0s autopkgtest [00:13:42]: starting date and time: 2024-03-21 00:13:42+0000 0s autopkgtest [00:13:42]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [00:13:42]: host juju-7f2275-prod-proposed-migration-environment-4; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.4emws6c4/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed --apt-upgrade presto --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ncbi-blast+/2.12.0+ds-4build1 python3-defaults/3.12.2-0ubuntu1' -- lxd -r lxd-armhf-10.145.243.58 lxd-armhf-10.145.243.58:autopkgtest/ubuntu/noble/armhf 22s autopkgtest [00:14:04]: testbed dpkg architecture: armhf 24s autopkgtest [00:14:06]: testbed apt version: 2.7.12 24s autopkgtest [00:14:06]: @@@@@@@@@@@@@@@@@@@@ test bed setup 31s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 32s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3767 kB] 32s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [499 kB] 32s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [53.9 kB] 32s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 32s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main armhf Packages [629 kB] 32s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main armhf c-n-f Metadata [2492 B] 32s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf Packages [1372 B] 32s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf c-n-f Metadata [116 B] 32s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf Packages [3802 kB] 32s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf c-n-f Metadata [7776 B] 32s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf Packages [46.5 kB] 32s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf c-n-f Metadata [116 B] 34s Fetched 8933 kB in 2s (5438 kB/s) 35s Reading package lists... 43s tee: /proc/self/fd/2: Permission denied 65s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 65s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 65s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 66s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 67s Reading package lists... 67s Reading package lists... 67s Building dependency tree... 67s Reading state information... 68s Calculating upgrade... 68s The following packages were automatically installed and are no longer required: 68s linux-headers-6.8.0-11 python3-lib2to3 68s Use 'apt autoremove' to remove them. 68s The following packages will be REMOVED: 68s libapt-pkg6.0 libarchive13 libatm1 libcurl3-gnutls libcurl4 libdb5.3 libelf1 68s libext2fs2 libgdbm-compat4 libgdbm6 libglib2.0-0 libgnutls30 libgpgme11 68s libhogweed6 libmagic1 libnetplan0 libnettle8 libnpth0 libnvme1 libparted2 68s libpcap0.8 libperl5.38 libpng16-16 libpsl5 libreadline8 libreiserfscore0 68s libssl3 libtirpc3 libuv1 linux-headers-6.8.0-11-generic python3-distutils 68s The following NEW packages will be installed: 68s libapt-pkg6.0t64 libarchive13t64 libatm1t64 libcurl3t64-gnutls libcurl4t64 68s libdb5.3t64 libelf1t64 libext2fs2t64 libgdbm-compat4t64 libgdbm6t64 68s libglib2.0-0t64 libgnutls30t64 libgpgme11t64 libhogweed6t64 libmagic1t64 68s libnetplan1 libnettle8t64 libnpth0t64 libnvme1t64 libparted2t64 68s libpcap0.8t64 libperl5.38t64 libpng16-16t64 libpsl5t64 libreadline8t64 68s libreiserfscore0t64 libssl3t64 libtirpc3t64 libuv1t64 linux-headers-6.8.0-20 68s linux-headers-6.8.0-20-generic xdg-user-dirs 68s The following packages have been kept back: 68s multipath-tools 68s The following packages will be upgraded: 68s apparmor apt apt-utils bind9-dnsutils bind9-host bind9-libs binutils 68s binutils-arm-linux-gnueabihf binutils-common bolt bsdextrautils bsdutils 68s btrfs-progs coreutils cryptsetup-bin curl dbus dbus-bin dbus-daemon 68s dbus-session-bus-common dbus-system-bus-common dbus-user-session debianutils 68s dhcpcd-base dirmngr dmsetup dpkg dpkg-dev e2fsprogs e2fsprogs-l10n eject 68s fdisk file ftp fwupd gawk gcc-13-base gcc-14-base gir1.2-girepository-2.0 68s gir1.2-glib-2.0 gnupg gnupg-l10n gnupg-utils gpg gpg-agent gpg-wks-client 68s gpgconf gpgsm gpgv groff-base ibverbs-providers inetutils-telnet info 68s initramfs-tools initramfs-tools-bin initramfs-tools-core install-info 68s iproute2 jq keyboxd kmod kpartx krb5-locales libapparmor1 libaudit-common 68s libaudit1 libbinutils libblkid1 libblockdev-crypto3 libblockdev-fs3 68s libblockdev-loop3 libblockdev-mdraid3 libblockdev-nvme3 libblockdev-part3 68s libblockdev-swap3 libblockdev-utils3 libblockdev3 libbpf1 libbrotli1 libbsd0 68s libc-bin libc6 libcap-ng0 libcom-err2 libcryptsetup12 libctf-nobfd0 libctf0 68s libdbus-1-3 libdebconfclient0 libdevmapper1.02.1 libdpkg-perl 68s libevent-core-2.1-7 libexpat1 libfdisk1 libfido2-1 libftdi1-2 libfwupd2 68s libgcc-s1 libgirepository-1.0-1 libglib2.0-data libgssapi-krb5-2 68s libgudev-1.0-0 libgusb2 libibverbs1 libjcat1 libjq1 libjson-glib-1.0-0 68s libjson-glib-1.0-common libk5crypto3 libkmod2 libkrb5-3 libkrb5support0 68s libldap-common libldap2 liblocale-gettext-perl liblzma5 libmagic-mgc 68s libmbim-glib4 libmbim-proxy libmm-glib0 libmount1 libnghttp2-14 libnsl2 68s libnss-systemd libpam-modules libpam-modules-bin libpam-runtime 68s libpam-systemd libpam0g libplymouth5 libpolkit-agent-1-0 68s libpolkit-gobject-1-0 libpython3-stdlib libpython3.11-minimal 68s libpython3.11-stdlib libpython3.12-minimal libpython3.12-stdlib libqmi-glib5 68s libqmi-proxy libqrtr-glib0 librtmp1 libsasl2-2 libsasl2-modules 68s libsasl2-modules-db libseccomp2 libselinux1 libsemanage-common libsemanage2 68s libsframe1 libslang2 libsmartcols1 libsqlite3-0 libss2 libssh-4 libstdc++6 68s libsystemd-shared libsystemd0 libtext-charwidth-perl libtext-iconv-perl 68s libtirpc-common libudev1 libudisks2-0 libusb-1.0-0 libuuid1 libvolume-key1 68s libxml2 libxmlb2 libxmuu1 linux-headers-generic locales logsave lshw lsof 68s man-db mount mtr-tiny netplan-generator netplan.io openssh-client 68s openssh-server openssh-sftp-server openssl parted perl perl-base 68s perl-modules-5.38 pinentry-curses plymouth plymouth-theme-ubuntu-text psmisc 68s python-apt-common python3 python3-apt python3-cryptography python3-dbus 68s python3-gdbm python3-gi python3-lib2to3 python3-markupsafe python3-minimal 68s python3-netplan python3-pkg-resources python3-pyrsistent python3-setuptools 68s python3-typing-extensions python3-yaml python3.11 python3.11-minimal 68s python3.12 python3.12-minimal readline-common rsync shared-mime-info sudo 68s systemd systemd-dev systemd-resolved systemd-sysv systemd-timesyncd tcpdump 68s telnet tnftp ubuntu-pro-client ubuntu-pro-client-l10n udev udisks2 usb.ids 68s util-linux uuid-runtime vim-common vim-tiny wget xxd xz-utils zlib1g 69s 235 upgraded, 32 newly installed, 31 to remove and 1 not upgraded. 69s Need to get 106 MB of archives. 69s After this operation, 84.4 MB of additional disk space will be used. 69s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bsdutils armhf 1:2.39.3-9ubuntu2 [102 kB] 69s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-14-base armhf 14-20240315-1ubuntu1 [47.0 kB] 69s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgcc-s1 armhf 14-20240315-1ubuntu1 [41.5 kB] 69s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libstdc++6 armhf 14-20240315-1ubuntu1 [714 kB] 69s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc6 armhf 2.39-0ubuntu6 [2827 kB] 69s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbrotli1 armhf 1.1.0-2build1 [319 kB] 69s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgssapi-krb5-2 armhf 1.20.1-5.1build3 [119 kB] 69s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkrb5-3 armhf 1.20.1-5.1build3 [321 kB] 69s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkrb5support0 armhf 1.20.1-5.1build3 [31.4 kB] 69s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libk5crypto3 armhf 1.20.1-5.1build3 [78.6 kB] 69s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcom-err2 armhf 1.47.0-2.4~exp1ubuntu2 [21.9 kB] 69s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/main armhf zlib1g armhf 1:1.3.dfsg-3.1ubuntu1 [49.2 kB] 69s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2build6 [51.3 kB] 69s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main armhf udisks2 armhf 2.10.1-6 [276 kB] 69s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libudisks2-0 armhf 2.10.1-6 [143 kB] 69s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblkid1 armhf 2.39.3-9ubuntu2 [160 kB] 69s Get:17 http://ftpmaster.internal/ubuntu noble-proposed/main armhf liblzma5 armhf 5.6.0-0.2 [117 kB] 69s Get:18 http://ftpmaster.internal/ubuntu noble-proposed/main armhf kmod armhf 31+20240202-2ubuntu4 [91.8 kB] 69s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkmod2 armhf 31+20240202-2ubuntu4 [44.9 kB] 69s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-dev all 255.4-1ubuntu5 [103 kB] 69s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-timesyncd armhf 255.4-1ubuntu5 [36.0 kB] 69s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-session-bus-common all 1.14.10-4ubuntu2 [80.3 kB] 69s Get:23 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libaudit-common all 1:3.1.2-2.1 [5674 B] 69s Get:24 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcap-ng0 armhf 0.8.4-2build1 [13.5 kB] 69s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libaudit1 armhf 1:3.1.2-2.1 [44.3 kB] 69s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam0g armhf 1.5.3-5ubuntu3 [62.0 kB] 69s Get:27 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libselinux1 armhf 3.5-2ubuntu1 [70.9 kB] 69s Get:28 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcurl4t64 armhf 8.5.0-2ubuntu7 [296 kB] 69s Get:29 http://ftpmaster.internal/ubuntu noble-proposed/main armhf curl armhf 8.5.0-2ubuntu7 [219 kB] 69s Get:30 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpsl5t64 armhf 0.21.2-1.1 [55.7 kB] 69s Get:31 http://ftpmaster.internal/ubuntu noble-proposed/main armhf wget armhf 1.21.4-1ubuntu2 [317 kB] 69s Get:32 http://ftpmaster.internal/ubuntu noble-proposed/main armhf tnftp armhf 20230507-2build1 [98.6 kB] 69s Get:33 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpcap0.8t64 armhf 1.10.4-4.1ubuntu1 [137 kB] 69s Get:34 http://ftpmaster.internal/ubuntu noble-proposed/main armhf tcpdump armhf 4.99.4-3ubuntu2 [425 kB] 69s Get:35 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsystemd-shared armhf 255.4-1ubuntu5 [2009 kB] 70s Get:36 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-resolved armhf 255.4-1ubuntu5 [289 kB] 70s Get:37 http://ftpmaster.internal/ubuntu noble-proposed/main armhf sudo armhf 1.9.15p5-3ubuntu3 [936 kB] 70s Get:38 http://ftpmaster.internal/ubuntu noble-proposed/main armhf rsync armhf 3.2.7-1build1 [413 kB] 70s Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-cryptography armhf 41.0.7-4build2 [788 kB] 70s Get:40 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssl armhf 3.0.13-0ubuntu2 [975 kB] 70s Get:41 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-sftp-server armhf 1:9.6p1-3ubuntu11 [35.5 kB] 70s Get:42 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-client armhf 1:9.6p1-3ubuntu11 [890 kB] 70s Get:43 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-server armhf 1:9.6p1-3ubuntu11 [503 kB] 70s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-6.8.0-20 all 6.8.0-20.20 [13.6 MB] 70s Get:45 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-6.8.0-20-generic armhf 6.8.0-20.20 [1287 kB] 70s Get:46 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-generic armhf 6.8.0-20.20+1 [9610 B] 70s Get:47 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libssl3t64 armhf 3.0.13-0ubuntu2 [1558 kB] 70s Get:48 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnss-systemd armhf 255.4-1ubuntu5 [148 kB] 70s Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libudev1 armhf 255.4-1ubuntu5 [166 kB] 70s Get:50 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd armhf 255.4-1ubuntu5 [3502 kB] 70s Get:51 http://ftpmaster.internal/ubuntu noble-proposed/main armhf udev armhf 255.4-1ubuntu5 [1852 kB] 70s Get:52 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-sysv armhf 255.4-1ubuntu5 [11.9 kB] 70s Get:53 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-systemd armhf 255.4-1ubuntu5 [216 kB] 70s Get:54 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsystemd0 armhf 255.4-1ubuntu5 [410 kB] 70s Get:55 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-modules-bin armhf 1.5.3-5ubuntu3 [47.0 kB] 70s Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-modules armhf 1.5.3-5ubuntu3 [261 kB] 70s Get:57 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-runtime all 1.5.3-5ubuntu3 [40.8 kB] 70s Get:58 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-user-session armhf 1.14.10-4ubuntu2 [9962 B] 70s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libapparmor1 armhf 4.0.0-beta3-0ubuntu2 [45.0 kB] 70s Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libexpat1 armhf 2.6.1-2 [65.9 kB] 70s Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-system-bus-common all 1.14.10-4ubuntu2 [81.5 kB] 70s Get:62 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-bin armhf 1.14.10-4ubuntu2 [37.1 kB] 70s Get:63 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus armhf 1.14.10-4ubuntu2 [28.1 kB] 70s Get:64 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-daemon armhf 1.14.10-4ubuntu2 [109 kB] 70s Get:65 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdbus-1-3 armhf 1.14.10-4ubuntu2 [190 kB] 70s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmount1 armhf 2.39.3-9ubuntu2 [171 kB] 70s Get:67 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libseccomp2 armhf 2.5.5-1ubuntu2 [49.5 kB] 70s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdevmapper1.02.1 armhf 2:1.02.185-3ubuntu2 [135 kB] 70s Get:69 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libuuid1 armhf 2.39.3-9ubuntu2 [34.4 kB] 70s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcryptsetup12 armhf 2:2.7.0-1ubuntu2 [238 kB] 70s Get:71 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfdisk1 armhf 2.39.3-9ubuntu2 [196 kB] 70s Get:72 http://ftpmaster.internal/ubuntu noble-proposed/main armhf mount armhf 2.39.3-9ubuntu2 [134 kB] 70s Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-utils3 armhf 3.1.0-1build1 [16.9 kB] 70s Get:74 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libvolume-key1 armhf 0.3.12-7build1 [38.4 kB] 70s Get:75 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjcat1 armhf 0.2.0-2build2 [30.4 kB] 70s Get:76 http://ftpmaster.internal/ubuntu noble-proposed/main armhf parted armhf 3.6-3.1build2 [39.4 kB] 70s Get:77 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libparted2t64 armhf 3.6-3.1build2 [143 kB] 70s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.12 armhf 3.12.2-4build3 [645 kB] 70s Get:79 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.12-minimal armhf 3.12.2-4build3 [1942 kB] 70s Get:80 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.12-stdlib armhf 3.12.2-4build3 [1906 kB] 70s Get:81 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.12-minimal armhf 3.12.2-4build3 [816 kB] 71s Get:82 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-modules-db armhf 2.1.28+dfsg1-4ubuntu4 [19.2 kB] 71s Get:83 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.11 armhf 3.11.8-1build4 [589 kB] 71s Get:84 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.11-minimal armhf 3.11.8-1build4 [1795 kB] 71s Get:85 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.11-stdlib armhf 3.11.8-1build4 [1810 kB] 71s Get:86 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.11-minimal armhf 3.11.8-1build4 [826 kB] 71s Get:87 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsqlite3-0 armhf 3.45.1-1ubuntu1 [599 kB] 71s Get:88 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtext-iconv-perl armhf 1.7-8build2 [12.7 kB] 71s Get:89 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtext-charwidth-perl armhf 0.04-11build2 [8962 B] 71s Get:90 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 71s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdb5.3t64 armhf 5.3.28+dfsg2-5build1 [661 kB] 71s Get:92 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-gdbm armhf 3.12.2-3ubuntu2 [17.1 kB] 71s Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main armhf man-db armhf 2.12.0-3build4 [1196 kB] 71s Get:94 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgdbm6t64 armhf 1.23-5.1 [30.3 kB] 71s Get:95 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgdbm-compat4t64 armhf 1.23-5.1 [6208 B] 71s Get:96 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libperl5.38t64 armhf 5.38.2-3.2 [4101 kB] 71s Get:97 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl armhf 5.38.2-3.2 [231 kB] 71s Get:98 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl-base armhf 5.38.2-3.2 [1671 kB] 71s Get:99 http://ftpmaster.internal/ubuntu noble-proposed/main armhf liblocale-gettext-perl armhf 1.07-6ubuntu3 [15.0 kB] 71s Get:100 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnettle8t64 armhf 3.9.1-2.2 [187 kB] 71s Get:101 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libhogweed6t64 armhf 3.9.1-2.2 [187 kB] 71s Get:102 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgnutls30t64 armhf 3.8.3-1.1ubuntu2 [1046 kB] 72s Get:103 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libldap2 armhf 2.6.7+dfsg-1~exp1ubuntu6 [172 kB] 72s Get:104 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcurl3t64-gnutls armhf 8.5.0-2ubuntu7 [290 kB] 72s Get:105 http://ftpmaster.internal/ubuntu noble-proposed/main armhf shared-mime-info armhf 2.4-1build1 [470 kB] 72s Get:106 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gir1.2-girepository-2.0 armhf 1.79.1-1ubuntu6 [24.8 kB] 72s Get:107 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gir1.2-glib-2.0 armhf 2.79.3-3ubuntu5 [182 kB] 72s Get:108 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgirepository-1.0-1 armhf 1.79.1-1ubuntu6 [106 kB] 72s Get:109 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-gi armhf 3.47.0-3build1 [219 kB] 72s Get:110 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-dbus armhf 1.3.2-5build2 [94.7 kB] 72s Get:111 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnetplan1 armhf 1.0-1 [113 kB] 72s Get:112 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-netplan armhf 1.0-1 [22.5 kB] 72s Get:113 http://ftpmaster.internal/ubuntu noble-proposed/main armhf netplan-generator armhf 1.0-1 [58.7 kB] 72s Get:114 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools-bin armhf 0.142ubuntu22 [20.1 kB] 72s Get:115 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools-core all 0.142ubuntu22 [50.0 kB] 72s Get:116 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools all 0.142ubuntu22 [9056 B] 72s Get:117 http://ftpmaster.internal/ubuntu noble-proposed/main armhf netplan.io armhf 1.0-1 [64.3 kB] 72s Get:118 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxmlb2 armhf 0.3.15-1build1 [57.0 kB] 72s Get:119 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqrtr-glib0 armhf 1.2.2-1ubuntu3 [15.4 kB] 72s Get:120 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqmi-glib5 armhf 1.35.2-0ubuntu1 [908 kB] 72s Get:121 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqmi-proxy armhf 1.35.2-0ubuntu1 [5732 B] 72s Get:122 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpolkit-agent-1-0 armhf 124-1ubuntu1 [15.3 kB] 72s Get:123 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpolkit-gobject-1-0 armhf 124-1ubuntu1 [44.1 kB] 72s Get:124 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libglib2.0-0t64 armhf 2.79.3-3ubuntu5 [1414 kB] 72s Get:125 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfwupd2 armhf 1.9.15-1 [123 kB] 72s Get:126 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libarchive13t64 armhf 3.7.2-1.1ubuntu1 [330 kB] 72s Get:127 http://ftpmaster.internal/ubuntu noble-proposed/main armhf fwupd armhf 1.9.15-1 [4349 kB] 72s Get:128 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apt-utils armhf 2.7.13ubuntu1 [210 kB] 72s Get:129 