0s autopkgtest [22:50:13]: starting date: 2024-03-18 0s autopkgtest [22:50:13]: git checkout: d9c0295b adt_testbed.py: supress warnings from apt using a shell pipeline 0s autopkgtest [22:50:13]: host juju-7f2275-prod-proposed-migration-environment-4; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.0181ngwq/out --timeout-copy=6000 --setup-commands 'sed -i "s/ports.ubuntu.com/ftpmaster.internal/; s/ubuntu-ports/ubuntu/" /etc/apt/sources.list `ls /etc/apt/sources.list.d/*.list 2>/dev/null || true`; ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.0.13-0ubuntu2 -- lxd -r lxd-armhf-10.44.124.252 lxd-armhf-10.44.124.252:autopkgtest/ubuntu/noble/armhf 33s autopkgtest [22:50:46]: @@@@@@@@@@@@@@@@@@@@ test bed setup 34s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 35s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 35s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [52.0 kB] 35s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [485 kB] 35s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3720 kB] 35s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main armhf Packages [586 kB] 35s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main armhf c-n-f Metadata [2492 B] 35s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf Packages [1372 B] 35s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf c-n-f Metadata [116 B] 35s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf Packages [3580 kB] 36s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf c-n-f Metadata [7776 B] 36s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf Packages [35.6 kB] 36s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf c-n-f Metadata [116 B] 43s Fetched 8593 kB in 2s (3624 kB/s) 43s Reading package lists... 58s tee: /proc/self/fd/2: Permission denied 86s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 86s Hit:2 http://ports.ubuntu.com/ubuntu-ports noble InRelease 86s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 86s Hit:4 http://ports.ubuntu.com/ubuntu-ports noble-updates InRelease 86s Hit:5 http://ftpmaster.internal/ubuntu noble-security InRelease 86s Hit:6 http://ports.ubuntu.com/ubuntu-ports noble-backports InRelease 86s Hit:7 http://ftpmaster.internal/ubuntu noble-proposed InRelease 86s Hit:8 http://ports.ubuntu.com/ubuntu-ports noble-security InRelease 90s Reading package lists... 91s Reading package lists... 91s Building dependency tree... 91s Reading state information... 93s Calculating upgrade... 94s The following packages have been kept back: 94s openssl 94s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 94s Reading package lists... 95s Building dependency tree... 95s Reading state information... 96s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 98s autopkgtest [22:51:51]: rebooting testbed after setup commands that affected boot 126s autopkgtest [22:52:19]: testbed running kernel: Linux 5.4.0-173-generic #191-Ubuntu SMP Fri Feb 2 13:54:37 UTC 2024 130s autopkgtest [22:52:23]: testbed dpkg architecture: armhf 144s autopkgtest [22:52:37]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit 152s Get:1 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (dsc) [2502 B] 152s Get:2 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (tar) [16.4 MB] 152s Get:3 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (diff) [10.8 MB] 152s gpgv: Signature made Mon Dec 25 17:00:09 2023 UTC 152s gpgv: using EDDSA key A095B66EE09024BEE6A2F0722A27904BD7243EDA 152s gpgv: Can't check signature: No public key 152s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.3.1+ds-2.dsc: no acceptable signature found 155s autopkgtest [22:52:48]: testing package seqkit version 2.3.1+ds-2 155s autopkgtest [22:52:48]: build not needed 219s autopkgtest [22:53:52]: test run-unit-test: preparing testbed 232s Reading package lists... 233s Building dependency tree... 233s Reading state information... 234s Correcting dependencies...Starting pkgProblemResolver with broken count: 0 234s Starting 2 pkgProblemResolver with broken count: 0 234s Done 235s Done 235s Starting pkgProblemResolver with broken count: 0 236s Starting 2 pkgProblemResolver with broken count: 0 236s Done 237s The following additional packages will be installed: 237s seqkit seqkit-examples ssshtest 237s The following NEW packages will be installed: 237s seqkit seqkit-examples ssshtest 238s 0 upgraded, 3 newly installed, 0 to remove and 1 not upgraded. 238s 1 not fully installed or removed. 238s Need to get 47.5 MB of archives. 238s After this operation, 55.7 MB of additional disk space will be used. 238s Get:1 http://ftpmaster.internal/ubuntu noble/universe armhf seqkit armhf 2.3.1+ds-2 [7744 kB] 238s Get:2 http://ftpmaster.internal/ubuntu noble/universe armhf seqkit-examples all 2.3.1+ds-2 [39.7 MB] 240s Get:3 http://ftpmaster.internal/ubuntu noble/universe armhf ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B] 241s Fetched 47.5 MB in 2s (20.8 MB/s) 241s Selecting previously unselected package seqkit. 