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] 382s Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 382s Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] 383s Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] 383s Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] 383s Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] 383s Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] 383s Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] 383s Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] 383s Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] 383s Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] 383s Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] 383s chr1 feature count: 2687 383s chr2 feature count: 1715 383s chr3 feature count: 1490 383s chr4 feature count: 1004 383s chr5 feature count: 1132 383s chr6 feature count: 1368 383s chr7 feature count: 1169 383s chr8 feature count: 913 383s chr9 feature count: 1025 383s chr10 feature count: 1039 383s chr11 feature count: 1642 383s chr12 feature count: 1350 383s chr13 feature count: 433 383s chr14 feature count: 785 383s chr15 feature count: 812 383s chr16 feature count: 1106 383s chr17 feature count: 1528 383s chr18 feature count: 398 383s chr19 feature count: 1785 383s chr20 feature count: 694 383s chr21 feature count: 321 383s chr22 feature count: 593 383s Loaded 24989 TSS in 1.83014 seconds. (13654.2 TSS/second). 383s 383s Collecting metrics from test.bam. 383s 383s Logging problematic reads to SRR891275.problems. 383s 383s Loading peaks for read group SRR891275 from test.peaks.gz. 383s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 383s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 383s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 384s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 384s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 384s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 384s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 384s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 389s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 389s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 389s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 389s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 389s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 389s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 389s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 389s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 389s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 389s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 389s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 389s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 389s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 389s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 389s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 389s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 389s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 389s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 389s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 389s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 389s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 389s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 389s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 389s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 389s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 389s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 389s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 389s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 389s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 389s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 389s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 389s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 389s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 389s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 389s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 389s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 389s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 389s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 389s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 389s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 389s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 389s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 389s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 389s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 389s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 389s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 389s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 389s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 389s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 389s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 389s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 389s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 389s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 390s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 390s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 390s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 390s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 390s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 390s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 390s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 390s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 390s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 390s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 390s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 391s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 391s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 391s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 391s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 391s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 391s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 391s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 391s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 391s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 391s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 391s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 391s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 391s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 391s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 391s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 391s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 391s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 391s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 392s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 392s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 392s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 392s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 392s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 392s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 392s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 392s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 392s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 392s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 392s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 393s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 393s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 393s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 393s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 393s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 393s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 394s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 396s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 396s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 396s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 396s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 396s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 396s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 396s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 396s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 396s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 396s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 396s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 396s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 396s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 396s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 396s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 396s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 396s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 396s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 396s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 396s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 396s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 396s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 396s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 396s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 396s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 396s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 396s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 396s chr1 peak count: 3667 396s chr2 peak count: 3154 396s chr3 peak count: 2528 396s chr4 peak count: 1814 396s chr5 peak count: 2042 396s chr6 peak count: 2483 396s chr7 peak count: 1999 396s chr8 peak count: 1647 396s chr9 peak count: 1475 396s chr10 peak count: 1815 396s chr11 peak count: 1878 396s chr12 peak count: 2078 396s chr13 peak count: 1026 396s chr14 peak count: 1275 396s chr15 peak count: 1140 396s chr16 peak count: 1211 396s chr17 peak count: 1664 396s chr18 peak count: 772 396s chr19 peak count: 1595 396s chr20 peak count: 864 396s chr21 peak count: 487 396s chr22 peak count: 662 396s Loaded 37276 peaks in 12.8368 seconds. (2903.85 peaks/second). 396s 396s Logging problematic reads to SRR891278.problems. 