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libapt-pkg6.0t64 armhf 2.7.13ubuntu1 [986 kB] 72s Get:130 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apt armhf 2.7.13ubuntu1 [1367 kB] 72s Get:131 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ubuntu-pro-client-l10n armhf 31.2 [19.4 kB] 72s Get:132 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ubuntu-pro-client armhf 31.2 [216 kB] 72s Get:133 http://ftpmaster.internal/ubuntu noble-proposed/main armhf keyboxd armhf 2.4.4-2ubuntu15 [111 kB] 72s Get:134 http://ftpmaster.internal/ubuntu noble/main armhf libnpth0t64 armhf 1.6-3.1 [6940 B] 72s Get:135 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgv armhf 2.4.4-2ubuntu15 [224 kB] 72s Get:136 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg armhf 2.4.4-2ubuntu15 [524 kB] 72s Get:137 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg-wks-client armhf 2.4.4-2ubuntu15 [87.4 kB] 72s Get:138 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg-utils armhf 2.4.4-2ubuntu15 [158 kB] 72s Get:139 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg-agent armhf 2.4.4-2ubuntu15 [235 kB] 72s Get:140 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgsm armhf 2.4.4-2ubuntu15 [241 kB] 72s Get:141 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libreadline8t64 armhf 8.2-3.1 [129 kB] 72s Get:142 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gawk armhf 1:5.2.1-2build2 [415 kB] 72s Get:143 http://ftpmaster.internal/ubuntu noble-proposed/main armhf fdisk armhf 2.39.3-9ubuntu2 [135 kB] 72s Get:144 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgconf armhf 2.4.4-2ubuntu15 [115 kB] 72s Get:145 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dirmngr armhf 2.4.4-2ubuntu15 [346 kB] 72s Get:146 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg all 2.4.4-2ubuntu15 [359 kB] 72s Get:147 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-apt armhf 2.7.6build1 [162 kB] 72s Get:148 http://ftpmaster.internal/ubuntu noble-proposed/main armhf pinentry-curses armhf 1.2.1-3ubuntu4 [36.7 kB] 72s Get:149 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-yaml armhf 6.0.1-2build1 [117 kB] 72s Get:150 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python-apt-common all 2.7.6build1 [19.8 kB] 72s Get:151 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-setuptools all 68.1.2-2ubuntu1 [396 kB] 72s Get:152 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-pkg-resources all 68.1.2-2ubuntu1 [168 kB] 72s Get:153 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dpkg armhf 1.22.6ubuntu4 [1229 kB] 72s Get:154 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-minimal armhf 3.12.2-0ubuntu1 [27.1 kB] 72s Get:155 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3 armhf 3.12.2-0ubuntu1 [24.1 kB] 72s Get:156 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3-stdlib armhf 3.12.2-0ubuntu1 [9802 B] 72s Get:157 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsmartcols1 armhf 2.39.3-9ubuntu2 [117 kB] 72s Get:158 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bsdextrautils armhf 2.39.3-9ubuntu2 [78.7 kB] 72s Get:159 http://ftpmaster.internal/ubuntu noble-proposed/main armhf groff-base armhf 1.23.0-3build1 [946 kB] 72s Get:160 http://ftpmaster.internal/ubuntu noble-proposed/main armhf readline-common all 8.2-3.1 [56.4 kB] 72s Get:161 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgpgme11t64 armhf 1.18.0-4.1ubuntu3 [120 kB] 72s Get:162 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-crypto3 armhf 3.1.0-1build1 [20.3 kB] 72s Get:163 http://ftpmaster.internal/ubuntu noble-proposed/main armhf e2fsprogs-l10n all 1.47.0-2.4~exp1ubuntu2 [5996 B] 72s Get:164 http://ftpmaster.internal/ubuntu noble-proposed/main armhf logsave armhf 1.47.0-2.4~exp1ubuntu2 [21.9 kB] 72s Get:165 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dhcpcd-base armhf 1:10.0.6-1ubuntu2 [186 kB] 72s Get:166 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-fs3 armhf 3.1.0-1build1 [34.4 kB] 72s Get:167 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libreiserfscore0t64 armhf 1:3.6.27-7.1 [66.2 kB] 72s Get:168 http://ftpmaster.internal/ubuntu noble-proposed/main armhf btrfs-progs armhf 6.6.3-1.1build1 [852 kB] 72s Get:169 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libext2fs2t64 armhf 1.47.0-2.4~exp1ubuntu2 [201 kB] 73s Get:170 http://ftpmaster.internal/ubuntu noble-proposed/main armhf e2fsprogs armhf 1.47.0-2.4~exp1ubuntu2 [571 kB] 73s Get:171 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-loop3 armhf 3.1.0-1build1 [6502 B] 73s Get:172 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-mdraid3 armhf 3.1.0-1build1 [13.3 kB] 73s Get:173 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-nvme3 armhf 3.1.0-1build1 [17.5 kB] 73s Get:174 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnvme1t64 armhf 1.8-3 [67.5 kB] 73s Get:175 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-part3 armhf 3.1.0-1build1 [16.4 kB] 73s Get:176 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-swap3 armhf 3.1.0-1build1 [8894 B] 73s Get:177 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev3 armhf 3.1.0-1build1 [42.9 kB] 73s Get:178 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgudev-1.0-0 armhf 1:238-3ubuntu2 [13.6 kB] 73s Get:179 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxml2 armhf 2.9.14+dfsg-1.3ubuntu2 [595 kB] 73s Get:180 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbpf1 armhf 1:1.3.0-2build1 [146 kB] 73s Get:181 http://ftpmaster.internal/ubuntu noble-proposed/main armhf iproute2 armhf 6.1.0-1ubuntu5 [1060 kB] 73s Get:182 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libelf1t64 armhf 0.190-1.1build2 [49.9 kB] 73s Get:183 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtirpc-common all 1.3.4+ds-1.1 [8018 B] 73s Get:184 http://ftpmaster.internal/ubuntu noble-proposed/main armhf lsof armhf 4.95.0-1build2 [248 kB] 73s Get:185 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnsl2 armhf 1.3.0-3build2 [36.5 kB] 73s Get:186 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtirpc3t64 armhf 1.3.4+ds-1.1 [73.2 kB] 73s Get:187 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmbim-proxy armhf 1.31.2-0ubuntu2 [5748 B] 73s Get:188 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmbim-glib4 armhf 1.31.2-0ubuntu2 [216 kB] 73s Get:189 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjson-glib-1.0-common all 1.8.0-2build1 [4210 B] 73s Get:190 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjson-glib-1.0-0 armhf 1.8.0-2build1 [61.2 kB] 73s Get:191 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnghttp2-14 armhf 1.59.0-1build1 [68.1 kB] 73s Get:192 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libssh-4 armhf 0.10.6-2build1 [169 kB] 73s Get:193 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libusb-1.0-0 armhf 2:1.0.27-1 [48.7 kB] 73s Get:194 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgusb2 armhf 0.4.8-1build1 [34.6 kB] 73s Get:195 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmm-glib0 armhf 1.23.4-0ubuntu1 [214 kB] 73s Get:196 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-2 armhf 2.1.28+dfsg1-4ubuntu4 [49.7 kB] 73s Get:197 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libibverbs1 armhf 50.0-2build1 [57.9 kB] 73s Get:198 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfido2-1 armhf 1.14.0-1build1 [75.8 kB] 73s Get:199 http://ftpmaster.internal/ubuntu noble-proposed/main armhf coreutils armhf 9.4-3ubuntu3 [1280 kB] 73s Get:200 http://ftpmaster.internal/ubuntu noble-proposed/main armhf debianutils armhf 5.17 [88.9 kB] 73s Get:201 http://ftpmaster.internal/ubuntu noble-proposed/main armhf util-linux armhf 2.39.3-9ubuntu2 [1216 kB] 73s Get:202 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc-bin armhf 2.39-0ubuntu6 [530 kB] 73s Get:203 http://ftpmaster.internal/ubuntu noble-proposed/main armhf file armhf 1:5.45-3 [21.1 kB] 73s Get:204 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmagic-mgc armhf 1:5.45-3 [307 kB] 73s Get:205 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmagic1t64 armhf 1:5.45-3 [81.4 kB] 73s Get:206 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libplymouth5 armhf 24.004.60-1ubuntu5 [140 kB] 73s Get:207 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpng16-16t64 armhf 1.6.43-3 [166 kB] 73s Get:208 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-host armhf 1:9.18.24-0ubuntu3 [47.4 kB] 73s Get:209 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-dnsutils armhf 1:9.18.24-0ubuntu3 [149 kB] 73s Get:210 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-libs armhf 1:9.18.24-0ubuntu3 [1148 kB] 74s Get:211 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libuv1t64 armhf 1.48.0-1.1 [82.9 kB] 74s Get:212 http://ftpmaster.internal/ubuntu noble-proposed/main armhf uuid-runtime armhf 2.39.3-9ubuntu2 [41.7 kB] 74s Get:213 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdebconfclient0 armhf 0.271ubuntu2 [10.8 kB] 74s Get:214 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsemanage-common all 3.5-1build4 [10.1 kB] 74s Get:215 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsemanage2 armhf 3.5-1build4 [84.5 kB] 74s Get:216 http://ftpmaster.internal/ubuntu noble-proposed/main armhf install-info armhf 7.1-3build1 [60.5 kB] 74s Get:217 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-13-base armhf 13.2.0-19ubuntu1 [47.7 kB] 74s Get:218 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libss2 armhf 1.47.0-2.4~exp1ubuntu2 [14.7 kB] 74s Get:219 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dmsetup armhf 2:1.02.185-3ubuntu2 [81.1 kB] 74s Get:220 http://ftpmaster.internal/ubuntu noble-proposed/main armhf eject armhf 2.39.3-9ubuntu2 [43.2 kB] 74s Get:221 http://ftpmaster.internal/ubuntu noble-proposed/main armhf krb5-locales all 1.20.1-5.1build3 [13.8 kB] 74s Get:222 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbsd0 armhf 0.12.1-1 [36.6 kB] 74s Get:223 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libglib2.0-data all 2.79.3-3ubuntu5 [46.6 kB] 74s Get:224 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libslang2 armhf 2.3.3-3build1 [478 kB] 74s Get:225 http://ftpmaster.internal/ubuntu noble-proposed/main armhf locales all 2.39-0ubuntu6 [4232 kB] 74s Get:226 http://ftpmaster.internal/ubuntu noble-proposed/main armhf vim-tiny armhf 2:9.1.0016-1ubuntu5 [665 kB] 74s Get:227 http://ftpmaster.internal/ubuntu noble-proposed/main armhf vim-common all 2:9.1.0016-1ubuntu5 [385 kB] 74s Get:228 http://ftpmaster.internal/ubuntu noble/main armhf xdg-user-dirs armhf 0.18-1 [17.3 kB] 74s Get:229 http://ftpmaster.internal/ubuntu noble-proposed/main armhf xxd armhf 2:9.1.0016-1ubuntu5 [62.4 kB] 74s Get:230 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apparmor armhf 4.0.0-beta3-0ubuntu2 [562 kB] 74s Get:231 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ftp all 20230507-2build1 [4724 B] 74s Get:232 http://ftpmaster.internal/ubuntu noble-proposed/main armhf inetutils-telnet armhf 2:2.5-3ubuntu3 [90.7 kB] 74s Get:233 http://ftpmaster.internal/ubuntu noble-proposed/main armhf info armhf 7.1-3build1 [127 kB] 74s Get:234 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxmuu1 armhf 2:1.1.3-3build1 [8004 B] 74s Get:235 http://ftpmaster.internal/ubuntu noble-proposed/main armhf lshw armhf 02.19.git.2021.06.19.996aaad9c7-2build2 [310 kB] 74s Get:236 http://ftpmaster.internal/ubuntu noble-proposed/main armhf mtr-tiny armhf 0.95-1.1build1 [51.7 kB] 74s Get:237 http://ftpmaster.internal/ubuntu noble-proposed/main armhf plymouth-theme-ubuntu-text armhf 24.004.60-1ubuntu5 [9826 B] 74s Get:238 http://ftpmaster.internal/ubuntu noble-proposed/main armhf plymouth armhf 24.004.60-1ubuntu5 [143 kB] 74s Get:239 http://ftpmaster.internal/ubuntu noble-proposed/main armhf psmisc armhf 23.7-1 [176 kB] 74s Get:240 http://ftpmaster.internal/ubuntu noble-proposed/main armhf telnet all 0.17+2.5-3ubuntu3 [3682 B] 74s Get:241 http://ftpmaster.internal/ubuntu noble-proposed/main armhf usb.ids all 2024.03.18-1 [223 kB] 74s Get:242 http://ftpmaster.internal/ubuntu noble-proposed/main armhf xz-utils armhf 5.6.0-0.2 [271 kB] 74s Get:243 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libctf0 armhf 2.42-4ubuntu1 [87.7 kB] 74s Get:244 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libctf-nobfd0 armhf 2.42-4ubuntu1 [88.0 kB] 74s Get:245 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils-arm-linux-gnueabihf armhf 2.42-4ubuntu1 [2925 kB] 74s Get:246 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbinutils armhf 2.42-4ubuntu1 [464 kB] 74s Get:247 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils armhf 2.42-4ubuntu1 [3078 B] 74s Get:248 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils-common armhf 2.42-4ubuntu1 [217 kB] 74s Get:249 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsframe1 armhf 2.42-4ubuntu1 [13.1 kB] 74s Get:250 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bolt armhf 0.9.6-2build1 [138 kB] 74s Get:251 http://ftpmaster.internal/ubuntu noble-proposed/main armhf cryptsetup-bin armhf 2:2.7.0-1ubuntu2 [214 kB] 74s Get:252 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dpkg-dev all 1.22.6ubuntu4 [1074 kB] 74s Get:253 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdpkg-perl all 1.22.6ubuntu4 [268 kB] 74s Get:254 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg-l10n all 2.4.4-2ubuntu15 [65.8 kB] 74s Get:255 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ibverbs-providers armhf 50.0-2build1 [27.4 kB] 74s Get:256 http://ftpmaster.internal/ubuntu noble-proposed/main armhf jq armhf 1.7.1-3 [65.2 kB] 74s Get:257 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjq1 armhf 1.7.1-3 [156 kB] 74s Get:258 http://ftpmaster.internal/ubuntu noble/main armhf libatm1t64 armhf 1:2.5.1-5.1 [20.0 kB] 74s Get:259 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libevent-core-2.1-7 armhf 2.1.12-stable-9build1 [82.3 kB] 74s Get:260 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libftdi1-2 armhf 1.5-6build4 [25.7 kB] 74s Get:261 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libldap-common all 2.6.7+dfsg-1~exp1ubuntu6 [31.3 kB] 74s Get:262 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-modules armhf 2.1.28+dfsg1-4ubuntu4 [61.4 kB] 74s Get:263 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-lib2to3 all 3.12.2-3ubuntu2 [79.3 kB] 74s Get:264 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-markupsafe armhf 2.1.5-1build1 [12.1 kB] 74s Get:265 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-pyrsistent armhf 0.20.0-1build1 [53.0 kB] 74s Get:266 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-typing-extensions all 4.10.0-1 [60.7 kB] 74s Get:267 http://ftpmaster.internal/ubuntu noble-proposed/main armhf kpartx armhf 0.9.4-5ubuntu5 [31.4 kB] 75s Preconfiguring packages ... 75s Fetched 106 MB in 6s (18.2 MB/s) 75s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 75s Preparing to unpack .../bsdutils_1%3a2.39.3-9ubuntu2_armhf.deb ... 75s Unpacking bsdutils (1:2.39.3-9ubuntu2) over (1:2.39.3-6ubuntu2) ... 75s Setting up bsdutils (1:2.39.3-9ubuntu2) ... 75s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 75s Preparing to unpack .../gcc-14-base_14-20240315-1ubuntu1_armhf.deb ... 75s Unpacking gcc-14-base:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 75s Setting up gcc-14-base:armhf (14-20240315-1ubuntu1) ... 76s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 76s Preparing to unpack .../libgcc-s1_14-20240315-1ubuntu1_armhf.deb ... 76s Unpacking libgcc-s1:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 76s Setting up libgcc-s1:armhf (14-20240315-1ubuntu1) ... 76s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 76s Preparing to unpack .../libstdc++6_14-20240315-1ubuntu1_armhf.deb ... 76s Unpacking libstdc++6:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 76s Setting up libstdc++6:armhf (14-20240315-1ubuntu1) ... 76s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 76s Preparing to unpack .../libc6_2.39-0ubuntu6_armhf.deb ... 76s Unpacking libc6:armhf (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 76s Setting up libc6:armhf (2.39-0ubuntu6) ... 77s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 77s Preparing to unpack .../0-libbrotli1_1.1.0-2build1_armhf.deb ... 77s Unpacking libbrotli1:armhf (1.1.0-2build1) over (1.1.0-2) ... 77s Preparing to unpack .../1-libgssapi-krb5-2_1.20.1-5.1build3_armhf.deb ... 77s Unpacking libgssapi-krb5-2:armhf (1.20.1-5.1build3) over (1.20.1-5build1) ... 77s Preparing to unpack .../2-libkrb5-3_1.20.1-5.1build3_armhf.deb ... 77s Unpacking libkrb5-3:armhf (1.20.1-5.1build3) over (1.20.1-5build1) ... 77s Preparing to unpack .../3-libkrb5support0_1.20.1-5.1build3_armhf.deb ... 77s Unpacking libkrb5support0:armhf (1.20.1-5.1build3) over (1.20.1-5build1) ... 77s Preparing to unpack .../4-libk5crypto3_1.20.1-5.1build3_armhf.deb ... 77s Unpacking libk5crypto3:armhf (1.20.1-5.1build3) over (1.20.1-5build1) ... 77s Preparing to unpack .../5-libcom-err2_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 77s Unpacking libcom-err2:armhf (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 77s Preparing to unpack .../6-zlib1g_1%3a1.3.dfsg-3.1ubuntu1_armhf.deb ... 77s Unpacking zlib1g:armhf (1:1.3.dfsg-3.1ubuntu1) over (1:1.3.dfsg-3ubuntu1) ... 77s Setting up zlib1g:armhf (1:1.3.dfsg-3.1ubuntu1) ... 77s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 77s Preparing to unpack .../librtmp1_2.4+20151223.gitfa8646d.1-2build6_armhf.deb ... 77s Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2build6) over (2.4+20151223.gitfa8646d.1-2build4) ... 77s Preparing to unpack .../udisks2_2.10.1-6_armhf.deb ... 77s Unpacking udisks2 (2.10.1-6) over (2.10.1-1ubuntu2) ... 77s Preparing to unpack .../libudisks2-0_2.10.1-6_armhf.deb ... 77s Unpacking libudisks2-0:armhf (2.10.1-6) over (2.10.1-1ubuntu2) ... 77s Preparing to unpack .../libblkid1_2.39.3-9ubuntu2_armhf.deb ... 77s Unpacking libblkid1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 77s Setting up libblkid1:armhf (2.39.3-9ubuntu2) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 78s Preparing to unpack .../liblzma5_5.6.0-0.2_armhf.deb ... 78s Unpacking liblzma5:armhf (5.6.0-0.2) over (5.4.5-0.3) ... 78s Setting up liblzma5:armhf (5.6.0-0.2) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 78s Preparing to unpack .../0-kmod_31+20240202-2ubuntu4_armhf.deb ... 78s Unpacking kmod (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 78s dpkg: warning: unable to delete old directory '/lib/modprobe.d': Directory not empty 78s Preparing to unpack .../1-libkmod2_31+20240202-2ubuntu4_armhf.deb ... 78s Unpacking libkmod2:armhf (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 78s Preparing to unpack .../2-systemd-dev_255.4-1ubuntu5_all.deb ... 78s Unpacking systemd-dev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 78s Preparing to unpack .../3-systemd-timesyncd_255.4-1ubuntu5_armhf.deb ... 78s Unpacking systemd-timesyncd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 78s Preparing to unpack .../4-dbus-session-bus-common_1.14.10-4ubuntu2_all.deb ... 78s Unpacking dbus-session-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 78s Preparing to unpack .../5-libaudit-common_1%3a3.1.2-2.1_all.deb ... 78s Unpacking libaudit-common (1:3.1.2-2.1) over (1:3.1.2-2) ... 78s Setting up libaudit-common (1:3.1.2-2.1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 78s Preparing to unpack .../libcap-ng0_0.8.4-2build1_armhf.deb ... 78s Unpacking libcap-ng0:armhf (0.8.4-2build1) over (0.8.4-2) ... 78s Setting up libcap-ng0:armhf (0.8.4-2build1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 78s Preparing to unpack .../libaudit1_1%3a3.1.2-2.1_armhf.deb ... 78s Unpacking libaudit1:armhf (1:3.1.2-2.1) over (1:3.1.2-2) ... 78s Setting up libaudit1:armhf (1:3.1.2-2.1) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 78s Preparing to unpack .../libpam0g_1.5.3-5ubuntu3_armhf.deb ... 78s Unpacking libpam0g:armhf (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 78s Setting up libpam0g:armhf (1.5.3-5ubuntu3) ... 