241s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 241s Preparing to unpack .../seqkit_2.3.1+ds-2_armhf.deb ... 241s Unpacking seqkit (2.3.1+ds-2) ... 241s Selecting previously unselected package seqkit-examples. 241s Preparing to unpack .../seqkit-examples_2.3.1+ds-2_all.deb ... 241s Unpacking seqkit-examples (2.3.1+ds-2) ... 241s Selecting previously unselected package ssshtest. 242s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ... 242s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ... 242s Setting up seqkit (2.3.1+ds-2) ... 242s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ... 242s Setting up seqkit-examples (2.3.1+ds-2) ... 242s Setting up autopkgtest-satdep (0) ... 242s Processing triggers for man-db (2.12.0-3) ... 260s (Reading database ... 58704 files and directories currently installed.) 260s Removing autopkgtest-satdep (0) ... 270s autopkgtest [22:54:43]: test run-unit-test: [----------------------- 273s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation) 274s tput: No value for $TERM and no -T specified 275s 275s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT 275s PASS "28645" == "28645" (LINE 28) 275s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30) 275s 275s seq_type ran in 0 sec with 2/0 lines to STDERR/OUT 275s PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36) 275s 275s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 275s PASS STDOUT CONTAINS "Protein" (LINE 42) 275s 275s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 275s PASS STDOUT CONTAINS "RNA" (LINE 48) 275s 275s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 275s PASS STDOUT CONTAINS "DNA" (LINE 54) 275s 275s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT 275s PASS STDOUT CONTAINS "DNA" (LINE 60) 275s PASS STDOUT CONTAINS "FASTQ" (LINE 61) 276s 276s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT 276s PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68) 276s 276s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT 276s PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72) 276s 276s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT 276s PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76) 276s 276s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT 276s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences 276s PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88) 277s 277s seq_rmgap_lowercapse ran in 1 sec with 0/2 lines to STDERR/OUT 277s PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95) 277s 277s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT 277s PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102) 277s 277s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 277s PASS "a" == "a" (LINE 117) 277s 277s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 277s PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123) 277s 277s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 277s PASS "gtn" == "gtn" (LINE 129) 277s 277s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 277s PASS "ACG" == "ACG" (LINE 135) 277s 277s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT 277s PASS "N" == "N" (LINE 141) 278s 278s subseq_gtf ran in 1 sec with 2/2 lines to STDERR/OUT 278s PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152) 278s 278s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 278s PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158) 278s 278s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 278s PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164) 278s 278s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT 278s PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170) 278s 278s sliding ran in 0 sec with 0/2 lines to STDERR/OUT 278s PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184) 279s 279s fx2tab_tab2fx ran in 1 sec with 0/92461 lines to STDERR/OUT 279s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197) 279s 279s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT 279s [ERRO] stat tests/reads_1.fq.gz: no such file or directory 280s [ERRO] xopen: no content 280s PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202) 280s 280s fx2tab_qual_len ran in 1 sec with 0/0 lines to STDERR/OUT 280s Length correlation: 280s PASS "1" == "1" (LINE 220) 280s Length correlation: 280s PASS "1" == "1" (LINE 224) 280s Qual correlation: 280s PASS "1" == "1" (LINE 228) 280s 280s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT 281s PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238) 281s 281s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT 281s PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244) 282s 282s grep_by_list_head100 ran in 1 sec with 1/299 lines to STDERR/OUT 282s PASS "100" == "100" (LINE 249) 282s 282s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT 283s PASS "3074" == "3074" (LINE 254) 283s 283s rmdup ran in 1 sec with 1/2 lines to STDERR/OUT 