396s 396s Loading peaks for read group SRR891278 from test.peaks.gz. 396s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 396s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 396s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 397s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 397s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 397s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 397s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 397s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 398s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 398s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 398s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 398s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 398s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 398s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 398s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 399s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 399s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 399s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 399s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 399s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 399s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 399s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 399s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 400s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 400s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 400s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 400s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 400s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 400s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 400s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 401s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 401s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 401s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 401s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 401s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 401s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 401s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 401s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 401s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 401s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 402s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 402s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 402s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 402s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 402s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 402s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 402s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 402s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 402s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 402s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 402s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 402s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 402s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 402s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 402s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 402s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 402s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 402s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 402s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 402s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 402s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 402s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 402s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 402s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 402s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 402s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 402s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 402s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 403s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 403s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 403s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 403s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 403s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 404s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 404s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 404s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 404s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 404s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 404s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 404s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 404s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 404s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 404s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 404s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 404s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 404s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 404s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 404s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 404s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 404s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 404s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 404s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 404s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 405s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 405s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 405s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 405s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 405s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 405s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 405s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 405s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 405s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 406s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 406s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 406s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 406s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 406s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 406s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 408s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 408s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 408s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 408s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 408s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 408s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 408s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 408s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 408s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 408s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 408s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 408s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 408s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 408s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 408s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 408s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 408s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 408s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 409s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 409s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 409s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 409s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 409s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 409s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 409s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 409s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 409s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 409s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 409s chr1 peak count: 3667 409s chr2 peak count: 3154 409s chr3 peak count: 2528 409s chr4 peak count: 1814 409s chr5 peak count: 2042 409s chr6 peak count: 2483 409s chr7 peak count: 1999 409s chr8 peak count: 1647 409s chr9 peak count: 1475 409s chr10 peak count: 1815 409s chr11 peak count: 1878 409s chr12 peak count: 2078 409s chr13 peak count: 1026 409s chr14 peak count: 1275 409s chr15 peak count: 1140 409s chr16 peak count: 1211 409s chr17 peak count: 1664 409s chr18 peak count: 772 409s chr19 peak count: 1595 409s chr20 peak count: 864 409s chr21 peak count: 487 409s chr22 peak count: 662 409s Loaded 37276 peaks in 12.8528 seconds. (2900.23 peaks/second). 409s 409s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 409s New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 409s New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 409s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 409s 5: 439 (84.423%) 409s 10: 439 (84.423%) 409s 15: 438 (84.231%) 409s 20: 436 (83.846%) 409s 25: 435 (83.654%) 409s 30: 420 (80.769%) 409s 409s Peak Metrics 409s ------------ 409s Peak count: 37276 409s 409s High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) 409s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 409s Top peak: 2 (1.000% of all high quality autosomal alignments) 409s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 409s Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) 409s Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) 409s Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) 409s 409s Read Group 409s ========== 409s ID: SRR891278 409s Library: SRR891278 409s Sample: GSM1155967 409s Description: a library of brutal tests? 409s 409s Sequencing center: 409s Sequencing date: 409s Sequencing platform: ILLUMINA 409s Platform model: 409s Platform unit: 409s Flow order: 409s Key sequence: 409s Predicted median insert size: 409s Programs: 409s 409s Metrics 409s ------- 409s 409s Read Mapping Metrics 409s -------------------- 409s Total reads: 520 409s Total problems: 90 (17.308%) 409s Properly paired and mapped reads: 430 (82.692%) 409s Secondary reads: 10 (1.923%) 409s Supplementary reads: 0 (0.000%) 409s Duplicate reads: 158 (30.385% of all reads) 409s 409s Quality Indicators 409s ------------------ 409s Short to mononucleosomal ratio: 2.357 409s High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 409s as a percentage of autosomal reads: 91.743% 409s as a percentage of all reads: 38.462% 409s TSS enrichment: 3.687 409s 409s Paired Read Metrics 409s ------------------- 409s Paired reads: 520 (100.000%) 409s Paired and mapped reads: 440 (84.615%) 409s FR reads: 430 (82.692308%) 409s First of pair: 259 (49.808%) 409s Second of pair: 261 (50.192%) 409s Forward reads: 261 (50.192%) 409s Reverse reads: 259 (49.808%) 409s Forward mate reads: 260 (50.000%) 409s Reverse mate reads: 260 (50.000%) 409s 409s Unmapped Read Metrics 409s --------------------- 409s Unmapped reads: 8 (1.538%) 409s Unmapped mate reads: 4 (0.769%) 409s Reads not passing quality controls: 0 (0.000%) 409s Unpaired reads: 0 (0.000%) 409s Reads with zero mapping quality: 49 (9.423%) 409s 409s Aberrant Mapping Metrics 409s ------------------------ 409s RF reads: 6 (1.153846%) 409s FF reads: 4 (0.769231%) 409s RR reads: 9 (1.730769%) 409s Reads that paired and mapped but... 409s on different chromosomes: 8 (1.538%) 409s probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) 409s just not properly: 0 (0.000%) 409s 409s Autosomal/Mitochondrial Metrics 409s ------------------------------- 409s Total autosomal reads: 218 (41.923% of all reads) 409s Total mitochondrial reads: 192 (36.923% of all reads) 409s Duplicate autosomal reads: 17 (7.798% of all autosomal reads) 409s Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) 409s 409s 409s Mapping Quality 409s --------------- 409s Mean MAPQ: 48.044 409s Median MAPQ: 60.000 409s Reads with MAPQ >=... 