78s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 78s Preparing to unpack .../libselinux1_3.5-2ubuntu1_armhf.deb ... 78s Unpacking libselinux1:armhf (3.5-2ubuntu1) over (3.5-2build1) ... 78s Setting up libselinux1:armhf (3.5-2ubuntu1) ... 78s dpkg: libcurl4:armhf: dependency problems, but removing anyway as you requested: 78s curl depends on libcurl4 (= 8.5.0-2ubuntu2). 78s 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 79s Removing libcurl4:armhf (8.5.0-2ubuntu2) ... 79s Selecting previously unselected package libcurl4t64:armhf. 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58614 files and directories currently installed.) 79s Preparing to unpack .../libcurl4t64_8.5.0-2ubuntu7_armhf.deb ... 79s Unpacking libcurl4t64:armhf (8.5.0-2ubuntu7) ... 79s Preparing to unpack .../curl_8.5.0-2ubuntu7_armhf.deb ... 79s Unpacking curl (8.5.0-2ubuntu7) over (8.5.0-2ubuntu2) ... 79s dpkg: libpsl5:armhf: dependency problems, but removing anyway as you requested: 79s wget depends on libpsl5 (>= 0.16.0). 79s libcurl3-gnutls:armhf depends on libpsl5 (>= 0.16.0). 79s 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 79s Removing libpsl5:armhf (0.21.2-1build1) ... 79s Selecting previously unselected package libpsl5t64:armhf. 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58615 files and directories currently installed.) 79s Preparing to unpack .../libpsl5t64_0.21.2-1.1_armhf.deb ... 79s Unpacking libpsl5t64:armhf (0.21.2-1.1) ... 79s Preparing to unpack .../wget_1.21.4-1ubuntu2_armhf.deb ... 79s Unpacking wget (1.21.4-1ubuntu2) over (1.21.4-1ubuntu1) ... 79s Preparing to unpack .../tnftp_20230507-2build1_armhf.deb ... 79s Unpacking tnftp (20230507-2build1) over (20230507-2) ... 79s dpkg: libpcap0.8:armhf: dependency problems, but removing anyway as you requested: 79s tcpdump depends on libpcap0.8 (>= 1.9.1). 79s 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58621 files and directories currently installed.) 79s Removing libpcap0.8:armhf (1.10.4-4ubuntu3) ... 79s Selecting previously unselected package libpcap0.8t64:armhf. 79s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58610 files and directories currently installed.) 79s Preparing to unpack .../00-libpcap0.8t64_1.10.4-4.1ubuntu1_armhf.deb ... 79s Unpacking libpcap0.8t64:armhf (1.10.4-4.1ubuntu1) ... 79s Preparing to unpack .../01-tcpdump_4.99.4-3ubuntu2_armhf.deb ... 79s Unpacking tcpdump (4.99.4-3ubuntu2) over (4.99.4-3ubuntu1) ... 79s Preparing to unpack .../02-libsystemd-shared_255.4-1ubuntu5_armhf.deb ... 79s Unpacking libsystemd-shared:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 79s Preparing to unpack .../03-systemd-resolved_255.4-1ubuntu5_armhf.deb ... 79s Unpacking systemd-resolved (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 79s Preparing to unpack .../04-sudo_1.9.15p5-3ubuntu3_armhf.deb ... 79s Unpacking sudo (1.9.15p5-3ubuntu3) over (1.9.15p5-3ubuntu1) ... 79s Preparing to unpack .../05-rsync_3.2.7-1build1_armhf.deb ... 79s Unpacking rsync (3.2.7-1build1) over (3.2.7-1) ... 79s Preparing to unpack .../06-python3-cryptography_41.0.7-4build2_armhf.deb ... 80s Unpacking python3-cryptography (41.0.7-4build2) over (41.0.7-3) ... 80s Preparing to unpack .../07-openssl_3.0.13-0ubuntu2_armhf.deb ... 80s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 80s Preparing to unpack .../08-openssh-sftp-server_1%3a9.6p1-3ubuntu11_armhf.deb ... 80s Unpacking openssh-sftp-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 80s Preparing to unpack .../09-openssh-client_1%3a9.6p1-3ubuntu11_armhf.deb ... 80s Unpacking openssh-client (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 80s Preparing to unpack .../10-openssh-server_1%3a9.6p1-3ubuntu11_armhf.deb ... 80s Unpacking openssh-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 80s Selecting previously unselected package linux-headers-6.8.0-20. 80s Preparing to unpack .../11-linux-headers-6.8.0-20_6.8.0-20.20_all.deb ... 80s Unpacking linux-headers-6.8.0-20 (6.8.0-20.20) ... 83s Selecting previously unselected package linux-headers-6.8.0-20-generic. 83s Preparing to unpack .../12-linux-headers-6.8.0-20-generic_6.8.0-20.20_armhf.deb ... 83s Unpacking linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 85s Preparing to unpack .../13-linux-headers-generic_6.8.0-20.20+1_armhf.deb ... 85s Unpacking linux-headers-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 89773 files and directories currently installed.) 85s Removing linux-headers-6.8.0-11-generic (6.8.0-11.11) ... 85s dpkg: libssl3:armhf: dependency problems, but removing anyway as you requested: 85s systemd depends on libssl3 (>= 3.0.0). 85s libssh-4:armhf depends on libssl3 (>= 3.0.0). 85s libsasl2-modules:armhf depends on libssl3 (>= 3.0.0). 85s libsasl2-2:armhf depends on libssl3 (>= 3.0.0). 85s libpython3.12-minimal:armhf depends on libssl3 (>= 3.0.0). 85s libpython3.11-minimal:armhf depends on libssl3 (>= 3.0.0). 85s libnvme1 depends on libssl3 (>= 3.0.0). 85s libfido2-1:armhf depends on libssl3 (>= 3.0.0). 85s libcryptsetup12:armhf depends on libssl3 (>= 3.0.0). 85s dhcpcd-base depends on libssl3 (>= 3.0.0). 85s bind9-libs:armhf depends on libssl3 (>= 3.0.0). 85s 85s Removing libssl3:armhf (3.0.10-1ubuntu4) ... 85s Selecting previously unselected package libssl3t64:armhf. 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78623 files and directories currently installed.) 85s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_armhf.deb ... 85s Unpacking libssl3t64:armhf (3.0.13-0ubuntu2) ... 85s Setting up libssl3t64:armhf (3.0.13-0ubuntu2) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78636 files and directories currently installed.) 85s Preparing to unpack .../libnss-systemd_255.4-1ubuntu5_armhf.deb ... 85s Unpacking libnss-systemd:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 86s Preparing to unpack .../libudev1_255.4-1ubuntu5_armhf.deb ... 86s Unpacking libudev1:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 86s Setting up libudev1:armhf (255.4-1ubuntu5) ... 86s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78636 files and directories currently installed.) 86s Preparing to unpack .../systemd_255.4-1ubuntu5_armhf.deb ... 86s Unpacking systemd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 87s Preparing to unpack .../udev_255.4-1ubuntu5_armhf.deb ... 87s Unpacking udev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 87s Preparing to unpack .../libsystemd0_255.4-1ubuntu5_armhf.deb ... 87s Unpacking libsystemd0:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 87s Setting up libsystemd0:armhf (255.4-1ubuntu5) ... 87s Setting up libkmod2:armhf (31+20240202-2ubuntu4) ... 87s Setting up libsystemd-shared:armhf (255.4-1ubuntu5) ... 87s Setting up systemd-dev (255.4-1ubuntu5) ... 87s Setting up systemd (255.4-1ubuntu5) ... 88s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78636 files and directories currently installed.) 88s Preparing to unpack .../systemd-sysv_255.4-1ubuntu5_armhf.deb ... 88s Unpacking systemd-sysv (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 88s Preparing to unpack .../libpam-systemd_255.4-1ubuntu5_armhf.deb ... 88s Unpacking libpam-systemd:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 88s Preparing to unpack .../libpam-modules-bin_1.5.3-5ubuntu3_armhf.deb ... 88s Unpacking libpam-modules-bin (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 88s Setting up libpam-modules-bin (1.5.3-5ubuntu3) ... 88s pam_namespace.service is a disabled or a static unit not running, not starting it. 88s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78636 files and directories currently installed.) 88s Preparing to unpack .../libpam-modules_1.5.3-5ubuntu3_armhf.deb ... 88s Unpacking libpam-modules:armhf (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 88s Setting up libpam-modules:armhf (1.5.3-5ubuntu3) ... 88s Installing new version of config file /etc/security/namespace.init ... 89s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 89s Preparing to unpack .../libpam-runtime_1.5.3-5ubuntu3_all.deb ... 89s Unpacking libpam-runtime (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 89s Setting up libpam-runtime (1.5.3-5ubuntu3) ... 89s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 89s Preparing to unpack .../0-dbus-user-session_1.14.10-4ubuntu2_armhf.deb ... 89s Unpacking dbus-user-session (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 89s Preparing to unpack .../1-libapparmor1_4.0.0-beta3-0ubuntu2_armhf.deb ... 89s Unpacking libapparmor1:armhf (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 89s Preparing to unpack .../2-libexpat1_2.6.1-2_armhf.deb ... 89s Unpacking libexpat1:armhf (2.6.1-2) over (2.6.0-1) ... 89s Preparing to unpack .../3-dbus-system-bus-common_1.14.10-4ubuntu2_all.deb ... 89s Unpacking dbus-system-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 89s Preparing to unpack .../4-dbus-bin_1.14.10-4ubuntu2_armhf.deb ... 89s Unpacking dbus-bin (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 89s Preparing to unpack .../5-dbus_1.14.10-4ubuntu2_armhf.deb ... 89s Unpacking dbus (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 89s Preparing to unpack .../6-dbus-daemon_1.14.10-4ubuntu2_armhf.deb ... 89s Unpacking dbus-daemon (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 89s Preparing to unpack .../7-libdbus-1-3_1.14.10-4ubuntu2_armhf.deb ... 89s Unpacking libdbus-1-3:armhf (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 90s Preparing to unpack .../8-libmount1_2.39.3-9ubuntu2_armhf.deb ... 90s Unpacking libmount1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 90s Setting up libmount1:armhf (2.39.3-9ubuntu2) ... 90s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 90s Preparing to unpack .../libseccomp2_2.5.5-1ubuntu2_armhf.deb ... 90s Unpacking libseccomp2:armhf (2.5.5-1ubuntu2) over (2.5.5-1ubuntu1) ... 90s Setting up libseccomp2:armhf (2.5.5-1ubuntu2) ... 90s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 90s Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.185-3ubuntu2_armhf.deb ... 90s Unpacking libdevmapper1.02.1:armhf (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 90s Preparing to unpack .../libuuid1_2.39.3-9ubuntu2_armhf.deb ... 90s Unpacking libuuid1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 90s Setting up libuuid1:armhf (2.39.3-9ubuntu2) ... 90s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 90s Preparing to unpack .../0-libcryptsetup12_2%3a2.7.0-1ubuntu2_armhf.deb ... 90s Unpacking libcryptsetup12:armhf (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 90s Preparing to unpack .../1-libfdisk1_2.39.3-9ubuntu2_armhf.deb ... 90s Unpacking libfdisk1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 90s Preparing to unpack .../2-mount_2.39.3-9ubuntu2_armhf.deb ... 90s Unpacking mount (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 90s Preparing to unpack .../3-libblockdev-utils3_3.1.0-1build1_armhf.deb ... 90s Unpacking libblockdev-utils3:armhf (3.1.0-1build1) over (3.1.0-1) ... 90s Preparing to unpack .../4-libvolume-key1_0.3.12-7build1_armhf.deb ... 90s Unpacking libvolume-key1:armhf (0.3.12-7build1) over (0.3.12-5build2) ... 90s Preparing to unpack .../5-libjcat1_0.2.0-2build2_armhf.deb ... 90s Unpacking libjcat1:armhf (0.2.0-2build2) over (0.2.0-2) ... 91s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78634 files and directories currently installed.) 91s Removing libgpgme11:armhf (1.18.0-4ubuntu1) ... 91s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78628 files and directories currently installed.) 91s Preparing to unpack .../parted_3.6-3.1build2_armhf.deb ... 91s Unpacking parted (3.6-3.1build2) over (3.6-3) ... 91s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78628 files and directories currently installed.) 91s Removing libparted2:armhf (3.6-3) ... 91s Selecting previously unselected package libparted2t64:armhf. 91s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 91s Preparing to unpack .../00-libparted2t64_3.6-3.1build2_armhf.deb ... 91s Unpacking libparted2t64:armhf (3.6-3.1build2) ... 91s Preparing to unpack .../01-python3.12_3.12.2-4build3_armhf.deb ... 91s Unpacking python3.12 (3.12.2-4build3) over (3.12.2-1) ... 91s Preparing to unpack .../02-python3.12-minimal_3.12.2-4build3_armhf.deb ... 91s Unpacking python3.12-minimal (3.12.2-4build3) over (3.12.2-1) ... 91s Preparing to unpack .../03-libpython3.12-stdlib_3.12.2-4build3_armhf.deb ... 91s Unpacking libpython3.12-stdlib:armhf (3.12.2-4build3) over (3.12.2-1) ... 92s Preparing to unpack .../04-libpython3.12-minimal_3.12.2-4build3_armhf.deb ... 92s Unpacking libpython3.12-minimal:armhf (3.12.2-4build3) over (3.12.2-1) ... 92s Preparing to unpack .../05-libsasl2-modules-db_2.1.28+dfsg1-4ubuntu4_armhf.deb ... 92s Unpacking libsasl2-modules-db:armhf (2.1.28+dfsg1-4ubuntu4) over (2.1.28+dfsg1-4) ... 92s Preparing to unpack .../06-python3.11_3.11.8-1build4_armhf.deb ... 92s Unpacking python3.11 (3.11.8-1build4) over (3.11.8-1) ... 92s Preparing to unpack .../07-python3.11-minimal_3.11.8-1build4_armhf.deb ... 92s Unpacking python3.11-minimal (3.11.8-1build4) over (3.11.8-1) ... 92s Preparing to unpack .../08-libpython3.11-stdlib_3.11.8-1build4_armhf.deb ... 92s Unpacking libpython3.11-stdlib:armhf (3.11.8-1build4) over (3.11.8-1) ... 93s Preparing to unpack .../09-libpython3.11-minimal_3.11.8-1build4_armhf.deb ... 93s Unpacking libpython3.11-minimal:armhf (3.11.8-1build4) over (3.11.8-1) ... 93s Preparing to unpack .../10-libsqlite3-0_3.45.1-1ubuntu1_armhf.deb ... 93s Unpacking libsqlite3-0:armhf (3.45.1-1ubuntu1) over (3.45.1-1) ... 93s Preparing to unpack .../11-libtext-iconv-perl_1.7-8build2_armhf.deb ... 93s Unpacking libtext-iconv-perl:armhf (1.7-8build2) over (1.7-8build1) ... 93s Preparing to unpack .../12-libtext-charwidth-perl_0.04-11build2_armhf.deb ... 93s Unpacking libtext-charwidth-perl:armhf (0.04-11build2) over (0.04-11build1) ... 93s Preparing to unpack .../13-perl-modules-5.38_5.38.2-3.2_all.deb ... 93s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 94s dpkg: libperl5.38:armhf: dependency problems, but removing anyway as you requested: 94s perl depends on libperl5.38 (= 5.38.2-3). 94s 94s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78625 files and directories currently installed.) 94s Removing libperl5.38:armhf (5.38.2-3) ... 94s dpkg: libdb5.3:armhf: dependency problems, but removing anyway as you requested: 94s iproute2 depends on libdb5.3. 94s apt-utils depends on libdb5.3. 94s 94s Removing libdb5.3:armhf (5.3.28+dfsg2-4) ... 94s Selecting previously unselected package libdb5.3t64:armhf. 95s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78100 files and directories currently installed.) 95s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-5build1_armhf.deb ... 95s Unpacking libdb5.3t64:armhf (5.3.28+dfsg2-5build1) ... 95s Preparing to unpack .../python3-gdbm_3.12.2-3ubuntu2_armhf.deb ... 95s Unpacking python3-gdbm:armhf (3.12.2-3ubuntu2) over (3.11.5-1) ... 95s Preparing to unpack .../man-db_2.12.0-3build4_armhf.deb ... 95s Unpacking man-db (2.12.0-3build4) over (2.12.0-3) ... 95s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78106 files and directories currently installed.) 95s Removing libgdbm-compat4:armhf (1.23-5) ... 95s Removing libgdbm6:armhf (1.23-5) ... 95s Selecting previously unselected package libgdbm6t64:armhf. 95s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78096 files and directories currently installed.) 95s Preparing to unpack .../libgdbm6t64_1.23-5.1_armhf.deb ... 95s Unpacking libgdbm6t64:armhf (1.23-5.1) ... 95s Selecting previously unselected package libgdbm-compat4t64:armhf. 95s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_armhf.deb ... 95s Unpacking libgdbm-compat4t64:armhf (1.23-5.1) ... 95s Selecting previously unselected package libperl5.38t64:armhf. 95s Preparing to unpack .../libperl5.38t64_5.38.2-3.2_armhf.deb ... 95s Unpacking libperl5.38t64:armhf (5.38.2-3.2) ... 96s Preparing to unpack .../perl_5.38.2-3.2_armhf.deb ... 96s Unpacking perl (5.38.2-3.2) over (5.38.2-3) ... 96s Preparing to unpack .../perl-base_5.38.2-3.2_armhf.deb ... 96s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 96s Setting up perl-base (5.38.2-3.2) ... 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78627 files and directories currently installed.) 96s Preparing to unpack .../liblocale-gettext-perl_1.07-6ubuntu3_armhf.deb ... 96s Unpacking liblocale-gettext-perl (1.07-6ubuntu3) over (1.07-6build1) ... 96s dpkg: libnettle8:armhf: dependency problems, but removing anyway as you requested: 96s libhogweed6:armhf depends on libnettle8. 96s libgnutls30:armhf depends on libnettle8 (>= 3.9~). 96s libcurl3-gnutls:armhf depends on libnettle8. 96s libarchive13:armhf depends on libnettle8. 96s 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78627 files and directories currently installed.) 96s Removing libnettle8:armhf (3.9.1-2) ... 96s Selecting previously unselected package libnettle8t64:armhf. 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78620 files and directories currently installed.) 96s Preparing to unpack .../libnettle8t64_3.9.1-2.2_armhf.deb ... 96s Unpacking libnettle8t64:armhf (3.9.1-2.2) ... 96s Setting up libnettle8t64:armhf (3.9.1-2.2) ... 96s dpkg: libhogweed6:armhf: dependency problems, but removing anyway as you requested: 96s libgnutls30:armhf depends on libhogweed6 (>= 3.6). 96s 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78628 files and directories currently installed.) 96s Removing libhogweed6:armhf (3.9.1-2) ... 96s Selecting previously unselected package libhogweed6t64:armhf. 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78623 files and directories currently installed.) 96s Preparing to unpack .../libhogweed6t64_3.9.1-2.2_armhf.deb ... 96s Unpacking libhogweed6t64:armhf (3.9.1-2.2) ... 97s Setting up libhogweed6t64:armhf (3.9.1-2.2) ... 97s dpkg: libgnutls30:armhf: dependency problems, but removing anyway as you requested: 97s libldap2:armhf depends on libgnutls30 (>= 3.8.2). 97s libcurl3-gnutls:armhf depends on libgnutls30 (>= 3.8.2). 97s fwupd depends on libgnutls30 (>= 3.7.3). 97s dirmngr depends on libgnutls30 (>= 3.8.1). 97s apt depends on libgnutls30 (>= 3.8.1). 97s 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78629 files and directories currently installed.) 97s Removing libgnutls30:armhf (3.8.3-1ubuntu1) ... 97s Selecting previously unselected package libgnutls30t64:armhf. 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78620 files and directories currently installed.) 97s Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu2_armhf.deb ... 97s Unpacking libgnutls30t64:armhf (3.8.3-1.1ubuntu2) ... 97s Setting up libgnutls30t64:armhf (3.8.3-1.1ubuntu2) ... 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78648 files and directories currently installed.) 97s Preparing to unpack .../libldap2_2.6.7+dfsg-1~exp1ubuntu6_armhf.deb ... 97s Unpacking libldap2:armhf (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 97s dpkg: libcurl3-gnutls:armhf: dependency problems, but removing anyway as you requested: 97s libfwupd2:armhf depends on libcurl3-gnutls (>= 7.63.0). 97s fwupd depends on libcurl3-gnutls (>= 7.63.0). 97s 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78648 files and directories currently installed.) 97s Removing libcurl3-gnutls:armhf (8.5.0-2ubuntu2) ... 97s Selecting previously unselected package libcurl3t64-gnutls:armhf. 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78641 files and directories currently installed.) 97s Preparing to unpack .../00-libcurl3t64-gnutls_8.5.0-2ubuntu7_armhf.deb ... 97s Unpacking libcurl3t64-gnutls:armhf (8.5.0-2ubuntu7) ... 97s Preparing to unpack .../01-shared-mime-info_2.4-1build1_armhf.deb ... 97s Unpacking shared-mime-info (2.4-1build1) over (2.4-1) ... 97s Preparing to unpack .../02-gir1.2-girepository-2.0_1.79.1-1ubuntu6_armhf.deb ... 97s Unpacking gir1.2-girepository-2.0:armhf (1.79.1-1ubuntu6) over (1.79.1-1) ... 