283s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277) 283s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278) 283s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier 283s 283s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT 283s PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284) 283s PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285) 283s [INFO] 0 duplicated records removed 283s [INFO] sample by proportion 283s [INFO] 2814 sequences outputted 283s 283s common ran in 0 sec with 5/0 lines to STDERR/OUT 284s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 299) 284s 284s split ran in 0 sec with 104/0 lines to STDERR/OUT 284s [INFO] 0 duplicated records removed 284s PASS "100" == "100" (LINE 316) 284s [INFO] 0 duplicated records removed 284s PASS "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" == "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" (LINE 317) 284s [INFO] sample by proportion 284s [INFO] 2814 sequences outputted 284s [INFO] sample by proportion 285s [INFO] 2814 sequences outputted 285s PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 324) 285s 285s head ran in 0 sec with 0/30 lines to STDERR/OUT 285s PASS "10" == "10" (LINE 332) 285s PASS "snq" == "snq" (LINE 341) 285s PASS "seq_2" == "seq_2" (LINE 350) 285s 285s restart ran in 0 sec with 0/2 lines to STDERR/OUT 285s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364) 285s 285s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT 286s PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370) 288s 288s shuffle ran in 3 sec with 20/0 lines to STDERR/OUT 289s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 389) 289s PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390) 289s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 393) 290s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 394) 290s PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 395) 290s 290s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT 290s Correlation: 290s PASS "1" == "1" (LINE 422) 291s 291s bam_mean_qual ran in 1 sec with 0/0 lines to STDERR/OUT 291s Correlation: 291s PASS "1" == "1" (LINE 432) 291s 291s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT 291s Correlation: 291s PASS "1" == "1" (LINE 442) 291s 291s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT 291s Correlation: 291s PASS "1" == "1" (LINE 452) 292s 292s bam_read_aln ran in 1 sec with 0/0 lines to STDERR/OUT 292s Correlation: 292s PASS "1" == "1" (LINE 462) 292s 292s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT 292s Correlation: 292s PASS "1" == "1" (LINE 475) 292s 292s bam_right_clip ran in 0 sec with 0/0 lines to STDERR/OUT 292s Correlation: 292s PASS "1" == "1" (LINE 488) 294s 294s bam_bundler ran in 1 sec with 13/9 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 498) 294s 294s bam_fish_regression ran in 1 sec with 0/0 lines to STDERR/OUT 294s PASS EXIT CODE (LINE 516) 294s 294s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 530) 294s 294s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 541) 294s 294s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 549) 294s 294s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT 294s PASS "0" == "0" (LINE 557) 302s 302s scat_fasta ran in 6 sec with 261/0 lines to STDERR/OUT 302s PASS "0" == "0" (LINE 606) 302s PASS "0" == "0" (LINE 608) 304s 304s scat_fastq ran in 4 sec with 531/0 lines to STDERR/OUT 304s PASS "0" == "0" (LINE 652) 304s PASS "0" == "0" (LINE 654) 304s [INFO] sample by number 304s [INFO] loading all sequences into memory... 304s [INFO] 9 sequences outputted 304s 304s faidx_id ran in 0 sec with 0/0 lines to STDERR/OUT 304s [INFO] 9 patterns loaded from file 304s [INFO] read sequences ... 304s [INFO] 9 sequences loaded 304s [INFO] sorting ... 304s [INFO] output ... 304s [INFO] read sequences ... 304s [INFO] 9 sequences loaded 304s [INFO] sorting ... 304s [INFO] output ... 304s PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 670) 305s 305s faidx_full_head ran in 1 sec with 0/0 lines to STDERR/OUT 305s [INFO] read sequences ... 305s [INFO] 9 patterns loaded from file 305s [INFO] 9 sequences loaded 305s [INFO] sorting ... 305s [INFO] output ... 305s [INFO] read sequences ... 305s [INFO] 9 sequences loaded 305s [INFO] sorting ... 305s [INFO] output ... 305s PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 677) 305s 305s faidx_region ran in 0 sec with 0/0 lines to STDERR/OUT 305s PASS "AGUUUGAGGCUGUAAACAUCCCCGACUGGAAGCUGUCACUCAGCAGAGCUUUCAGUCUGAUGUUUACCCCCUCCGACC" == "AGUUUGAGGCUGUAAACAUCCCCGACUGGAAGCUGUCACUCAGCAGAGCUUUCAGUCUGAUGUUUACCCCCUCCGACC" (LINE 686) 305s 305s sshtest v0.1.5 305s 305s 71 Tests 305s 0 Failures 305s 71 Successes 306s autopkgtest [22:55:19]: test run-unit-test: -----------------------] 310s run-unit-test PASS 310s autopkgtest [22:55:23]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 315s autopkgtest [22:55:28]: @@@@@@@@@@@@@@@@@@@@ summary 315s run-unit-test PASS