409s 5: 449 (86.346%) 409s 10: 445 (85.577%) 409s 15: 443 (85.192%) 409s 20: 442 (85.000%) 409s 25: 442 (85.000%) 409s 30: 417 (80.192%) 409s 409s Peak Metrics 409s ------------ 409s Peak count: 37276 409s 409s High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) 409s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 409s Top peak: 2 (1.000% of all high quality autosomal alignments) 409s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 409s Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) 409s Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) 409s Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) 409s 409s 410s [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory 410s Read 411 excluded regions from exclude.dac.bed.gz. 410s Read 1649 excluded regions from exclude.duke.bed.gz. 410s Collecting metrics from test.bam. 410s 410s Logging problematic reads to Test collector.problems. 410s 410s Loading peaks for read group Test collector from test.peaks.gz. 410s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] 410s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] 410s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] 410s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 410s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 410s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 410s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] 411s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] 412s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 412s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 412s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] 412s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 412s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 412s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 412s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] 413s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] 413s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] 413s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 413s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 413s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 413s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] 413s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] 413s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] 413s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 413s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 413s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 413s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 414s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] 414s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] 414s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] 415s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] 415s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] 415s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 415s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 415s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 415s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 415s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 415s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 415s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 415s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 417s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] 417s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 417s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 417s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] 417s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] 417s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] 417s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] 417s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] 417s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] 417s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 417s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] 417s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] 417s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] 417s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] 417s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 417s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 417s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 417s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] 417s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] 417s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 417s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] 417s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] 417s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] 417s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] 417s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] 418s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] 418s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 418s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] 418s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] 418s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] 418s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] 418s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 418s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 418s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 418s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] 418s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] 418s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] 418s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] 419s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] 419s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 419s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] 419s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] 420s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] 420s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] 420s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 420s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 420s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 420s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 421s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] 421s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] 421s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] 421s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] 421s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] 421s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 421s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 421s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 421s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 421s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] 422s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] 422s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 422s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] 422s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] 422s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 422s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 422s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] 422s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 422s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 422s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] 422s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] 422s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] 422s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] 423s chr1 peak count: 3667 423s chr2 peak count: 3154 423s chr3 peak count: 2528 423s chr4 peak count: 1814 423s chr5 peak count: 2042 423s chr6 peak count: 2483 423s chr7 peak count: 1999 423s chr8 peak count: 1647 423s chr9 peak count: 1475 423s chr10 peak count: 1815 423s chr11 peak count: 1878 423s chr12 peak count: 2078 423s chr13 peak count: 1026 423s chr14 peak count: 1275 423s chr15 peak count: 1140 423s chr16 peak count: 1211 423s chr17 peak count: 1664 423s chr18 peak count: 772 423s chr19 peak count: 1595 423s chr20 peak count: 864 423s chr21 peak count: 487 423s chr22 peak count: 662 423s Loaded 37276 peaks in 12.918 seconds. (2885.593 peaks/second). 423s 423s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 423s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 423s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 423s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 423s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 423s 5: 888 (85.385%) 423s 10: 884 (85.000%) 423s 15: 881 (84.712%) 423s 20: 878 (84.423%) 423s 25: 877 (84.327%) 423s 30: 837 (80.481%) 423s 423s Peak Metrics 423s ------------ 423s Peak count: 37276 423s 423s High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) 423s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 423s Top peak: 2 (0.500% of all high quality autosomal alignments) 423s Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) 423s Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) 423s Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) 423s Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) 423s 423s 423s Read 411 excluded regions from exclude.dac.bed.gz. 423s Read 1649 excluded regions from exclude.duke.bed.gz. 423s Collecting metrics from test.bam. 423s 423s Logging problematic reads to Test collector.problems. 423s 423s Loading peaks for read group Test collector from notthere.peaks.gz. 423s Read 411 excluded regions from exclude.dac.bed.gz. 423s Read 1649 excluded regions from exclude.duke.bed.gz. 423s Loading TSS file 'notthere.bed.gz'. 423s [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 423s =============================================================================== 423s All tests passed (241 assertions in 54 test cases) 423s 424s autopkgtest [18:50:04]: test run-unit-test: -----------------------] 424s run-unit-test PASS 424s autopkgtest [18:50:04]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 426s autopkgtest [18:50:06]: @@@@@@@@@@@@@@@@@@@@ summary 426s run-unit-test PASS 480s Creating nova instance adt-noble-ppc64el-ataqv-20240325-184300-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-ppc64el-server-20240325.img (UUID ce50e202-ac12-4562-879d-419903f0141e)...