97s Preparing to unpack .../03-gir1.2-glib-2.0_2.79.3-3ubuntu5_armhf.deb ... 97s Unpacking gir1.2-glib-2.0:armhf (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 97s Preparing to unpack .../04-libgirepository-1.0-1_1.79.1-1ubuntu6_armhf.deb ... 97s Unpacking libgirepository-1.0-1:armhf (1.79.1-1ubuntu6) over (1.79.1-1) ... 97s Preparing to unpack .../05-python3-gi_3.47.0-3build1_armhf.deb ... 97s Unpacking python3-gi (3.47.0-3build1) over (3.47.0-3) ... 98s Preparing to unpack .../06-python3-dbus_1.3.2-5build2_armhf.deb ... 98s Unpacking python3-dbus (1.3.2-5build2) over (1.3.2-5build1) ... 98s Selecting previously unselected package libnetplan1:armhf. 98s Preparing to unpack .../07-libnetplan1_1.0-1_armhf.deb ... 98s Unpacking libnetplan1:armhf (1.0-1) ... 98s Preparing to unpack .../08-python3-netplan_1.0-1_armhf.deb ... 98s Unpacking python3-netplan (1.0-1) over (0.107.1-3) ... 98s Preparing to unpack .../09-netplan-generator_1.0-1_armhf.deb ... 98s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 98s Unpacking netplan-generator (1.0-1) over (0.107.1-3) ... 98s Preparing to unpack .../10-initramfs-tools-bin_0.142ubuntu22_armhf.deb ... 98s Unpacking initramfs-tools-bin (0.142ubuntu22) over (0.142ubuntu20) ... 98s Preparing to unpack .../11-initramfs-tools-core_0.142ubuntu22_all.deb ... 98s Unpacking initramfs-tools-core (0.142ubuntu22) over (0.142ubuntu20) ... 98s Preparing to unpack .../12-initramfs-tools_0.142ubuntu22_all.deb ... 98s Unpacking initramfs-tools (0.142ubuntu22) over (0.142ubuntu20) ... 98s Preparing to unpack .../13-netplan.io_1.0-1_armhf.deb ... 98s Unpacking netplan.io (1.0-1) over (0.107.1-3) ... 98s Preparing to unpack .../14-libxmlb2_0.3.15-1build1_armhf.deb ... 98s Unpacking libxmlb2:armhf (0.3.15-1build1) over (0.3.15-1) ... 98s Preparing to unpack .../15-libqrtr-glib0_1.2.2-1ubuntu3_armhf.deb ... 98s Unpacking libqrtr-glib0:armhf (1.2.2-1ubuntu3) over (1.2.2-1ubuntu2) ... 98s Preparing to unpack .../16-libqmi-glib5_1.35.2-0ubuntu1_armhf.deb ... 98s Unpacking libqmi-glib5:armhf (1.35.2-0ubuntu1) over (1.34.0-2) ... 98s Preparing to unpack .../17-libqmi-proxy_1.35.2-0ubuntu1_armhf.deb ... 98s Unpacking libqmi-proxy (1.35.2-0ubuntu1) over (1.34.0-2) ... 98s Preparing to unpack .../18-libpolkit-agent-1-0_124-1ubuntu1_armhf.deb ... 98s Unpacking libpolkit-agent-1-0:armhf (124-1ubuntu1) over (124-1) ... 98s Preparing to unpack .../19-libpolkit-gobject-1-0_124-1ubuntu1_armhf.deb ... 98s Unpacking libpolkit-gobject-1-0:armhf (124-1ubuntu1) over (124-1) ... 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78652 files and directories currently installed.) 98s Removing libnetplan0:armhf (0.107.1-3) ... 98s dpkg: libglib2.0-0:armhf: dependency problems, but removing anyway as you requested: 98s libmm-glib0:armhf depends on libglib2.0-0 (>= 2.62.0). 98s libmbim-proxy depends on libglib2.0-0 (>= 2.56). 98s libmbim-glib4:armhf depends on libglib2.0-0 (>= 2.56). 98s libjson-glib-1.0-0:armhf depends on libglib2.0-0 (>= 2.75.3). 98s libgusb2:armhf depends on libglib2.0-0 (>= 2.75.3). 98s libgudev-1.0-0:armhf depends on libglib2.0-0 (>= 2.38.0). 98s libfwupd2:armhf depends on libglib2.0-0 (>= 2.79.0). 98s libblockdev3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-swap3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-part3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-nvme3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-mdraid3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-loop3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-fs3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s libblockdev-crypto3:armhf depends on libglib2.0-0 (>= 2.42.2). 98s fwupd depends on libglib2.0-0 (>= 2.79.0). 98s bolt depends on libglib2.0-0 (>= 2.56.0). 98s 98s Removing libglib2.0-0:armhf (2.79.2-1~ubuntu1) ... 98s Selecting previously unselected package libglib2.0-0t64:armhf. 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78623 files and directories currently installed.) 98s Preparing to unpack .../libglib2.0-0t64_2.79.3-3ubuntu5_armhf.deb ... 98s libglib2.0-0t64.preinst: Removing /var/lib/dpkg/info/libglib2.0-0:armhf.postrm to avoid loss of /usr/share/glib-2.0/schemas/gschemas.compiled... 98s removed '/var/lib/dpkg/info/libglib2.0-0:armhf.postrm' 98s Unpacking libglib2.0-0t64:armhf (2.79.3-3ubuntu5) ... 98s Preparing to unpack .../libfwupd2_1.9.15-1_armhf.deb ... 98s Unpacking libfwupd2:armhf (1.9.15-1) over (1.9.14-1) ... 99s dpkg: libarchive13:armhf: dependency problems, but removing anyway as you requested: 99s fwupd depends on libarchive13 (>= 3.2.1). 99s 99s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78648 files and directories currently installed.) 99s Removing libarchive13:armhf (3.7.2-1ubuntu2) ... 99s Selecting previously unselected package libarchive13t64:armhf. 99s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78642 files and directories currently installed.) 99s Preparing to unpack .../libarchive13t64_3.7.2-1.1ubuntu1_armhf.deb ... 99s Unpacking libarchive13t64:armhf (3.7.2-1.1ubuntu1) ... 99s Preparing to unpack .../fwupd_1.9.15-1_armhf.deb ... 99s Unpacking fwupd (1.9.15-1) over (1.9.14-1) ... 99s Preparing to unpack .../apt-utils_2.7.13ubuntu1_armhf.deb ... 99s Unpacking apt-utils (2.7.13ubuntu1) over (2.7.12) ... 99s dpkg: libapt-pkg6.0:armhf: dependency problems, but removing anyway as you requested: 99s ubuntu-pro-client depends on libapt-pkg6.0 (>= 1.9~). 99s python3-apt depends on libapt-pkg6.0 (>= 2.7.11). 99s apt depends on libapt-pkg6.0 (>= 2.7.12). 99s 99s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78649 files and directories currently installed.) 99s Removing libapt-pkg6.0:armhf (2.7.12) ... 99s Selecting previously unselected package libapt-pkg6.0t64:armhf. 99s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78600 files and directories currently installed.) 99s Preparing to unpack .../libapt-pkg6.0t64_2.7.13ubuntu1_armhf.deb ... 99s Unpacking libapt-pkg6.0t64:armhf (2.7.13ubuntu1) ... 99s Setting up libapt-pkg6.0t64:armhf (2.7.13ubuntu1) ... 99s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 99s Preparing to unpack .../apt_2.7.13ubuntu1_armhf.deb ... 99s Unpacking apt (2.7.13ubuntu1) over (2.7.12) ... 99s Setting up apt (2.7.13ubuntu1) ... 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 100s Preparing to unpack .../ubuntu-pro-client-l10n_31.2_armhf.deb ... 100s Unpacking ubuntu-pro-client-l10n (31.2) over (31.1) ... 100s Preparing to unpack .../ubuntu-pro-client_31.2_armhf.deb ... 100s Unpacking ubuntu-pro-client (31.2) over (31.1) ... 100s Preparing to unpack .../keyboxd_2.4.4-2ubuntu15_armhf.deb ... 100s Unpacking keyboxd (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 100s dpkg: libnpth0:armhf: dependency problems, but removing anyway as you requested: 100s gpgv depends on libnpth0 (>= 0.90). 100s gpgsm depends on libnpth0 (>= 0.90). 100s gpg-agent depends on libnpth0 (>= 0.90). 100s gpg depends on libnpth0 (>= 0.90). 100s dirmngr depends on libnpth0 (>= 0.90). 100s 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 100s Removing libnpth0:armhf (1.6-3build2) ... 100s Selecting previously unselected package libnpth0t64:armhf. 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78645 files and directories currently installed.) 100s Preparing to unpack .../libnpth0t64_1.6-3.1_armhf.deb ... 100s Unpacking libnpth0t64:armhf (1.6-3.1) ... 100s Setting up libnpth0t64:armhf (1.6-3.1) ... 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78651 files and directories currently installed.) 100s Preparing to unpack .../gpgv_2.4.4-2ubuntu15_armhf.deb ... 100s Unpacking gpgv (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 100s Setting up gpgv (2.4.4-2ubuntu15) ... 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78651 files and directories currently installed.) 100s Preparing to unpack .../gpg_2.4.4-2ubuntu15_armhf.deb ... 100s Unpacking gpg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../gpg-wks-client_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking gpg-wks-client (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../gnupg-utils_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking gnupg-utils (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../gpg-agent_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking gpg-agent (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../gpgsm_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking gpgsm (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s dpkg: libreadline8:armhf: dependency problems, but removing anyway as you requested: 101s gpgconf depends on libreadline8 (>= 6.0). 101s gawk depends on libreadline8 (>= 6.0). 101s fdisk depends on libreadline8 (>= 6.0). 101s 101s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78651 files and directories currently installed.) 101s Removing libreadline8:armhf (8.2-3) ... 101s Selecting previously unselected package libreadline8t64:armhf. 101s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78639 files and directories currently installed.) 101s Preparing to unpack .../libreadline8t64_8.2-3.1_armhf.deb ... 101s Adding 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8 to /lib/arm-linux-gnueabihf/libhistory.so.8.usr-is-merged by libreadline8t64' 101s Adding 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8.2 to /lib/arm-linux-gnueabihf/libhistory.so.8.2.usr-is-merged by libreadline8t64' 101s Adding 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8 to /lib/arm-linux-gnueabihf/libreadline.so.8.usr-is-merged by libreadline8t64' 101s Adding 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8.2 to /lib/arm-linux-gnueabihf/libreadline.so.8.2.usr-is-merged by libreadline8t64' 101s Unpacking libreadline8t64:armhf (8.2-3.1) ... 101s Setting up libreadline8t64:armhf (8.2-3.1) ... 101s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78659 files and directories currently installed.) 101s Preparing to unpack .../00-gawk_1%3a5.2.1-2build2_armhf.deb ... 101s Unpacking gawk (1:5.2.1-2build2) over (1:5.2.1-2) ... 101s Preparing to unpack .../01-fdisk_2.39.3-9ubuntu2_armhf.deb ... 101s Unpacking fdisk (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 101s Preparing to unpack .../02-gpgconf_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking gpgconf (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../03-dirmngr_2.4.4-2ubuntu15_armhf.deb ... 101s Unpacking dirmngr (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../04-gnupg_2.4.4-2ubuntu15_all.deb ... 101s Unpacking gnupg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 101s Preparing to unpack .../05-python3-apt_2.7.6build1_armhf.deb ... 101s Unpacking python3-apt (2.7.6build1) over (2.7.6) ... 101s Preparing to unpack .../06-pinentry-curses_1.2.1-3ubuntu4_armhf.deb ... 101s Unpacking pinentry-curses (1.2.1-3ubuntu4) over (1.2.1-3ubuntu1) ... 101s Preparing to unpack .../07-python3-yaml_6.0.1-2build1_armhf.deb ... 101s Unpacking python3-yaml (6.0.1-2build1) over (6.0.1-2) ... 101s Preparing to unpack .../08-python-apt-common_2.7.6build1_all.deb ... 101s Unpacking python-apt-common (2.7.6build1) over (2.7.6) ... 101s Preparing to unpack .../09-python3-setuptools_68.1.2-2ubuntu1_all.deb ... 101s Unpacking python3-setuptools (68.1.2-2ubuntu1) over (68.1.2-2) ... 102s Preparing to unpack .../10-python3-pkg-resources_68.1.2-2ubuntu1_all.deb ... 102s Unpacking python3-pkg-resources (68.1.2-2ubuntu1) over (68.1.2-2) ... 102s Preparing to unpack .../11-dpkg_1.22.6ubuntu4_armhf.deb ... 102s Unpacking dpkg (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 102s Setting up dpkg (1.22.6ubuntu4) ... 102s Setting up libpython3.12-minimal:armhf (3.12.2-4build3) ... 102s Setting up libexpat1:armhf (2.6.1-2) ... 102s Setting up python3.12-minimal (3.12.2-4build3) ... 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78656 files and directories currently installed.) 103s Preparing to unpack .../python3-minimal_3.12.2-0ubuntu1_armhf.deb ... 103s Unpacking python3-minimal (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 103s Setting up python3-minimal (3.12.2-0ubuntu1) ... 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78656 files and directories currently installed.) 103s Preparing to unpack .../python3_3.12.2-0ubuntu1_armhf.deb ... 103s Unpacking python3 (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 103s Preparing to unpack .../libpython3-stdlib_3.12.2-0ubuntu1_armhf.deb ... 103s Unpacking libpython3-stdlib:armhf (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 104s Preparing to unpack .../libsmartcols1_2.39.3-9ubuntu2_armhf.deb ... 104s Unpacking libsmartcols1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 104s Setting up libsmartcols1:armhf (2.39.3-9ubuntu2) ... 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78656 files and directories currently installed.) 104s Preparing to unpack .../0-bsdextrautils_2.39.3-9ubuntu2_armhf.deb ... 104s Unpacking bsdextrautils (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 104s Preparing to unpack .../1-groff-base_1.23.0-3build1_armhf.deb ... 104s Unpacking groff-base (1.23.0-3build1) over (1.23.0-3) ... 104s Preparing to unpack .../2-readline-common_8.2-3.1_all.deb ... 104s Unpacking readline-common (8.2-3.1) over (8.2-3) ... 104s Selecting previously unselected package libgpgme11t64:armhf. 104s Preparing to unpack .../3-libgpgme11t64_1.18.0-4.1ubuntu3_armhf.deb ... 104s Unpacking libgpgme11t64:armhf (1.18.0-4.1ubuntu3) ... 104s Preparing to unpack .../4-libblockdev-crypto3_3.1.0-1build1_armhf.deb ... 104s Unpacking libblockdev-crypto3:armhf (3.1.0-1build1) over (3.1.0-1) ... 104s Preparing to unpack .../5-e2fsprogs-l10n_1.47.0-2.4~exp1ubuntu2_all.deb ... 104s Unpacking e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 104s Preparing to unpack .../6-logsave_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 104s Unpacking logsave (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 104s Preparing to unpack .../7-dhcpcd-base_1%3a10.0.6-1ubuntu2_armhf.deb ... 104s Unpacking dhcpcd-base (1:10.0.6-1ubuntu2) over (1:10.0.6-1ubuntu1) ... 104s Preparing to unpack .../8-libblockdev-fs3_3.1.0-1build1_armhf.deb ... 104s Unpacking libblockdev-fs3:armhf (3.1.0-1build1) over (3.1.0-1) ... 104s dpkg: libreiserfscore0: dependency problems, but removing anyway as you requested: 104s btrfs-progs depends on libreiserfscore0 (>= 1:3.6.27). 104s 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78663 files and directories currently installed.) 104s Removing libreiserfscore0 (1:3.6.27-7) ... 104s Selecting previously unselected package libreiserfscore0t64. 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78658 files and directories currently installed.) 104s Preparing to unpack .../libreiserfscore0t64_1%3a3.6.27-7.1_armhf.deb ... 104s Unpacking libreiserfscore0t64 (1:3.6.27-7.1) ... 104s Preparing to unpack .../btrfs-progs_6.6.3-1.1build1_armhf.deb ... 104s Unpacking btrfs-progs (6.6.3-1.1build1) over (6.6.3-1.1) ... 104s dpkg: libext2fs2:armhf: dependency problems, but removing anyway as you requested: 104s e2fsprogs depends on libext2fs2 (= 1.47.0-2ubuntu1). 104s 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78664 files and directories currently installed.) 104s Removing libext2fs2:armhf (1.47.0-2ubuntu1) ... 104s Selecting previously unselected package libext2fs2t64:armhf. 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78657 files and directories currently installed.) 104s Preparing to unpack .../libext2fs2t64_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 104s Adding 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2 to /lib/arm-linux-gnueabihf/libe2p.so.2.usr-is-merged by libext2fs2t64' 104s Adding 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2.3 to /lib/arm-linux-gnueabihf/libe2p.so.2.3.usr-is-merged by libext2fs2t64' 104s Adding 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2 to /lib/arm-linux-gnueabihf/libext2fs.so.2.usr-is-merged by libext2fs2t64' 104s Adding 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2.4 to /lib/arm-linux-gnueabihf/libext2fs.so.2.4.usr-is-merged by libext2fs2t64' 104s Unpacking libext2fs2t64:armhf (1.47.0-2.4~exp1ubuntu2) ... 104s Setting up libcom-err2:armhf (1.47.0-2.4~exp1ubuntu2) ... 104s Setting up libext2fs2t64:armhf (1.47.0-2.4~exp1ubuntu2) ... 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 104s Preparing to unpack .../e2fsprogs_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 104s Unpacking e2fsprogs (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 104s Preparing to unpack .../libblockdev-loop3_3.1.0-1build1_armhf.deb ... 104s Unpacking libblockdev-loop3:armhf (3.1.0-1build1) over (3.1.0-1) ... 104s Preparing to unpack .../libblockdev-mdraid3_3.1.0-1build1_armhf.deb ... 104s Unpacking libblockdev-mdraid3:armhf (3.1.0-1build1) over (3.1.0-1) ... 104s Preparing to unpack .../libblockdev-nvme3_3.1.0-1build1_armhf.deb ... 104s Unpacking libblockdev-nvme3:armhf (3.1.0-1build1) over (3.1.0-1) ... 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 104s Removing libnvme1 (1.8-2) ... 104s Selecting previously unselected package libnvme1t64. 104s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78666 files and directories currently installed.) 105s Preparing to unpack .../0-libnvme1t64_1.8-3_armhf.deb ... 105s Unpacking libnvme1t64 (1.8-3) ... 105s Preparing to unpack .../1-libblockdev-part3_3.1.0-1build1_armhf.deb ... 105s Unpacking libblockdev-part3:armhf (3.1.0-1build1) over (3.1.0-1) ... 105s Preparing to unpack .../2-libblockdev-swap3_3.1.0-1build1_armhf.deb ... 105s Unpacking libblockdev-swap3:armhf (3.1.0-1build1) over (3.1.0-1) ... 105s Preparing to unpack .../3-libblockdev3_3.1.0-1build1_armhf.deb ... 105s Unpacking libblockdev3:armhf (3.1.0-1build1) over (3.1.0-1) ... 105s Preparing to unpack .../4-libgudev-1.0-0_1%3a238-3ubuntu2_armhf.deb ... 105s Unpacking libgudev-1.0-0:armhf (1:238-3ubuntu2) over (1:238-3) ... 105s Preparing to unpack .../5-libxml2_2.9.14+dfsg-1.3ubuntu2_armhf.deb ... 105s Unpacking libxml2:armhf (2.9.14+dfsg-1.3ubuntu2) over (2.9.14+dfsg-1.3ubuntu1) ... 105s Preparing to unpack .../6-libbpf1_1%3a1.3.0-2build1_armhf.deb ... 105s Unpacking libbpf1:armhf (1:1.3.0-2build1) over (1:1.3.0-2) ... 105s Preparing to unpack .../7-iproute2_6.1.0-1ubuntu5_armhf.deb ... 105s Unpacking iproute2 (6.1.0-1ubuntu5) over (6.1.0-1ubuntu2) ... 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78674 files and directories currently installed.) 105s Removing libelf1:armhf (0.190-1) ... 105s Selecting previously unselected package libelf1t64:armhf. 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78669 files and directories currently installed.) 105s Preparing to unpack .../libelf1t64_0.190-1.1build2_armhf.deb ... 105s Unpacking libelf1t64:armhf (0.190-1.1build2) ... 105s Preparing to unpack .../libtirpc-common_1.3.4+ds-1.1_all.deb ... 105s Unpacking libtirpc-common (1.3.4+ds-1.1) over (1.3.4+ds-1build1) ... 105s Preparing to unpack .../lsof_4.95.0-1build2_armhf.deb ... 105s Unpacking lsof (4.95.0-1build2) over (4.95.0-1build1) ... 105s Preparing to unpack .../libnsl2_1.3.0-3build2_armhf.deb ... 105s Unpacking libnsl2:armhf (1.3.0-3build2) over (1.3.0-3) ... 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78674 files and directories currently installed.) 105s Removing libtirpc3:armhf (1.3.4+ds-1build1) ... 105s Selecting previously unselected package libtirpc3t64:armhf. 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78668 files and directories currently installed.) 105s Preparing to unpack .../00-libtirpc3t64_1.3.4+ds-1.1_armhf.deb ... 105s Adding 'diversion of /lib/arm-linux-gnueabihf/libtirpc.so.3 to /lib/arm-linux-gnueabihf/libtirpc.so.3.usr-is-merged by libtirpc3t64' 105s Adding 'diversion of /lib/arm-linux-gnueabihf/libtirpc.so.3.0.0 to /lib/arm-linux-gnueabihf/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' 105s Unpacking libtirpc3t64:armhf (1.3.4+ds-1.1) ... 105s Preparing to unpack .../01-libmbim-proxy_1.31.2-0ubuntu2_armhf.deb ... 105s Unpacking libmbim-proxy (1.31.2-0ubuntu2) over (1.30.0-1) ... 105s Preparing to unpack .../02-libmbim-glib4_1.31.2-0ubuntu2_armhf.deb ... 105s Unpacking libmbim-glib4:armhf (1.31.2-0ubuntu2) over (1.30.0-1) ... 105s Preparing to unpack .../03-libjson-glib-1.0-common_1.8.0-2build1_all.deb ... 105s Unpacking libjson-glib-1.0-common (1.8.0-2build1) over (1.8.0-2) ... 105s Preparing to unpack .../04-libjson-glib-1.0-0_1.8.0-2build1_armhf.deb ... 105s Unpacking libjson-glib-1.0-0:armhf (1.8.0-2build1) over (1.8.0-2) ... 105s Preparing to unpack .../05-libnghttp2-14_1.59.0-1build1_armhf.deb ... 105s Unpacking libnghttp2-14:armhf (1.59.0-1build1) over (1.59.0-1) ... 105s Preparing to unpack .../06-libssh-4_0.10.6-2build1_armhf.deb ... 105s Unpacking libssh-4:armhf (0.10.6-2build1) over (0.10.6-2) ... 105s Preparing to unpack .../07-libusb-1.0-0_2%3a1.0.27-1_armhf.deb ... 105s Unpacking libusb-1.0-0:armhf (2:1.0.27-1) over (2:1.0.26-1) ... 105s Preparing to unpack .../08-libgusb2_0.4.8-1build1_armhf.deb ... 105s Unpacking libgusb2:armhf (0.4.8-1build1) over (0.4.8-1) ... 105s Preparing to unpack .../09-libmm-glib0_1.23.4-0ubuntu1_armhf.deb ... 105s Unpacking libmm-glib0:armhf (1.23.4-0ubuntu1) over (1.22.0-3) ... 106s Preparing to unpack .../10-libsasl2-2_2.1.28+dfsg1-4ubuntu4_armhf.deb ... 106s Unpacking libsasl2-2:armhf (2.1.28+dfsg1-4ubuntu4) over (2.1.28+dfsg1-4) ... 106s Preparing to unpack .../11-libibverbs1_50.0-2build1_armhf.deb ... 106s Unpacking libibverbs1:armhf (50.0-2build1) over (50.0-2) ... 106s Preparing to unpack .../12-libfido2-1_1.14.0-1build1_armhf.deb ... 106s Unpacking libfido2-1:armhf (1.14.0-1build1) over (1.14.0-1) ... 106s Preparing to unpack .../13-coreutils_9.4-3ubuntu3_armhf.deb ... 106s Unpacking coreutils (9.4-3ubuntu3) over (9.4-2ubuntu4) ... 106s Setting up coreutils (9.4-3ubuntu3) ... 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78679 files and directories currently installed.) 106s Preparing to unpack .../debianutils_5.17_armhf.deb ... 106s Unpacking debianutils (5.17) over (5.16) ... 106s Setting up debianutils (5.17) ... 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78679 files and directories currently installed.) 106s Preparing to unpack .../util-linux_2.39.3-9ubuntu2_armhf.deb ... 106s Unpacking util-linux (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 106s Setting up util-linux (2.39.3-9ubuntu2) ... 107s fstrim.service is a disabled or a static unit not running, not starting it. 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78679 files and directories currently installed.) 107s Preparing to unpack .../libc-bin_2.39-0ubuntu6_armhf.deb ... 107s Unpacking libc-bin (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 107s Setting up libc-bin (2.39-0ubuntu6) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78679 files and directories currently installed.) 107s Removing libatm1:armhf (1:2.5.1-5) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78674 files and directories currently installed.) 107s Preparing to unpack .../file_1%3a5.45-3_armhf.deb ... 107s Unpacking file (1:5.45-3) over (1:5.45-2) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78674 files and directories currently installed.) 107s Removing libmagic1:armhf (1:5.45-2) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78664 files and directories currently installed.) 107s Preparing to unpack .../libmagic-mgc_1%3a5.45-3_armhf.deb ... 107s Unpacking libmagic-mgc (1:5.45-3) over (1:5.45-2) ... 107s Selecting previously unselected package libmagic1t64:armhf. 107s Preparing to unpack .../libmagic1t64_1%3a5.45-3_armhf.deb ... 107s Unpacking libmagic1t64:armhf (1:5.45-3) ... 107s Preparing to unpack .../libplymouth5_24.004.60-1ubuntu5_armhf.deb ... 107s Unpacking libplymouth5:armhf (24.004.60-1ubuntu5) over (24.004.60-1ubuntu3) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78675 files and directories currently installed.) 108s Removing libpng16-16:armhf (1.6.43-1) ... 108s Selecting previously unselected package libpng16-16t64:armhf. 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78665 files and directories currently installed.) 108s Preparing to unpack .../libpng16-16t64_1.6.43-3_armhf.deb ... 108s Unpacking libpng16-16t64:armhf (1.6.43-3) ... 108s Preparing to unpack .../bind9-host_1%3a9.18.24-0ubuntu3_armhf.deb ... 108s Unpacking bind9-host (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 108s Preparing to unpack .../bind9-dnsutils_1%3a9.18.24-0ubuntu3_armhf.deb ... 108s Unpacking bind9-dnsutils (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 108s Preparing to unpack .../bind9-libs_1%3a9.18.24-0ubuntu3_armhf.deb ... 108s Unpacking bind9-libs:armhf (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78676 files and directories currently installed.) 108s Removing libuv1:armhf (1.48.0-1) ... 108s Selecting previously unselected package libuv1t64:armhf. 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78671 files and directories currently installed.) 108s Preparing to unpack .../libuv1t64_1.48.0-1.1_armhf.deb ... 108s Unpacking libuv1t64:armhf (1.48.0-1.1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78677 files and directories currently installed.) 108s Removing python3-distutils (3.11.5-1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 108s Preparing to unpack .../uuid-runtime_2.39.3-9ubuntu2_armhf.deb ... 108s Unpacking uuid-runtime (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 108s Preparing to unpack .../libdebconfclient0_0.271ubuntu2_armhf.deb ... 108s Unpacking libdebconfclient0:armhf (0.271ubuntu2) over (0.271ubuntu1) ... 108s Setting up libdebconfclient0:armhf (0.271ubuntu2) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 108s Preparing to unpack .../libsemanage-common_3.5-1build4_all.deb ... 108s Unpacking libsemanage-common (3.5-1build4) over (3.5-1build2) ... 108s Setting up libsemanage-common (3.5-1build4) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 108s Preparing to unpack .../libsemanage2_3.5-1build4_armhf.deb ... 108s Unpacking libsemanage2:armhf (3.5-1build4) over (3.5-1build2) ... 108s Setting up libsemanage2:armhf (3.5-1build4) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 108s Preparing to unpack .../install-info_7.1-3build1_armhf.deb ... 108s Unpacking install-info (7.1-3build1) over (7.1-3) ... 108s Setting up install-info (7.1-3build1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 108s Preparing to unpack .../00-gcc-13-base_13.2.0-19ubuntu1_armhf.deb ... 108s Unpacking gcc-13-base:armhf (13.2.0-19ubuntu1) over (13.2.0-17ubuntu2) ... 109s Preparing to unpack .../01-libss2_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 109s Unpacking libss2:armhf (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 109s Preparing to unpack .../02-dmsetup_2%3a1.02.185-3ubuntu2_armhf.deb ... 109s Unpacking dmsetup (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 109s Preparing to unpack .../03-eject_2.39.3-9ubuntu2_armhf.deb ... 109s Unpacking eject (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 109s Preparing to unpack .../04-krb5-locales_1.20.1-5.1build3_all.deb ... 109s Unpacking krb5-locales (1.20.1-5.1build3) over (1.20.1-5build1) ... 109s Preparing to unpack .../05-libbsd0_0.12.1-1_armhf.deb ... 109s Unpacking libbsd0:armhf (0.12.1-1) over (0.11.8-1) ... 109s Preparing to unpack .../06-libglib2.0-data_2.79.3-3ubuntu5_all.deb ... 109s Unpacking libglib2.0-data (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 109s Preparing to unpack .../07-libslang2_2.3.3-3build1_armhf.deb ... 109s Unpacking libslang2:armhf (2.3.3-3build1) over (2.3.3-3) ... 109s Preparing to unpack .../08-locales_2.39-0ubuntu6_all.deb ... 109s Unpacking locales (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 110s Preparing to unpack .../09-vim-tiny_2%3a9.1.0016-1ubuntu5_armhf.deb ... 110s Unpacking vim-tiny (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 110s Preparing to unpack .../10-vim-common_2%3a9.1.0016-1ubuntu5_all.deb ... 110s Unpacking vim-common (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 110s Selecting previously unselected package xdg-user-dirs. 110s Preparing to unpack .../11-xdg-user-dirs_0.18-1_armhf.deb ... 110s Unpacking xdg-user-dirs (0.18-1) ... 110s Preparing to unpack .../12-xxd_2%3a9.1.0016-1ubuntu5_armhf.deb ... 110s Unpacking xxd (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 110s Preparing to unpack .../13-apparmor_4.0.0-beta3-0ubuntu2_armhf.deb ... 111s Unpacking apparmor (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 111s Preparing to unpack .../14-ftp_20230507-2build1_all.deb ... 111s Unpacking ftp (20230507-2build1) over (20230507-2) ... 111s Preparing to unpack .../15-inetutils-telnet_2%3a2.5-3ubuntu3_armhf.deb ... 111s Unpacking inetutils-telnet (2:2.5-3ubuntu3) over (2:2.5-3ubuntu1) ... 111s Preparing to unpack .../16-info_7.1-3build1_armhf.deb ... 111s Unpacking info (7.1-3build1) over (7.1-3) ... 112s Preparing to unpack .../17-libxmuu1_2%3a1.1.3-3build1_armhf.deb ... 112s Unpacking libxmuu1:armhf (2:1.1.3-3build1) over (2:1.1.3-3) ... 112s Preparing to unpack .../18-lshw_02.19.git.2021.06.19.996aaad9c7-2build2_armhf.deb ... 112s Unpacking lshw (02.19.git.2021.06.19.996aaad9c7-2build2) over (02.19.git.2021.06.19.996aaad9c7-2build1) ... 112s Preparing to unpack .../19-mtr-tiny_0.95-1.1build1_armhf.deb ... 112s Unpacking mtr-tiny (0.95-1.1build1) over (0.95-1.1) ... 112s Preparing to unpack .../20-plymouth-theme-ubuntu-text_24.004.60-1ubuntu5_armhf.deb ... 112s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu5) over (24.004.60-1ubuntu3) ... 112s Preparing to unpack .../21-plymouth_24.004.60-1ubuntu5_armhf.deb ... 112s Unpacking plymouth (24.004.60-1ubuntu5) over (24.004.60-1ubuntu3) ... 112s Preparing to unpack .../22-psmisc_23.7-1_armhf.deb ... 112s Unpacking psmisc (23.7-1) over (23.6-2) ... 112s Preparing to unpack .../23-telnet_0.17+2.5-3ubuntu3_all.deb ... 112s Unpacking telnet (0.17+2.5-3ubuntu3) over (0.17+2.5-3ubuntu1) ... 112s Preparing to unpack .../24-usb.ids_2024.03.18-1_all.deb ... 112s Unpacking usb.ids (2024.03.18-1) over (2024.01.30-1) ... 112s Preparing to unpack .../25-xz-utils_5.6.0-0.2_armhf.deb ... 112s Unpacking xz-utils (5.6.0-0.2) over (5.4.5-0.3) ... 112s Preparing to unpack .../26-libctf0_2.42-4ubuntu1_armhf.deb ... 112s Unpacking libctf0:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../27-libctf-nobfd0_2.42-4ubuntu1_armhf.deb ... 112s Unpacking libctf-nobfd0:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../28-binutils-arm-linux-gnueabihf_2.42-4ubuntu1_armhf.deb ... 112s Unpacking binutils-arm-linux-gnueabihf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../29-libbinutils_2.42-4ubuntu1_armhf.deb ... 112s Unpacking libbinutils:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../30-binutils_2.42-4ubuntu1_armhf.deb ... 112s Unpacking binutils (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../31-binutils-common_2.42-4ubuntu1_armhf.deb ... 112s Unpacking binutils-common:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../32-libsframe1_2.42-4ubuntu1_armhf.deb ... 112s Unpacking libsframe1:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 112s Preparing to unpack .../33-bolt_0.9.6-2build1_armhf.deb ... 112s Unpacking bolt (0.9.6-2build1) over (0.9.6-2) ... 113s Preparing to unpack .../34-cryptsetup-bin_2%3a2.7.0-1ubuntu2_armhf.deb ... 113s Unpacking cryptsetup-bin (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 113s Preparing to unpack .../35-dpkg-dev_1.22.6ubuntu4_all.deb ... 113s Unpacking dpkg-dev (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 113s Preparing to unpack .../36-libdpkg-perl_1.22.6ubuntu4_all.deb ... 113s Unpacking libdpkg-perl (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 113s Preparing to unpack .../37-gnupg-l10n_2.4.4-2ubuntu15_all.deb ... 113s Unpacking gnupg-l10n (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 113s Preparing to unpack .../38-ibverbs-providers_50.0-2build1_armhf.deb ... 113s Unpacking ibverbs-providers:armhf (50.0-2build1) over (50.0-2) ... 113s Preparing to unpack .../39-jq_1.7.1-3_armhf.deb ... 113s Unpacking jq (1.7.1-3) over (1.7.1-2) ... 113s Preparing to unpack .../40-libjq1_1.7.1-3_armhf.deb ... 113s Unpacking libjq1:armhf (1.7.1-3) over (1.7.1-2) ... 113s Selecting previously unselected package libatm1t64:armhf. 113s Preparing to unpack .../41-libatm1t64_1%3a2.5.1-5.1_armhf.deb ... 113s Unpacking libatm1t64:armhf (1:2.5.1-5.1) ... 113s Preparing to unpack .../42-libevent-core-2.1-7_2.1.12-stable-9build1_armhf.deb ... 113s Unpacking libevent-core-2.1-7:armhf (2.1.12-stable-9build1) over (2.1.12-stable-9) ... 113s Preparing to unpack .../43-libftdi1-2_1.5-6build4_armhf.deb ... 113s Unpacking libftdi1-2:armhf (1.5-6build4) over (1.5-6build3) ... 113s Preparing to unpack .../44-libldap-common_2.6.7+dfsg-1~exp1ubuntu6_all.deb ... 113s Unpacking libldap-common (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 113s Preparing to unpack .../45-libsasl2-modules_2.1.28+dfsg1-4ubuntu4_armhf.deb ... 113s Unpacking libsasl2-modules:armhf (2.1.28+dfsg1-4ubuntu4) over (2.1.28+dfsg1-4) ... 113s Preparing to unpack .../46-python3-lib2to3_3.12.2-3ubuntu2_all.deb ... 113s Unpacking python3-lib2to3 (3.12.2-3ubuntu2) over (3.11.5-1) ... 114s Preparing to unpack .../47-python3-markupsafe_2.1.5-1build1_armhf.deb ... 114s Unpacking python3-markupsafe (2.1.5-1build1) over (2.1.5-1) ... 114s Preparing to unpack .../48-python3-pyrsistent_0.20.0-1build1_armhf.deb ... 114s Unpacking python3-pyrsistent:armhf (0.20.0-1build1) over (0.20.0-1) ... 114s Preparing to unpack .../49-python3-typing-extensions_4.10.0-1_all.deb ... 114s Unpacking python3-typing-extensions (4.10.0-1) over (4.9.0-1) ... 114s Preparing to unpack .../50-kpartx_0.9.4-5ubuntu5_armhf.deb ... 114s Unpacking kpartx (0.9.4-5ubuntu5) over (0.9.4-5ubuntu3) ... 114s Setting up pinentry-curses (1.2.1-3ubuntu4) ... 114s Setting up libtext-iconv-perl:armhf (1.7-8build2) ... 114s Setting up libtext-charwidth-perl:armhf (0.04-11build2) ... 114s Setting up libibverbs1:armhf (50.0-2build1) ... 114s Setting up systemd-sysv (255.4-1ubuntu5) ... 114s Setting up libapparmor1:armhf (4.0.0-beta3-0ubuntu2) ... 114s Setting up libatm1t64:armhf (1:2.5.1-5.1) ... 114s Setting up libgdbm6t64:armhf (1.23-5.1) ... 114s Setting up bsdextrautils (2.39.3-9ubuntu2) ... 114s Setting up libgdbm-compat4t64:armhf (1.23-5.1) ... 114s Setting up xdg-user-dirs (0.18-1) ... 114s Setting up ibverbs-providers:armhf (50.0-2build1) ... 114s Setting up linux-headers-6.8.0-20 (6.8.0-20.20) ... 114s Setting up libmagic-mgc (1:5.45-3) ... 114s Setting up gawk (1:5.2.1-2build2) ... 114s Setting up psmisc (23.7-1) ... 114s Setting up libjq1:armhf (1.7.1-3) ... 114s Setting up libtirpc-common (1.3.4+ds-1.1) ... 114s Setting up libbrotli1:armhf (1.1.0-2build1) ... 114s Setting up libsqlite3-0:armhf (3.45.1-1ubuntu1) ... 114s Setting up libsasl2-modules:armhf (2.1.28+dfsg1-4ubuntu4) ... 114s Setting up libuv1t64:armhf (1.48.0-1.1) ... 114s Setting up libmagic1t64:armhf (1:5.45-3) ... 114s Setting up binutils-common:armhf (2.42-4ubuntu1) ... 114s Setting up libpsl5t64:armhf (0.21.2-1.1) ... 114s Setting up libnghttp2-14:armhf (1.59.0-1build1) ... 114s Setting up libreiserfscore0t64 (1:3.6.27-7.1) ... 114s Setting up libctf-nobfd0:armhf (2.42-4ubuntu1) ... 114s Setting up libnss-systemd:armhf (255.4-1ubuntu5) ... 114s Setting up krb5-locales (1.20.1-5.1build3) ... 114s Setting up file (1:5.45-3) ... 114s Setting up kmod (31+20240202-2ubuntu4) ... 114s Setting up lshw (02.19.git.2021.06.19.996aaad9c7-2build2) ... 114s Setting up locales (2.39-0ubuntu6) ... 115s Generating locales (this might take a while)... 117s en_US.UTF-8... done 117s Generation complete. 117s Setting up libldap-common (2.6.7+dfsg-1~exp1ubuntu6) ... 117s Setting up xxd (2:9.1.0016-1ubuntu5) ... 117s Setting up libsframe1:armhf (2.42-4ubuntu1) ... 117s Setting up libelf1t64:armhf (0.190-1.1build2) ... 117s Setting up libkrb5support0:armhf (1.20.1-5.1build3) ... 117s Setting up linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 117s Setting up eject (2.39.3-9ubuntu2) ... 117s Setting up apparmor (4.0.0-beta3-0ubuntu2) ... 117s Installing new version of config file /etc/apparmor.d/abstractions/authentication ... 117s Installing new version of config file /etc/apparmor.d/abstractions/crypto ... 117s Installing new version of config file /etc/apparmor.d/abstractions/kde-open5 ... 117s Installing new version of config file /etc/apparmor.d/abstractions/openssl ... 117s Installing new version of config file /etc/apparmor.d/code ... 117s Installing new version of config file /etc/apparmor.d/firefox ... 117s apparmor_parser: Unable to replace "lsb_release". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 117s 117s apparmor_parser: Unable to replace "kmod". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 117s 117s apparmor_parser: Unable to replace "nvidia_modprobe". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 117s 118s sysctl: cannot stat /proc/sys/kernel/apparmor_restrict_unprivileged_userns: No such file or directory 118s Reloading AppArmor profiles 118s /sbin/apparmor_parser: Unable to replace "1password". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "Discord". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "MongoDB Compass". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "brave". /sbin/apparmor_parser: Unable to replace "busybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "buildah". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "cam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "ch-checkns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "ch-run". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "vscode". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "chrome". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "crun". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "devhelp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "element-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "epiphany". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "evolution". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "firefox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "flatpak". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "geary". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "github-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "goldendict". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "ipa_verify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "kchmviewer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "keybase". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lc-compliance". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "libcamerify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "loupe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "linux-sandbox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-attach". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-create". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-destroy". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-execute". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-unshare". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-stop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lxc-usernsexec". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "mmdebstrap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "msedge". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "nautilus". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "notepadqq". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "opam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "obsidian". /sbin/apparmor_parser: Unable to replace "opera". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "pageedit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "podman". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "polypane". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "privacybrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "qcam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "qutebrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "rootlesskit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "rpm". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "rssguard". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "runc". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "qmapshack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-abort". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild". /sbin/apparmor_parser: Unable to replace "sbuild-adduser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-apt". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-checkpackages". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-clean". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-destroychroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-distupgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-createchroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-hold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-shell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-unhold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-update". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "sbuild-upgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "scide". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "signal-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "slirp4netns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "slack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "plasmashell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "stress-ng". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "surfshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "systemd-coredump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "thunderbird". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "toybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "tup". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "tuxedo-control-center". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "trinity". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "userbindmount". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "unprivileged_userns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "steam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "uwsgi-core". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "vdens". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "virtiofsd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "vivaldi-bin". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "vpnns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "wpcom". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "lsb_release". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "kmod". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "nvidia_modprobe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "unix-chkpwd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "rsyslogd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "/usr/bin/man". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_apt_news". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s /sbin/apparmor_parser: Unable to replace "tcpdump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 118s 118s Error: At least one profile failed to load 118s Setting up libglib2.0-0t64:armhf (2.79.3-3ubuntu5) ... 118s No schema files found: doing nothing. 118s Setting up libglib2.0-data (2.79.3-3ubuntu5) ... 118s Setting up vim-common (2:9.1.0016-1ubuntu5) ... 118s Setting up gcc-13-base:armhf (13.2.0-19ubuntu1) ... 118s Setting up libqrtr-glib0:armhf (1.2.2-1ubuntu3) ... 118s Setting up libslang2:armhf (2.3.3-3build1) ... 118s Setting up libnvme1t64 (1.8-3) ... 118s Setting up mtr-tiny (0.95-1.1build1) ... 118s Setting up gnupg-l10n (2.4.4-2ubuntu15) ... 118s Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2build6) ... 118s Setting up libdbus-1-3:armhf (1.14.10-4ubuntu2) ... 118s Setting up xz-utils (5.6.0-0.2) ... 118s Setting up perl-modules-5.38 (5.38.2-3.2) ... 118s Setting up libblockdev-utils3:armhf (3.1.0-1build1) ... 118s Setting up libpng16-16t64:armhf (1.6.43-3) ... 118s Setting up systemd-timesyncd (255.4-1ubuntu5) ... 119s Setting up libevent-core-2.1-7:armhf (2.1.12-stable-9build1) ... 119s Setting up udev (255.4-1ubuntu5) ... 119s Setting up libss2:armhf (1.47.0-2.4~exp1ubuntu2) ... 119s Setting up usb.ids (2024.03.18-1) ... 119s Setting up sudo (1.9.15p5-3ubuntu3) ... 119s Setting up dhcpcd-base (1:10.0.6-1ubuntu2) ... 119s Setting up gir1.2-glib-2.0:armhf (2.79.3-3ubuntu5) ... 119s Setting up libk5crypto3:armhf (1.20.1-5.1build3) ... 119s Setting up logsave (1.47.0-2.4~exp1ubuntu2) ... 119s Setting up libfdisk1:armhf (2.39.3-9ubuntu2) ... 119s Setting up libdb5.3t64:armhf (5.3.28+dfsg2-5build1) ... 119s Setting up libblockdev-nvme3:armhf (3.1.0-1build1) ... 119s Setting up libdevmapper1.02.1:armhf (2:1.02.185-3ubuntu2) ... 119s Setting up libblockdev-fs3:armhf (3.1.0-1build1) ... 119s Setting up python-apt-common (2.7.6build1) ... 119s Setting up mount (2.39.3-9ubuntu2) ... 119s Setting up dmsetup (2:1.02.185-3ubuntu2) ... 119s Setting up uuid-runtime (2.39.3-9ubuntu2) ... 120s uuidd.service is a disabled or a static unit not running, not starting it. 120s Setting up libmm-glib0:armhf (1.23.4-0ubuntu1) ... 120s Setting up groff-base (1.23.0-3build1) ... 120s Setting up libplymouth5:armhf (24.004.60-1ubuntu5) ... 120s Setting up dbus-session-bus-common (1.14.10-4ubuntu2) ... 120s Setting up kpartx (0.9.4-5ubuntu5) ... 120s Setting up jq (1.7.1-3) ... 120s Setting up gpgconf (2.4.4-2ubuntu15) ... 120s Setting up libpcap0.8t64:armhf (1.10.4-4.1ubuntu1) ... 120s Setting up libcryptsetup12:armhf (2:2.7.0-1ubuntu2) ... 120s Setting up libgirepository-1.0-1:armhf (1.79.1-1ubuntu6) ... 120s Setting up libjson-glib-1.0-common (1.8.0-2build1) ... 120s Setting up libkrb5-3:armhf (1.20.1-5.1build3) ... 120s Setting up libpython3.11-minimal:armhf (3.11.8-1build4) ... 120s Setting up libusb-1.0-0:armhf (2:1.0.27-1) ... 120s Setting up libperl5.38t64:armhf (5.38.2-3.2) ... 120s Setting up tnftp (20230507-2build1) ... 120s Setting up libbinutils:armhf (2.42-4ubuntu1) ... 120s Setting up dbus-system-bus-common (1.14.10-4ubuntu2) ... 120s Setting up libfido2-1:armhf (1.14.0-1build1) ... 120s Setting up openssl (3.0.13-0ubuntu2) ... 120s Setting up libbsd0:armhf (0.12.1-1) ... 120s Setting up readline-common (8.2-3.1) ... 120s Setting up libxml2:armhf (2.9.14+dfsg-1.3ubuntu2) ... 120s Setting up libxmuu1:armhf (2:1.1.3-3build1) ... 120s Setting up dbus-bin (1.14.10-4ubuntu2) ... 120s Setting up info (7.1-3build1) ... 120s Setting up liblocale-gettext-perl (1.07-6ubuntu3) ... 120s Setting up gpg (2.4.4-2ubuntu15) ... 120s Setting up libgudev-1.0-0:armhf (1:238-3ubuntu2) ... 120s Setting up libpolkit-gobject-1-0:armhf (124-1ubuntu1) ... 120s Setting up libbpf1:armhf (1:1.3.0-2build1) ... 120s Setting up libmbim-glib4:armhf (1.31.2-0ubuntu2) ... 120s Setting up rsync (3.2.7-1build1) ... 121s rsync.service is a disabled or a static unit not running, not starting it. 121s Setting up libudisks2-0:armhf (2.10.1-6) ... 121s Setting up bolt (0.9.6-2build1) ... 121s bolt.service is a disabled or a static unit not running, not starting it. 121s Setting up gnupg-utils (2.4.4-2ubuntu15) ... 121s Setting up initramfs-tools-bin (0.142ubuntu22) ... 121s Setting up libctf0:armhf (2.42-4ubuntu1) ... 121s Setting up cryptsetup-bin (2:2.7.0-1ubuntu2) ... 121s Setting up python3.11-minimal (3.11.8-1build4) ... 123s Setting up tcpdump (4.99.4-3ubuntu2) ... 123s apparmor_parser: Unable to replace "tcpdump". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 123s 123s Setting up apt-utils (2.7.13ubuntu1) ... 123s Setting up gpg-agent (2.4.4-2ubuntu15) ... 123s Setting up libpython3.12-stdlib:armhf (3.12.2-4build3) ... 123s Setting up libblockdev-mdraid3:armhf (3.1.0-1build1) ... 123s Setting up wget (1.21.4-1ubuntu2) ... 123s Setting up libblockdev-swap3:armhf (3.1.0-1build1) ... 123s Setting up plymouth (24.004.60-1ubuntu5) ... 123s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 124s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 124s Setting up libxmlb2:armhf (0.3.15-1build1) ... 124s Setting up btrfs-progs (6.6.3-1.1build1) ... 124s Setting up libpython3.11-stdlib:armhf (3.11.8-1build4) ... 124s Setting up python3.12 (3.12.2-4build3) ... 125s Setting up libblockdev-loop3:armhf (3.1.0-1build1) ... 125s Setting up gpgsm (2.4.4-2ubuntu15) ... 125s Setting up inetutils-telnet (2:2.5-3ubuntu3) ... 125s Setting up e2fsprogs (1.47.0-2.4~exp1ubuntu2) ... 125s update-initramfs: deferring update (trigger activated) 126s e2scrub_all.service is a disabled or a static unit not running, not starting it. 126s Setting up libparted2t64:armhf (3.6-3.1build2) ... 126s Setting up linux-headers-generic (6.8.0-20.20+1) ... 126s Setting up dbus-daemon (1.14.10-4ubuntu2) ... 126s Setting up libmbim-proxy (1.31.2-0ubuntu2) ... 126s Setting up vim-tiny (2:9.1.0016-1ubuntu5) ... 126s Setting up libnetplan1:armhf (1.0-1) ... 126s Setting up man-db (2.12.0-3build4) ... 126s Updating database of manual pages ... 127s apparmor_parser: Unable to replace "/usr/bin/man". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 127s 129s man-db.service is a disabled or a static unit not running, not starting it. 129s Setting up libblockdev3:armhf (3.1.0-1build1) ... 129s Setting up fdisk (2.39.3-9ubuntu2) ... 129s Setting up libjson-glib-1.0-0:armhf (1.8.0-2build1) ... 129s Setting up libblockdev-part3:armhf (3.1.0-1build1) ... 129s Setting up libsasl2-modules-db:armhf (2.1.28+dfsg1-4ubuntu4) ... 129s Setting up libftdi1-2:armhf (1.5-6build4) ... 129s Setting up perl (5.38.2-3.2) ... 129s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu5) ... 129s update-initramfs: deferring update (trigger activated) 129s Setting up gir1.2-girepository-2.0:armhf (1.79.1-1ubuntu6) ... 129s Setting up dbus (1.14.10-4ubuntu2) ... 129s A reboot is required to replace the running dbus-daemon. 129s Please reboot the system when convenient. 129s Setting up shared-mime-info (2.4-1build1) ... 129s Setting up libgssapi-krb5-2:armhf (1.20.1-5.1build3) ... 129s Setting up ftp (20230507-2build1) ... 129s Setting up keyboxd (2.4.4-2ubuntu15) ... 129s Setting up libdpkg-perl (1.22.6ubuntu4) ... 129s Setting up libsasl2-2:armhf (2.1.28+dfsg1-4ubuntu4) ... 129s Setting up libssh-4:armhf (0.10.6-2build1) ... 129s Setting up libpam-systemd:armhf (255.4-1ubuntu5) ... 129s Setting up libpolkit-agent-1-0:armhf (124-1ubuntu1) ... 129s Setting up libgpgme11t64:armhf (1.18.0-4.1ubuntu3) ... 129s Setting up netplan-generator (1.0-1) ... 129s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 129s Setting up initramfs-tools-core (0.142ubuntu22) ... 129s Setting up binutils-arm-linux-gnueabihf (2.42-4ubuntu1) ... 129s Setting up libarchive13t64:armhf (3.7.2-1.1ubuntu1) ... 129s Setting up libldap2:armhf (2.6.7+dfsg-1~exp1ubuntu6) ... 129s Setting up libpython3-stdlib:armhf (3.12.2-0ubuntu1) ... 129s Setting up systemd-resolved (255.4-1ubuntu5) ... 130s Setting up python3.11 (3.11.8-1build4) ... 131s Setting up telnet (0.17+2.5-3ubuntu3) ... 131s Setting up initramfs-tools (0.142ubuntu22) ... 131s update-initramfs: deferring update (trigger activated) 131s Setting up libcurl4t64:armhf (8.5.0-2ubuntu7) ... 131s Setting up bind9-libs:armhf (1:9.18.24-0ubuntu3) ... 131s Setting up libtirpc3t64:armhf (1.3.4+ds-1.1) ... 131s Setting up e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) ... 131s Setting up iproute2 (6.1.0-1ubuntu5) ... 131s Setting up openssh-client (1:9.6p1-3ubuntu11) ... 131s Setting up libgusb2:armhf (0.4.8-1build1) ... 131s Setting up libcurl3t64-gnutls:armhf (8.5.0-2ubuntu7) ... 131s Setting up parted (3.6-3.1build2) ... 131s Setting up libqmi-glib5:armhf (1.35.2-0ubuntu1) ... 131s Setting up python3 (3.12.2-0ubuntu1) ... 131s Setting up binutils (2.42-4ubuntu1) ... 131s Setting up python3-markupsafe (2.1.5-1build1) ... 131s Setting up libjcat1:armhf (0.2.0-2build2) ... 131s Setting up dpkg-dev (1.22.6ubuntu4) ... 131s Setting up dirmngr (2.4.4-2ubuntu15) ... 131s Setting up dbus-user-session (1.14.10-4ubuntu2) ... 131s Setting up python3-cryptography (41.0.7-4build2) ... 132s Setting up python3-gi (3.47.0-3build1) ... 132s Setting up python3-typing-extensions (4.10.0-1) ... 132s Setting up lsof (4.95.0-1build2) ... 132s Setting up python3-pyrsistent:armhf (0.20.0-1build1) ... 132s Setting up libnsl2:armhf (1.3.0-3build2) ... 132s Setting up gnupg (2.4.4-2ubuntu15) ... 132s Setting up python3-netplan (1.0-1) ... 132s Setting up curl (8.5.0-2ubuntu7) ... 132s Setting up libvolume-key1:armhf (0.3.12-7build1) ... 132s Setting up bind9-host (1:9.18.24-0ubuntu3) ... 132s Setting up python3-lib2to3 (3.12.2-3ubuntu2) ... 132s Setting up python3-pkg-resources (68.1.2-2ubuntu1) ... 133s Setting up openssh-sftp-server (1:9.6p1-3ubuntu11) ... 133s Setting up python3-dbus (1.3.2-5build2) ... 133s Setting up python3-setuptools (68.1.2-2ubuntu1) ... 133s Setting up gpg-wks-client (2.4.4-2ubuntu15) ... 133s Setting up openssh-server (1:9.6p1-3ubuntu11) ... 133s Replacing config file /etc/ssh/sshd_config with new version 135s Created symlink /etc/systemd/system/ssh.service.requires/ssh.socket → /usr/lib/systemd/system/ssh.socket. 136s Setting up libblockdev-crypto3:armhf (3.1.0-1build1) ... 136s Setting up python3-gdbm:armhf (3.12.2-3ubuntu2) ... 136s Setting up python3-apt (2.7.6build1) ... 136s Setting up libfwupd2:armhf (1.9.15-1) ... 136s Setting up python3-yaml (6.0.1-2build1) ... 136s Setting up libqmi-proxy (1.35.2-0ubuntu1) ... 136s Setting up netplan.io (1.0-1) ... 136s Setting up bind9-dnsutils (1:9.18.24-0ubuntu3) ... 136s Setting up ubuntu-pro-client (31.2) ... 136s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 136s 137s Setting up fwupd (1.9.15-1) ... 138s fwupd-offline-update.service is a disabled or a static unit not running, not starting it. 138s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 138s fwupd.service is a disabled or a static unit not running, not starting it. 138s Setting up ubuntu-pro-client-l10n (31.2) ... 138s Setting up udisks2 (2.10.1-6) ... 138s vda: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/uevent': Permission denied 138s vda1: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda1/uevent': Permission denied 138s vda15: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda15/uevent': Permission denied 138s vda2: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda2/uevent': Permission denied 138s loop0: Failed to write 'change' to '/sys/devices/virtual/block/loop0/uevent': Permission denied 138s loop1: Failed to write 'change' to '/sys/devices/virtual/block/loop1/uevent': Permission denied 138s loop2: Failed to write 'change' to '/sys/devices/virtual/block/loop2/uevent': Permission denied 138s loop3: Failed to write 'change' to '/sys/devices/virtual/block/loop3/uevent': Permission denied 138s loop4: Failed to write 'change' to '/sys/devices/virtual/block/loop4/uevent': Permission denied 138s loop5: Failed to write 'change' to '/sys/devices/virtual/block/loop5/uevent': Permission denied 138s loop6: Failed to write 'change' to '/sys/devices/virtual/block/loop6/uevent': Permission denied 138s loop7: Failed to write 'change' to '/sys/devices/virtual/block/loop7/uevent': Permission denied 138s Processing triggers for ufw (0.36.2-5) ... 138s Processing triggers for systemd (255.4-1ubuntu5) ... 138s Processing triggers for install-info (7.1-3build1) ... 138s Processing triggers for libc-bin (2.39-0ubuntu6) ... 138s Processing triggers for initramfs-tools (0.142ubuntu22) ... 140s Reading package lists... 140s Building dependency tree... 140s Reading state information... 141s The following packages will be REMOVED: 141s linux-headers-6.8.0-11* python3-lib2to3* 141s 0 upgraded, 0 newly installed, 2 to remove and 1 not upgraded. 141s After this operation, 85.8 MB disk space will be freed. 141s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78591 files and directories currently installed.) 141s Removing linux-headers-6.8.0-11 (6.8.0-11.11) ... 142s Removing python3-lib2to3 (3.12.2-3ubuntu2) ... 144s autopkgtest [00:16:06]: rebooting testbed after setup commands that affected boot 181s autopkgtest [00:16:43]: testbed running kernel: Linux 5.15.0-101-generic #111-Ubuntu SMP Wed Mar 6 18:01:01 UTC 2024 206s autopkgtest [00:17:08]: @@@@@@@@@@@@@@@@@@@@ apt-source presto 219s Get:1 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (dsc) [2233 B] 219s Get:2 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (tar) [362 kB] 219s Get:3 http://ftpmaster.internal/ubuntu noble/universe presto 0.7.2-1 (diff) [20.8 kB] 219s gpgv: Signature made Mon Feb 19 12:51:18 2024 UTC 219s gpgv: using RSA key 4A31DB5A1EE4096C87399880903649294C33F9B7 219s gpgv: Can't check signature: No public key 219s dpkg-source: warning: cannot verify inline signature for ./presto_0.7.2-1.dsc: no acceptable signature found 219s autopkgtest [00:17:21]: testing package presto version 0.7.2-1 221s autopkgtest [00:17:23]: build not needed 223s autopkgtest [00:17:25]: test pybuild-autopkgtest: preparing testbed 232s Reading package lists... 232s Building dependency tree... 232s Reading state information... 233s Starting pkgProblemResolver with broken count: 0 233s Starting 2 pkgProblemResolver with broken count: 0 233s Done 234s The following additional packages will be installed: 234s autoconf automake autopoint autotools-dev build-essential cd-hit cpp cpp-13 234s cpp-13-arm-linux-gnueabihf cpp-arm-linux-gnueabihf debhelper debugedit 234s dh-autoreconf dh-python dh-strip-nondeterminism dwz fontconfig-config 234s fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ g++-13 234s g++-13-arm-linux-gnueabihf g++-arm-linux-gnueabihf gcc gcc-13 234s gcc-13-arm-linux-gnueabihf gcc-arm-linux-gnueabihf gettext intltool-debian 234s libarchive-zip-perl libasan8 libatomic1 libblas3 libc-dev-bin libc6-dev 234s libcairo2 libcc1-0 libcrypt-dev libdebhelper-perl libdeflate0 libdw1t64 234s libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 libfreetype6 234s libgcc-13-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b 234s libimagequant0 libisl23 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 234s liblbfgsb0 liblcms2-2 liblerc4 libmbedcrypto7t64 libmbedtls14t64 234s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libraqm0 libsharpyuv0 234s libstdc++-13-dev libsub-override-perl libtiff6 libtool libubsan1 libwebp7 234s libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 234s linux-libc-dev m4 ncbi-blast+ ncbi-data po-debconf presto 234s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 234s python3-dateutil python3-decorator python3-freetype python3-numpy 234s python3-packaging python3-pandas python3-pandas-lib python3-pil 234s python3-presto python3-reportlab python3-rlpycairo python3-scipy 234s rpcsvc-proto sgml-base w3c-sgml-lib x11-common xfonts-encodings xfonts-utils 234s xml-core 234s Suggested packages: 234s autoconf-archive gnu-standards autoconf-doc cpp-doc gcc-13-locales 234s cpp-13-doc dh-make flit python3-build python3-installer python3-wheel 234s fonts-freefont-otf | fonts-freefont-ttf fonts-texgyre gcc-13-doc 234s gcc-multilib manpages-dev flex bison gdb gcc-doc gdb-arm-linux-gnueabihf 234s gettext-doc libasprintf-dev libgettextpo-dev glibc-doc liblcms2-utils 234s libstdc++-13-doc libtool-doc gfortran | fortran95-compiler gcj-jdk m4-doc 234s libmail-box-perl python3-tk bwa clustalo clustalw dialign dssp emboss 234s fasttree mafft muscle3 phylip phyml prank probcons python3-mysqldb 234s python3-matplotlib python3-mmtf python3-rdflib python3-psycopg2 raxml 234s samtools t-coffee wise gfortran python3-dev python3-pytest python-pandas-doc 234s python3-statsmodels python-pil-doc pdf-viewer python3-egenix-mxtexttools 234s python-reportlab-doc rl-accel rl-renderpm python-scipy-doc sgml-base-doc 234s Recommended packages: 234s manpages manpages-dev libc-devtools libarchive-cpio-perl libltdl-dev 234s libmail-sendmail-perl python-biopython-doc python3-matplotlib 234s python3-bottleneck python3-numexpr python3-odf python3-openpyxl python3-bs4 234s python3-html5lib python3-lxml python3-tables python3-olefile 234s fonts-dejavu-extra 234s The following NEW packages will be installed: 234s autoconf automake autopkgtest-satdep autopoint autotools-dev build-essential 234s cd-hit cpp cpp-13 cpp-13-arm-linux-gnueabihf cpp-arm-linux-gnueabihf 234s debhelper debugedit dh-autoreconf dh-python dh-strip-nondeterminism dwz 234s fontconfig-config fonts-dejavu-core fonts-dejavu-mono fonts-urw-base35 g++ 234s g++-13 g++-13-arm-linux-gnueabihf g++-arm-linux-gnueabihf gcc gcc-13 234s gcc-13-arm-linux-gnueabihf gcc-arm-linux-gnueabihf gettext intltool-debian 234s libarchive-zip-perl libasan8 libatomic1 libblas3 libc-dev-bin libc6-dev 234s libcairo2 libcc1-0 libcrypt-dev libdebhelper-perl libdeflate0 libdw1t64 234s libfile-stripnondeterminism-perl libfontconfig1 libfontenc1 libfreetype6 234s libgcc-13-dev libgfortran5 libgomp1 libgraphite2-3 libharfbuzz0b 234s libimagequant0 libisl23 libjbig0 libjpeg-turbo8 libjpeg8 liblapack3 234s liblbfgsb0 liblcms2-2 liblerc4 libmbedcrypto7t64 libmbedtls14t64 234s libmbedx509-1t64 libmpc3 libopenjp2-7 libpixman-1-0 libraqm0 libsharpyuv0 234s libstdc++-13-dev libsub-override-perl libtiff6 libtool libubsan1 libwebp7 234s libwebpdemux2 libwebpmux3 libxcb-render0 libxcb-shm0 libxrender1 234s linux-libc-dev m4 ncbi-blast+ ncbi-data po-debconf presto 234s pybuild-plugin-autopkgtest python3-all python3-biopython python3-cairo 234s python3-dateutil python3-decorator python3-freetype python3-numpy 234s python3-packaging python3-pandas python3-pandas-lib python3-pil 234s python3-presto python3-reportlab python3-rlpycairo python3-scipy 234s rpcsvc-proto sgml-base w3c-sgml-lib x11-common xfonts-encodings xfonts-utils 234s xml-core 234s 0 upgraded, 109 newly installed, 0 to remove and 1 not upgraded. 234s Need to get 125 MB/125 MB of archives. 234s After this operation, 412 MB of additional disk space will be used. 234s Get:1 /tmp/autopkgtest.CovVsU/1-autopkgtest-satdep.deb autopkgtest-satdep armhf 0 [816 B] 234s Get:2 http://ftpmaster.internal/ubuntu noble/main armhf sgml-base all 1.31 [11.4 kB] 234s Get:3 http://ftpmaster.internal/ubuntu noble/main armhf m4 armhf 1.4.19-4 [235 kB] 234s Get:4 http://ftpmaster.internal/ubuntu noble/main armhf autoconf all 2.71-3 [339 kB] 234s Get:5 http://ftpmaster.internal/ubuntu noble/main armhf autotools-dev all 20220109.1 [44.9 kB] 234s Get:6 http://ftpmaster.internal/ubuntu noble/main armhf automake all 1:1.16.5-1.3ubuntu1 [558 kB] 234s Get:7 http://ftpmaster.internal/ubuntu noble/main armhf autopoint all 0.21-14ubuntu1 [422 kB] 234s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc-dev-bin armhf 2.39-0ubuntu6 [19.1 kB] 234s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-libc-dev armhf 6.8.0-20.20 [1555 kB] 234s Get:10 http://ftpmaster.internal/ubuntu noble/main armhf libcrypt-dev armhf 1:4.4.36-4 [136 kB] 234s Get:11 http://ftpmaster.internal/ubuntu noble/main armhf rpcsvc-proto armhf 1.4.2-0ubuntu6 [63.7 kB] 234s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc6-dev armhf 2.39-0ubuntu6 [1351 kB] 234s Get:13 http://ftpmaster.internal/ubuntu noble/main armhf libisl23 armhf 0.26-3 [595 kB] 234s Get:14 http://ftpmaster.internal/ubuntu noble/main armhf libmpc3 armhf 1.3.1-1 [46.4 kB] 234s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main armhf cpp-13-arm-linux-gnueabihf armhf 13.2.0-19ubuntu1 [8753 kB] 235s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main armhf cpp-13 armhf 13.2.0-19ubuntu1 [1036 B] 235s Get:17 http://ftpmaster.internal/ubuntu noble/main armhf cpp-arm-linux-gnueabihf armhf 4:13.2.0-7ubuntu1 [5320 B] 235s Get:18 http://ftpmaster.internal/ubuntu noble/main armhf cpp armhf 4:13.2.0-7ubuntu1 [22.4 kB] 235s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcc1-0 armhf 14-20240315-1ubuntu1 [39.0 kB] 235s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgomp1 armhf 14-20240315-1ubuntu1 [125 kB] 235s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libatomic1 armhf 14-20240315-1ubuntu1 [7824 B] 235s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libasan8 armhf 14-20240315-1ubuntu1 [2941 kB] 235s Get:23 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libubsan1 armhf 14-20240315-1ubuntu1 [1152 kB] 235s Get:24 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgcc-13-dev armhf 13.2.0-19ubuntu1 [900 kB] 235s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-13-arm-linux-gnueabihf armhf 13.2.0-19ubuntu1 [16.8 MB] 235s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-13 armhf 13.2.0-19ubuntu1 [448 kB] 235s Get:27 http://ftpmaster.internal/ubuntu noble/main armhf gcc-arm-linux-gnueabihf armhf 4:13.2.0-7ubuntu1 [1220 B] 235s Get:28 http://ftpmaster.internal/ubuntu noble/main armhf gcc armhf 4:13.2.0-7ubuntu1 [5022 B] 235s Get:29 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libstdc++-13-dev armhf 13.2.0-19ubuntu1 [2403 kB] 235s Get:30 http://ftpmaster.internal/ubuntu noble-proposed/main armhf g++-13-arm-linux-gnueabihf armhf 13.2.0-19ubuntu1 [9935 kB] 236s Get:31 http://ftpmaster.internal/ubuntu noble-proposed/main armhf g++-13 armhf 13.2.0-19ubuntu1 [14.5 kB] 236s Get:32 http://ftpmaster.internal/ubuntu noble/main armhf g++-arm-linux-gnueabihf armhf 4:13.2.0-7ubuntu1 [966 B] 236s Get:33 http://ftpmaster.internal/ubuntu noble/main armhf g++ armhf 4:13.2.0-7ubuntu1 [1090 B] 236s Get:34 http://ftpmaster.internal/ubuntu noble/main armhf build-essential armhf 12.10ubuntu1 [4928 B] 236s Get:35 http://ftpmaster.internal/ubuntu noble/universe armhf cd-hit armhf 4.8.1-4 [512 kB] 236s Get:36 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdebhelper-perl all 13.14.1ubuntu5 [89.8 kB] 236s Get:37 http://ftpmaster.internal/ubuntu noble/main armhf libtool all 2.4.7-7 [166 kB] 236s Get:38 http://ftpmaster.internal/ubuntu noble/main armhf dh-autoreconf all 20 [16.1 kB] 236s Get:39 http://ftpmaster.internal/ubuntu noble/main armhf libarchive-zip-perl all 1.68-1 [90.2 kB] 236s Get:40 http://ftpmaster.internal/ubuntu noble/main armhf libsub-override-perl all 0.10-1 [10.0 kB] 236s Get:41 http://ftpmaster.internal/ubuntu noble/main armhf libfile-stripnondeterminism-perl all 1.13.1-1 [18.1 kB] 236s Get:42 http://ftpmaster.internal/ubuntu noble/main armhf dh-strip-nondeterminism all 1.13.1-1 [5362 B] 236s Get:43 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdw1t64 armhf 0.190-1.1build2 [235 kB] 236s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main armhf debugedit armhf 1:5.0-5build1 [42.2 kB] 236s Get:45 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dwz armhf 0.15-1build5 [116 kB] 236s Get:46 http://ftpmaster.internal/ubuntu noble/main armhf gettext armhf 0.21-14ubuntu1 [800 kB] 236s Get:47 http://ftpmaster.internal/ubuntu noble/main armhf intltool-debian all 0.35.0+20060710.6 [23.2 kB] 236s Get:48 http://ftpmaster.internal/ubuntu noble/main armhf po-debconf all 1.0.21+nmu1 [233 kB] 236s Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main armhf debhelper all 13.14.1ubuntu5 [869 kB] 236s Get:50 http://ftpmaster.internal/ubuntu noble/universe armhf dh-python all 6.20231223ubuntu2 [111 kB] 236s Get:51 http://ftpmaster.internal/ubuntu noble/main armhf fonts-dejavu-mono all 2.37-8 [502 kB] 236s Get:52 http://ftpmaster.internal/ubuntu noble/main armhf fonts-dejavu-core all 2.37-8 [835 kB] 236s Get:53 http://ftpmaster.internal/ubuntu noble/main armhf libfontenc1 armhf 1:1.1.8-1 [11.5 kB] 236s Get:54 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfreetype6 armhf 2.13.2+dfsg-1build2 [331 kB] 236s Get:55 http://ftpmaster.internal/ubuntu noble/main armhf x11-common all 1:7.7+23ubuntu2 [23.4 kB] 236s Get:56 http://ftpmaster.internal/ubuntu noble/main armhf xfonts-encodings all 1:1.0.5-0ubuntu2 [578 kB] 236s Get:57 http://ftpmaster.internal/ubuntu noble/main armhf xfonts-utils armhf 1:7.7+6build2 [89.8 kB] 236s Get:58 http://ftpmaster.internal/ubuntu noble/main armhf fonts-urw-base35 all 20200910-8 [11.0 MB] 236s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main armhf fontconfig-config armhf 2.15.0-1.1ubuntu1 [37.4 kB] 236s Get:60 http://ftpmaster.internal/ubuntu noble/main armhf libblas3 armhf 3.12.0-3 [123 kB] 236s Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfontconfig1 armhf 2.15.0-1.1ubuntu1 [113 kB] 236s Get:62 http://ftpmaster.internal/ubuntu noble/main armhf libpixman-1-0 armhf 0.42.2-1 [184 kB] 236s Get:63 http://ftpmaster.internal/ubuntu noble/main armhf libxcb-render0 armhf 1.15-1 [15.2 kB] 236s Get:64 http://ftpmaster.internal/ubuntu noble/main armhf libxcb-shm0 armhf 1.15-1 [5852 B] 236s Get:65 http://ftpmaster.internal/ubuntu noble/main armhf libxrender1 armhf 1:0.9.10-1.1 [16.5 kB] 236s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcairo2 armhf 1.18.0-1ubuntu1 [482 kB] 236s Get:67 http://ftpmaster.internal/ubuntu noble/main armhf libdeflate0 armhf 1.19-1 [41.3 kB] 236s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgfortran5 armhf 14-20240315-1ubuntu1 [312 kB] 236s Get:69 http://ftpmaster.internal/ubuntu noble/main armhf libgraphite2-3 armhf 1.3.14-2 [72.7 kB] 236s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libharfbuzz0b armhf 8.3.0-2build1 [446 kB] 236s Get:71 http://ftpmaster.internal/ubuntu noble/main armhf libimagequant0 armhf 2.18.0-1 [31.2 kB] 236s Get:72 http://ftpmaster.internal/ubuntu noble/main armhf libjpeg-turbo8 armhf 2.1.5-2ubuntu1 [123 kB] 236s Get:73 http://ftpmaster.internal/ubuntu noble/main armhf libjpeg8 armhf 8c-2ubuntu11 [2148 B] 236s Get:74 http://ftpmaster.internal/ubuntu noble/main armhf liblapack3 armhf 3.12.0-3 [2085 kB] 236s Get:75 http://ftpmaster.internal/ubuntu noble/universe armhf liblbfgsb0 armhf 3.0+dfsg.4-1 [27.1 kB] 236s Get:76 http://ftpmaster.internal/ubuntu noble/main armhf liblcms2-2 armhf 2.14-2 [134 kB] 236s Get:77 http://ftpmaster.internal/ubuntu noble/main armhf liblerc4 armhf 4.0.0+ds-4ubuntu1 [152 kB] 236s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf libmbedcrypto7t64 armhf 2.28.7-1.1ubuntu1 [180 kB] 236s Get:79 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf libmbedx509-1t64 armhf 2.28.7-1.1ubuntu1 [43.0 kB] 236s Get:80 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf libmbedtls14t64 armhf 2.28.7-1.1ubuntu1 [77.2 kB] 236s Get:81 http://ftpmaster.internal/ubuntu noble/main armhf libraqm0 armhf 0.10.1-1 [12.2 kB] 236s Get:82 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsharpyuv0 armhf 1.3.2-0.4build2 [13.6 kB] 236s Get:83 http://ftpmaster.internal/ubuntu noble/main armhf libjbig0 armhf 2.1-6.1ubuntu1 [24.9 kB] 236s Get:84 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libwebp7 armhf 1.3.2-0.4build2 [183 kB] 236s Get:85 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtiff6 armhf 4.5.1+git230720-4ubuntu1 [178 kB] 236s Get:86 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libwebpdemux2 armhf 1.3.2-0.4build2 [11.8 kB] 236s Get:87 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libwebpmux3 armhf 1.3.2-0.4build2 [22.4 kB] 236s Get:88 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf ncbi-data all 6.1.20170106+dfsg2-1 [4285 kB] 237s Get:89 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf ncbi-blast+ armhf 2.12.0+ds-4build1 [12.1 MB] 237s Get:90 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-numpy armhf 1:1.24.2-3ubuntu1 [3610 kB] 237s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libopenjp2-7 armhf 2.5.0-2build2 [160 kB] 237s Get:92 http://ftpmaster.internal/ubuntu noble/main armhf python3-pil armhf 10.2.0-1 [447 kB] 237s Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-cairo armhf 1.25.1-2build1 [114 kB] 237s Get:94 http://ftpmaster.internal/ubuntu noble/universe armhf python3-freetype all 2.4.0-1 [83.1 kB] 237s Get:95 http://ftpmaster.internal/ubuntu noble/universe armhf python3-rlpycairo all 0.3.0-3 [9130 B] 237s Get:96 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf python3-reportlab all 4.1.0-4 [1105 kB] 237s Get:97 http://ftpmaster.internal/ubuntu noble/main armhf xml-core all 0.19 [20.3 kB] 237s Get:98 http://ftpmaster.internal/ubuntu noble/universe armhf w3c-sgml-lib all 1.3-3 [280 kB] 237s Get:99 http://ftpmaster.internal/ubuntu noble/universe armhf python3-biopython armhf 1.81+dfsg-3 [1642 kB] 237s Get:100 http://ftpmaster.internal/ubuntu noble/main armhf python3-dateutil all 2.8.2-3 [79.2 kB] 237s Get:101 http://ftpmaster.internal/ubuntu noble/universe armhf python3-pandas-lib armhf 2.1.4+dfsg-4ubuntu2 [8219 kB] 237s Get:102 http://ftpmaster.internal/ubuntu noble/universe armhf python3-pandas all 2.1.4+dfsg-4ubuntu2 [3042 kB] 237s Get:103 http://ftpmaster.internal/ubuntu noble/main armhf python3-decorator all 5.1.1-5 [10.1 kB] 237s Get:104 http://ftpmaster.internal/ubuntu noble/universe armhf python3-scipy armhf 1.11.4-6 [18.4 MB] 238s Get:105 http://ftpmaster.internal/ubuntu noble/main armhf python3-packaging all 23.2-1 [40.6 kB] 238s Get:106 http://ftpmaster.internal/ubuntu noble/universe armhf python3-presto armhf 0.7.2-1 [80.7 kB] 238s Get:107 http://ftpmaster.internal/ubuntu noble/universe armhf presto all 0.7.2-1 [240 kB] 238s Get:108 http://ftpmaster.internal/ubuntu noble/universe armhf pybuild-plugin-autopkgtest all 6.20231223ubuntu2 [1760 B] 238s Get:109 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-all armhf 3.12.2-0ubuntu1 [886 B] 239s Fetched 125 MB in 5s (26.0 MB/s) 239s Selecting previously unselected package sgml-base. 239s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58434 files and directories currently installed.) 239s Preparing to unpack .../000-sgml-base_1.31_all.deb ... 239s Unpacking sgml-base (1.31) ... 239s Selecting previously unselected package m4. 239s Preparing to unpack .../001-m4_1.4.19-4_armhf.deb ... 239s Unpacking m4 (1.4.19-4) ... 239s Selecting previously unselected package autoconf. 239s Preparing to unpack .../002-autoconf_2.71-3_all.deb ... 239s Unpacking autoconf (2.71-3) ... 239s Selecting previously unselected package autotools-dev. 239s Preparing to unpack .../003-autotools-dev_20220109.1_all.deb ... 239s Unpacking autotools-dev (20220109.1) ... 239s Selecting previously unselected package automake. 239s Preparing to unpack .../004-automake_1%3a1.16.5-1.3ubuntu1_all.deb ... 239s Unpacking automake (1:1.16.5-1.3ubuntu1) ... 239s Selecting previously unselected package autopoint. 239s Preparing to unpack .../005-autopoint_0.21-14ubuntu1_all.deb ... 239s Unpacking autopoint (0.21-14ubuntu1) ... 240s Selecting previously unselected package libc-dev-bin. 240s Preparing to unpack .../006-libc-dev-bin_2.39-0ubuntu6_armhf.deb ... 240s Unpacking libc-dev-bin (2.39-0ubuntu6) ... 240s Selecting previously unselected package linux-libc-dev:armhf. 240s Preparing to unpack .../007-linux-libc-dev_6.8.0-20.20_armhf.deb ... 240s Unpacking linux-libc-dev:armhf (6.8.0-20.20) ... 240s Selecting previously unselected package libcrypt-dev:armhf. 240s Preparing to unpack .../008-libcrypt-dev_1%3a4.4.36-4_armhf.deb ... 240s Unpacking libcrypt-dev:armhf (1:4.4.36-4) ... 240s Selecting previously unselected package rpcsvc-proto. 240s Preparing to unpack .../009-rpcsvc-proto_1.4.2-0ubuntu6_armhf.deb ... 240s Unpacking rpcsvc-proto (1.4.2-0ubuntu6) ... 240s Selecting previously unselected package libc6-dev:armhf. 240s Preparing to unpack .../010-libc6-dev_2.39-0ubuntu6_armhf.deb ... 240s Unpacking libc6-dev:armhf (2.39-0ubuntu6) ... 240s Selecting previously unselected package libisl23:armhf. 240s Preparing to unpack .../011-libisl23_0.26-3_armhf.deb ... 240s Unpacking libisl23:armhf (0.26-3) ... 240s Selecting previously unselected package libmpc3:armhf. 240s Preparing to unpack .../012-libmpc3_1.3.1-1_armhf.deb ... 240s Unpacking libmpc3:armhf (1.3.1-1) ... 240s Selecting previously unselected package cpp-13-arm-linux-gnueabihf. 240s Preparing to unpack .../013-cpp-13-arm-linux-gnueabihf_13.2.0-19ubuntu1_armhf.deb ... 240s Unpacking cpp-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 240s Selecting previously unselected package cpp-13. 240s Preparing to unpack .../014-cpp-13_13.2.0-19ubuntu1_armhf.deb ... 240s Unpacking cpp-13 (13.2.0-19ubuntu1) ... 240s Selecting previously unselected package cpp-arm-linux-gnueabihf. 240s Preparing to unpack .../015-cpp-arm-linux-gnueabihf_4%3a13.2.0-7ubuntu1_armhf.deb ... 240s Unpacking cpp-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 241s Selecting previously unselected package cpp. 241s Preparing to unpack .../016-cpp_4%3a13.2.0-7ubuntu1_armhf.deb ... 241s Unpacking cpp (4:13.2.0-7ubuntu1) ... 241s Selecting previously unselected package libcc1-0:armhf. 241s Preparing to unpack .../017-libcc1-0_14-20240315-1ubuntu1_armhf.deb ... 241s Unpacking libcc1-0:armhf (14-20240315-1ubuntu1) ... 241s Selecting previously unselected package libgomp1:armhf. 241s Preparing to unpack .../018-libgomp1_14-20240315-1ubuntu1_armhf.deb ... 241s Unpacking libgomp1:armhf (14-20240315-1ubuntu1) ... 241s Selecting previously unselected package libatomic1:armhf. 241s Preparing to unpack .../019-libatomic1_14-20240315-1ubuntu1_armhf.deb ... 241s Unpacking libatomic1:armhf (14-20240315-1ubuntu1) ... 241s Selecting previously unselected package libasan8:armhf. 241s Preparing to unpack .../020-libasan8_14-20240315-1ubuntu1_armhf.deb ... 241s Unpacking libasan8:armhf (14-20240315-1ubuntu1) ... 241s Selecting previously unselected package libubsan1:armhf. 241s Preparing to unpack .../021-libubsan1_14-20240315-1ubuntu1_armhf.deb ... 241s Unpacking libubsan1:armhf (14-20240315-1ubuntu1) ... 241s Selecting previously unselected package libgcc-13-dev:armhf. 241s Preparing to unpack .../022-libgcc-13-dev_13.2.0-19ubuntu1_armhf.deb ... 241s Unpacking libgcc-13-dev:armhf (13.2.0-19ubuntu1) ... 241s Selecting previously unselected package gcc-13-arm-linux-gnueabihf. 241s Preparing to unpack .../023-gcc-13-arm-linux-gnueabihf_13.2.0-19ubuntu1_armhf.deb ... 241s Unpacking gcc-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 241s Selecting previously unselected package gcc-13. 241s Preparing to unpack .../024-gcc-13_13.2.0-19ubuntu1_armhf.deb ... 241s Unpacking gcc-13 (13.2.0-19ubuntu1) ... 242s Selecting previously unselected package gcc-arm-linux-gnueabihf. 242s Preparing to unpack .../025-gcc-arm-linux-gnueabihf_4%3a13.2.0-7ubuntu1_armhf.deb ... 242s Unpacking gcc-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 242s Selecting previously unselected package gcc. 242s Preparing to unpack .../026-gcc_4%3a13.2.0-7ubuntu1_armhf.deb ... 242s Unpacking gcc (4:13.2.0-7ubuntu1) ... 242s Selecting previously unselected package libstdc++-13-dev:armhf. 242s Preparing to unpack .../027-libstdc++-13-dev_13.2.0-19ubuntu1_armhf.deb ... 242s Unpacking libstdc++-13-dev:armhf (13.2.0-19ubuntu1) ... 242s Selecting previously unselected package g++-13-arm-linux-gnueabihf. 242s Preparing to unpack .../028-g++-13-arm-linux-gnueabihf_13.2.0-19ubuntu1_armhf.deb ... 242s Unpacking g++-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 242s Selecting previously unselected package g++-13. 242s Preparing to unpack .../029-g++-13_13.2.0-19ubuntu1_armhf.deb ... 242s Unpacking g++-13 (13.2.0-19ubuntu1) ... 242s Selecting previously unselected package g++-arm-linux-gnueabihf. 242s Preparing to unpack .../030-g++-arm-linux-gnueabihf_4%3a13.2.0-7ubuntu1_armhf.deb ... 242s Unpacking g++-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 242s Selecting previously unselected package g++. 242s Preparing to unpack .../031-g++_4%3a13.2.0-7ubuntu1_armhf.deb ... 242s Unpacking g++ (4:13.2.0-7ubuntu1) ... 242s Selecting previously unselected package build-essential. 242s Preparing to unpack .../032-build-essential_12.10ubuntu1_armhf.deb ... 242s Unpacking build-essential (12.10ubuntu1) ... 242s Selecting previously unselected package cd-hit. 242s Preparing to unpack .../033-cd-hit_4.8.1-4_armhf.deb ... 242s Unpacking cd-hit (4.8.1-4) ... 242s Selecting previously unselected package libdebhelper-perl. 242s Preparing to unpack .../034-libdebhelper-perl_13.14.1ubuntu5_all.deb ... 242s Unpacking libdebhelper-perl (13.14.1ubuntu5) ... 242s Selecting previously unselected package libtool. 242s Preparing to unpack .../035-libtool_2.4.7-7_all.deb ... 242s Unpacking libtool (2.4.7-7) ... 242s Selecting previously unselected package dh-autoreconf. 242s Preparing to unpack .../036-dh-autoreconf_20_all.deb ... 242s Unpacking dh-autoreconf (20) ... 242s Selecting previously unselected package libarchive-zip-perl. 242s Preparing to unpack .../037-libarchive-zip-perl_1.68-1_all.deb ... 242s Unpacking libarchive-zip-perl (1.68-1) ... 242s Selecting previously unselected package libsub-override-perl. 242s Preparing to unpack .../038-libsub-override-perl_0.10-1_all.deb ... 242s Unpacking libsub-override-perl (0.10-1) ... 242s Selecting previously unselected package libfile-stripnondeterminism-perl. 242s Preparing to unpack .../039-libfile-stripnondeterminism-perl_1.13.1-1_all.deb ... 242s Unpacking libfile-stripnondeterminism-perl (1.13.1-1) ... 242s Selecting previously unselected package dh-strip-nondeterminism. 242s Preparing to unpack .../040-dh-strip-nondeterminism_1.13.1-1_all.deb ... 242s Unpacking dh-strip-nondeterminism (1.13.1-1) ... 242s Selecting previously unselected package libdw1t64:armhf. 242s Preparing to unpack .../041-libdw1t64_0.190-1.1build2_armhf.deb ... 242s Unpacking libdw1t64:armhf (0.190-1.1build2) ... 243s Selecting previously unselected package debugedit. 243s Preparing to unpack .../042-debugedit_1%3a5.0-5build1_armhf.deb ... 243s Unpacking debugedit (1:5.0-5build1) ... 243s Selecting previously unselected package dwz. 243s Preparing to unpack .../043-dwz_0.15-1build5_armhf.deb ... 243s Unpacking dwz (0.15-1build5) ... 243s Selecting previously unselected package gettext. 243s Preparing to unpack .../044-gettext_0.21-14ubuntu1_armhf.deb ... 243s Unpacking gettext (0.21-14ubuntu1) ... 243s Selecting previously unselected package intltool-debian. 243s Preparing to unpack .../045-intltool-debian_0.35.0+20060710.6_all.deb ... 243s Unpacking intltool-debian (0.35.0+20060710.6) ... 243s Selecting previously unselected package po-debconf. 243s Preparing to unpack .../046-po-debconf_1.0.21+nmu1_all.deb ... 243s Unpacking po-debconf (1.0.21+nmu1) ... 243s Selecting previously unselected package debhelper. 243s Preparing to unpack .../047-debhelper_13.14.1ubuntu5_all.deb ... 243s Unpacking debhelper (13.14.1ubuntu5) ... 243s Selecting previously unselected package dh-python. 243s Preparing to unpack .../048-dh-python_6.20231223ubuntu2_all.deb ... 243s Unpacking dh-python (6.20231223ubuntu2) ... 243s Selecting previously unselected package fonts-dejavu-mono. 243s Preparing to unpack .../049-fonts-dejavu-mono_2.37-8_all.deb ... 243s Unpacking fonts-dejavu-mono (2.37-8) ... 243s Selecting previously unselected package fonts-dejavu-core. 243s Preparing to unpack .../050-fonts-dejavu-core_2.37-8_all.deb ... 243s Unpacking fonts-dejavu-core (2.37-8) ... 243s Selecting previously unselected package libfontenc1:armhf. 243s Preparing to unpack .../051-libfontenc1_1%3a1.1.8-1_armhf.deb ... 243s Unpacking libfontenc1:armhf (1:1.1.8-1) ... 243s Selecting previously unselected package libfreetype6:armhf. 243s Preparing to unpack .../052-libfreetype6_2.13.2+dfsg-1build2_armhf.deb ... 243s Unpacking libfreetype6:armhf (2.13.2+dfsg-1build2) ... 243s Selecting previously unselected package x11-common. 243s Preparing to unpack .../053-x11-common_1%3a7.7+23ubuntu2_all.deb ... 243s Unpacking x11-common (1:7.7+23ubuntu2) ... 243s Selecting previously unselected package xfonts-encodings. 243s Preparing to unpack .../054-xfonts-encodings_1%3a1.0.5-0ubuntu2_all.deb ... 243s Unpacking xfonts-encodings (1:1.0.5-0ubuntu2) ... 243s Selecting previously unselected package xfonts-utils. 243s Preparing to unpack .../055-xfonts-utils_1%3a7.7+6build2_armhf.deb ... 243s Unpacking xfonts-utils (1:7.7+6build2) ... 243s Selecting previously unselected package fonts-urw-base35. 243s Preparing to unpack .../056-fonts-urw-base35_20200910-8_all.deb ... 243s Unpacking fonts-urw-base35 (20200910-8) ... 244s Selecting previously unselected package fontconfig-config. 244s Preparing to unpack .../057-fontconfig-config_2.15.0-1.1ubuntu1_armhf.deb ... 244s Unpacking fontconfig-config (2.15.0-1.1ubuntu1) ... 244s Selecting previously unselected package libblas3:armhf. 244s Preparing to unpack .../058-libblas3_3.12.0-3_armhf.deb ... 244s Unpacking libblas3:armhf (3.12.0-3) ... 244s Selecting previously unselected package libfontconfig1:armhf. 244s Preparing to unpack .../059-libfontconfig1_2.15.0-1.1ubuntu1_armhf.deb ... 244s Unpacking libfontconfig1:armhf (2.15.0-1.1ubuntu1) ... 244s Selecting previously unselected package libpixman-1-0:armhf. 244s Preparing to unpack .../060-libpixman-1-0_0.42.2-1_armhf.deb ... 244s Unpacking libpixman-1-0:armhf (0.42.2-1) ... 244s Selecting previously unselected package libxcb-render0:armhf. 244s Preparing to unpack .../061-libxcb-render0_1.15-1_armhf.deb ... 244s Unpacking libxcb-render0:armhf (1.15-1) ... 244s Selecting previously unselected package libxcb-shm0:armhf. 244s Preparing to unpack .../062-libxcb-shm0_1.15-1_armhf.deb ... 244s Unpacking libxcb-shm0:armhf (1.15-1) ... 244s Selecting previously unselected package libxrender1:armhf. 244s Preparing to unpack .../063-libxrender1_1%3a0.9.10-1.1_armhf.deb ... 244s Unpacking libxrender1:armhf (1:0.9.10-1.1) ... 244s Selecting previously unselected package libcairo2:armhf. 244s Preparing to unpack .../064-libcairo2_1.18.0-1ubuntu1_armhf.deb ... 244s Unpacking libcairo2:armhf (1.18.0-1ubuntu1) ... 244s Selecting previously unselected package libdeflate0:armhf. 244s Preparing to unpack .../065-libdeflate0_1.19-1_armhf.deb ... 244s Unpacking libdeflate0:armhf (1.19-1) ... 244s Selecting previously unselected package libgfortran5:armhf. 244s Preparing to unpack .../066-libgfortran5_14-20240315-1ubuntu1_armhf.deb ... 244s Unpacking libgfortran5:armhf (14-20240315-1ubuntu1) ... 244s Selecting previously unselected package libgraphite2-3:armhf. 244s Preparing to unpack .../067-libgraphite2-3_1.3.14-2_armhf.deb ... 244s Unpacking libgraphite2-3:armhf (1.3.14-2) ... 244s Selecting previously unselected package libharfbuzz0b:armhf. 244s Preparing to unpack .../068-libharfbuzz0b_8.3.0-2build1_armhf.deb ... 244s Unpacking libharfbuzz0b:armhf (8.3.0-2build1) ... 245s Selecting previously unselected package libimagequant0:armhf. 245s Preparing to unpack .../069-libimagequant0_2.18.0-1_armhf.deb ... 245s Unpacking libimagequant0:armhf (2.18.0-1) ... 245s Selecting previously unselected package libjpeg-turbo8:armhf. 245s Preparing to unpack .../070-libjpeg-turbo8_2.1.5-2ubuntu1_armhf.deb ... 245s Unpacking libjpeg-turbo8:armhf (2.1.5-2ubuntu1) ... 245s Selecting previously unselected package libjpeg8:armhf. 245s Preparing to unpack .../071-libjpeg8_8c-2ubuntu11_armhf.deb ... 245s Unpacking libjpeg8:armhf (8c-2ubuntu11) ... 245s Selecting previously unselected package liblapack3:armhf. 245s Preparing to unpack .../072-liblapack3_3.12.0-3_armhf.deb ... 245s Unpacking liblapack3:armhf (3.12.0-3) ... 245s Selecting previously unselected package liblbfgsb0:armhf. 245s Preparing to unpack .../073-liblbfgsb0_3.0+dfsg.4-1_armhf.deb ... 245s Unpacking liblbfgsb0:armhf (3.0+dfsg.4-1) ... 245s Selecting previously unselected package liblcms2-2:armhf. 245s Preparing to unpack .../074-liblcms2-2_2.14-2_armhf.deb ... 245s Unpacking liblcms2-2:armhf (2.14-2) ... 245s Selecting previously unselected package liblerc4:armhf. 245s Preparing to unpack .../075-liblerc4_4.0.0+ds-4ubuntu1_armhf.deb ... 245s Unpacking liblerc4:armhf (4.0.0+ds-4ubuntu1) ... 245s Selecting previously unselected package libmbedcrypto7t64:armhf. 245s Preparing to unpack .../076-libmbedcrypto7t64_2.28.7-1.1ubuntu1_armhf.deb ... 245s Unpacking libmbedcrypto7t64:armhf (2.28.7-1.1ubuntu1) ... 245s Selecting previously unselected package libmbedx509-1t64:armhf. 245s Preparing to unpack .../077-libmbedx509-1t64_2.28.7-1.1ubuntu1_armhf.deb ... 245s Unpacking libmbedx509-1t64:armhf (2.28.7-1.1ubuntu1) ... 245s Selecting previously unselected package libmbedtls14t64:armhf. 245s Preparing to unpack .../078-libmbedtls14t64_2.28.7-1.1ubuntu1_armhf.deb ... 245s Unpacking libmbedtls14t64:armhf (2.28.7-1.1ubuntu1) ... 245s Selecting previously unselected package libraqm0:armhf. 245s Preparing to unpack .../079-libraqm0_0.10.1-1_armhf.deb ... 245s Unpacking libraqm0:armhf (0.10.1-1) ... 245s Selecting previously unselected package libsharpyuv0:armhf. 245s Preparing to unpack .../080-libsharpyuv0_1.3.2-0.4build2_armhf.deb ... 245s Unpacking libsharpyuv0:armhf (1.3.2-0.4build2) ... 245s Selecting previously unselected package libjbig0:armhf. 245s Preparing to unpack .../081-libjbig0_2.1-6.1ubuntu1_armhf.deb ... 245s Unpacking libjbig0:armhf (2.1-6.1ubuntu1) ... 245s Selecting previously unselected package libwebp7:armhf. 245s Preparing to unpack .../082-libwebp7_1.3.2-0.4build2_armhf.deb ... 245s Unpacking libwebp7:armhf (1.3.2-0.4build2) ... 245s Selecting previously unselected package libtiff6:armhf. 245s Preparing to unpack .../083-libtiff6_4.5.1+git230720-4ubuntu1_armhf.deb ... 245s Unpacking libtiff6:armhf (4.5.1+git230720-4ubuntu1) ... 245s Selecting previously unselected package libwebpdemux2:armhf. 245s Preparing to unpack .../084-libwebpdemux2_1.3.2-0.4build2_armhf.deb ... 245s Unpacking libwebpdemux2:armhf (1.3.2-0.4build2) ... 245s Selecting previously unselected package libwebpmux3:armhf. 245s Preparing to unpack .../085-libwebpmux3_1.3.2-0.4build2_armhf.deb ... 245s Unpacking libwebpmux3:armhf (1.3.2-0.4build2) ... 245s Selecting previously unselected package ncbi-data. 245s Preparing to unpack .../086-ncbi-data_6.1.20170106+dfsg2-1_all.deb ... 245s Unpacking ncbi-data (6.1.20170106+dfsg2-1) ... 245s Selecting previously unselected package ncbi-blast+. 245s Preparing to unpack .../087-ncbi-blast+_2.12.0+ds-4build1_armhf.deb ... 245s Unpacking ncbi-blast+ (2.12.0+ds-4build1) ... 246s Selecting previously unselected package python3-numpy. 246s Preparing to unpack .../088-python3-numpy_1%3a1.24.2-3ubuntu1_armhf.deb ... 246s Unpacking python3-numpy (1:1.24.2-3ubuntu1) ... 246s Selecting previously unselected package libopenjp2-7:armhf. 246s Preparing to unpack .../089-libopenjp2-7_2.5.0-2build2_armhf.deb ... 246s Unpacking libopenjp2-7:armhf (2.5.0-2build2) ... 246s Selecting previously unselected package python3-pil:armhf. 246s Preparing to unpack .../090-python3-pil_10.2.0-1_armhf.deb ... 246s Unpacking python3-pil:armhf (10.2.0-1) ... 246s Selecting previously unselected package python3-cairo. 246s Preparing to unpack .../091-python3-cairo_1.25.1-2build1_armhf.deb ... 246s Unpacking python3-cairo (1.25.1-2build1) ... 246s Selecting previously unselected package python3-freetype. 246s Preparing to unpack .../092-python3-freetype_2.4.0-1_all.deb ... 246s Unpacking python3-freetype (2.4.0-1) ... 246s Selecting previously unselected package python3-rlpycairo. 246s Preparing to unpack .../093-python3-rlpycairo_0.3.0-3_all.deb ... 246s Unpacking python3-rlpycairo (0.3.0-3) ... 246s Selecting previously unselected package python3-reportlab. 246s Preparing to unpack .../094-python3-reportlab_4.1.0-4_all.deb ... 246s Unpacking python3-reportlab (4.1.0-4) ... 246s Selecting previously unselected package xml-core. 246s Preparing to unpack .../095-xml-core_0.19_all.deb ... 246s Unpacking xml-core (0.19) ... 247s Selecting previously unselected package w3c-sgml-lib. 247s Preparing to unpack .../096-w3c-sgml-lib_1.3-3_all.deb ... 247s Unpacking w3c-sgml-lib (1.3-3) ... 247s Selecting previously unselected package python3-biopython. 247s Preparing to unpack .../097-python3-biopython_1.81+dfsg-3_armhf.deb ... 247s Unpacking python3-biopython (1.81+dfsg-3) ... 247s Selecting previously unselected package python3-dateutil. 247s Preparing to unpack .../098-python3-dateutil_2.8.2-3_all.deb ... 247s Unpacking python3-dateutil (2.8.2-3) ... 247s Selecting previously unselected package python3-pandas-lib:armhf. 247s Preparing to unpack .../099-python3-pandas-lib_2.1.4+dfsg-4ubuntu2_armhf.deb ... 247s Unpacking python3-pandas-lib:armhf (2.1.4+dfsg-4ubuntu2) ... 247s Selecting previously unselected package python3-pandas. 247s Preparing to unpack .../100-python3-pandas_2.1.4+dfsg-4ubuntu2_all.deb ... 247s Unpacking python3-pandas (2.1.4+dfsg-4ubuntu2) ... 248s Selecting previously unselected package python3-decorator. 248s Preparing to unpack .../101-python3-decorator_5.1.1-5_all.deb ... 248s Unpacking python3-decorator (5.1.1-5) ... 248s Selecting previously unselected package python3-scipy. 248s Preparing to unpack .../102-python3-scipy_1.11.4-6_armhf.deb ... 248s Unpacking python3-scipy (1.11.4-6) ... 249s Selecting previously unselected package python3-packaging. 249s Preparing to unpack .../103-python3-packaging_23.2-1_all.deb ... 249s Unpacking python3-packaging (23.2-1) ... 249s Selecting previously unselected package python3-presto. 249s Preparing to unpack .../104-python3-presto_0.7.2-1_armhf.deb ... 249s Unpacking python3-presto (0.7.2-1) ... 249s Selecting previously unselected package presto. 249s Preparing to unpack .../105-presto_0.7.2-1_all.deb ... 249s Unpacking presto (0.7.2-1) ... 249s Selecting previously unselected package pybuild-plugin-autopkgtest. 249s Preparing to unpack .../106-pybuild-plugin-autopkgtest_6.20231223ubuntu2_all.deb ... 249s Unpacking pybuild-plugin-autopkgtest (6.20231223ubuntu2) ... 249s Selecting previously unselected package python3-all. 249s Preparing to unpack .../107-python3-all_3.12.2-0ubuntu1_armhf.deb ... 249s Unpacking python3-all (3.12.2-0ubuntu1) ... 249s Selecting previously unselected package autopkgtest-satdep. 249s Preparing to unpack .../108-1-autopkgtest-satdep.deb ... 249s Unpacking autopkgtest-satdep (0) ... 249s Setting up dh-python (6.20231223ubuntu2) ... 249s Setting up libgraphite2-3:armhf (1.3.14-2) ... 249s Setting up liblcms2-2:armhf (2.14-2) ... 249s Setting up ncbi-data (6.1.20170106+dfsg2-1) ... 249s Setting up libpixman-1-0:armhf (0.42.2-1) ... 249s Setting up libsharpyuv0:armhf (1.3.2-0.4build2) ... 249s Setting up liblerc4:armhf (4.0.0+ds-4ubuntu1) ... 249s Setting up libmbedcrypto7t64:armhf (2.28.7-1.1ubuntu1) ... 249s Setting up libxrender1:armhf (1:0.9.10-1.1) ... 249s Setting up libxcb-render0:armhf (1.15-1) ... 249s Setting up libarchive-zip-perl (1.68-1) ... 249s Setting up libdebhelper-perl (13.14.1ubuntu5) ... 249s Setting up x11-common (1:7.7+23ubuntu2) ... 249s Setting up libdeflate0:armhf (1.19-1) ... 249s Setting up linux-libc-dev:armhf (6.8.0-20.20) ... 249s Setting up m4 (1.4.19-4) ... 249s Setting up python3-all (3.12.2-0ubuntu1) ... 249s Setting up libxcb-shm0:armhf (1.15-1) ... 249s Setting up libgomp1:armhf (14-20240315-1ubuntu1) ... 249s Setting up libjbig0:armhf (2.1-6.1ubuntu1) ... 249s Setting up libdw1t64:armhf (0.190-1.1build2) ... 249s Setting up python3-decorator (5.1.1-5) ... 249s Setting up libfontenc1:armhf (1:1.1.8-1) ... 249s Setting up autotools-dev (20220109.1) ... 249s Setting up libblas3:armhf (3.12.0-3) ... 249s update-alternatives: using /usr/lib/arm-linux-gnueabihf/blas/libblas.so.3 to provide /usr/lib/arm-linux-gnueabihf/libblas.so.3 (libblas.so.3-arm-linux-gnueabihf) in auto mode 249s Setting up python3-packaging (23.2-1) ... 249s Setting up rpcsvc-proto (1.4.2-0ubuntu6) ... 249s Setting up libfreetype6:armhf (2.13.2+dfsg-1build2) ... 249s Setting up xfonts-encodings (1:1.0.5-0ubuntu2) ... 249s Setting up libimagequant0:armhf (2.18.0-1) ... 249s Setting up fonts-dejavu-mono (2.37-8) ... 249s Setting up libmpc3:armhf (1.3.1-1) ... 249s Setting up libatomic1:armhf (14-20240315-1ubuntu1) ... 249s Setting up autopoint (0.21-14ubuntu1) ... 249s Setting up fonts-dejavu-core (2.37-8) ... 249s Setting up libjpeg-turbo8:armhf (2.1.5-2ubuntu1) ... 249s Setting up libgfortran5:armhf (14-20240315-1ubuntu1) ... 249s Setting up autoconf (2.71-3) ... 249s Setting up libwebp7:armhf (1.3.2-0.4build2) ... 249s Setting up libubsan1:armhf (14-20240315-1ubuntu1) ... 249s Setting up dwz (0.15-1build5) ... 249s Setting up libcrypt-dev:armhf (1:4.4.36-4) ... 249s Setting up libasan8:armhf (14-20240315-1ubuntu1) ... 249s Setting up debugedit (1:5.0-5build1) ... 249s Setting up libopenjp2-7:armhf (2.5.0-2build2) ... 249s Setting up libsub-override-perl (0.10-1) ... 249s Setting up libharfbuzz0b:armhf (8.3.0-2build1) ... 249s Setting up python3-dateutil (2.8.2-3) ... 250s Setting up sgml-base (1.31) ... 250s Setting up libisl23:armhf (0.26-3) ... 250s Setting up libc-dev-bin (2.39-0ubuntu6) ... 250s Setting up libwebpmux3:armhf (1.3.2-0.4build2) ... 250s Setting up libcc1-0:armhf (14-20240315-1ubuntu1) ... 250s Setting up cd-hit (4.8.1-4) ... 250s Setting up libjpeg8:armhf (8c-2ubuntu11) ... 250s Setting up automake (1:1.16.5-1.3ubuntu1) ... 250s update-alternatives: using /usr/bin/automake-1.16 to provide /usr/bin/automake (automake) in auto mode 250s Setting up libfile-stripnondeterminism-perl (1.13.1-1) ... 250s Setting up liblapack3:armhf (3.12.0-3) ... 250s update-alternatives: using /usr/lib/arm-linux-gnueabihf/lapack/liblapack.so.3 to provide /usr/lib/arm-linux-gnueabihf/liblapack.so.3 (liblapack.so.3-arm-linux-gnueabihf) in auto mode 250s Setting up gettext (0.21-14ubuntu1) ... 250s Setting up libmbedx509-1t64:armhf (2.28.7-1.1ubuntu1) ... 250s Setting up cpp-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 250s Setting up fontconfig-config (2.15.0-1.1ubuntu1) ... 250s Setting up libwebpdemux2:armhf (1.3.2-0.4build2) ... 250s Setting up python3-freetype (2.4.0-1) ... 250s Setting up xfonts-utils (1:7.7+6build2) ... 250s Setting up intltool-debian (0.35.0+20060710.6) ... 250s Setting up libraqm0:armhf (0.10.1-1) ... 250s Setting up python3-numpy (1:1.24.2-3ubuntu1) ... 253s Setting up dh-strip-nondeterminism (1.13.1-1) ... 253s Setting up libgcc-13-dev:armhf (13.2.0-19ubuntu1) ... 253s Setting up libmbedtls14t64:armhf (2.28.7-1.1ubuntu1) ... 253s Setting up libtiff6:armhf (4.5.1+git230720-4ubuntu1) ... 253s Setting up xml-core (0.19) ... 253s Setting up libc6-dev:armhf (2.39-0ubuntu6) ... 253s Setting up libfontconfig1:armhf (2.15.0-1.1ubuntu1) ... 253s Setting up cpp-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 253s Setting up libstdc++-13-dev:armhf (13.2.0-19ubuntu1) ... 253s Setting up liblbfgsb0:armhf (3.0+dfsg.4-1) ... 253s Setting up python3-scipy (1.11.4-6) ... 257s Setting up cpp-13 (13.2.0-19ubuntu1) ... 257s Setting up po-debconf (1.0.21+nmu1) ... 257s Setting up python3-pandas-lib:armhf (2.1.4+dfsg-4ubuntu2) ... 257s Setting up fonts-urw-base35 (20200910-8) ... 257s Setting up libcairo2:armhf (1.18.0-1ubuntu1) ... 257s Setting up gcc-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 257s Setting up ncbi-blast+ (2.12.0+ds-4build1) ... 257s Setting up python3-pil:armhf (10.2.0-1) ... 257s Setting up python3-pandas (2.1.4+dfsg-4ubuntu2) ... 263s Setting up gcc-13 (13.2.0-19ubuntu1) ... 263s Setting up cpp (4:13.2.0-7ubuntu1) ... 263s Setting up gcc-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 263s Setting up g++-13-arm-linux-gnueabihf (13.2.0-19ubuntu1) ... 263s Setting up g++-arm-linux-gnueabihf (4:13.2.0-7ubuntu1) ... 263s Setting up g++-13 (13.2.0-19ubuntu1) ... 263s Setting up python3-cairo (1.25.1-2build1) ... 264s Setting up libtool (2.4.7-7) ... 264s Setting up gcc (4:13.2.0-7ubuntu1) ... 264s Setting up dh-autoreconf (20) ... 264s Setting up python3-rlpycairo (0.3.0-3) ... 264s Setting up python3-reportlab (4.1.0-4) ... 265s Setting up g++ (4:13.2.0-7ubuntu1) ... 265s update-alternatives: using /usr/bin/g++ to provide /usr/bin/c++ (c++) in auto mode 265s Setting up build-essential (12.10ubuntu1) ... 265s Setting up debhelper (13.14.1ubuntu5) ... 265s Setting up pybuild-plugin-autopkgtest (6.20231223ubuntu2) ... 265s Processing triggers for libc-bin (2.39-0ubuntu6) ... 265s Processing triggers for man-db (2.12.0-3build4) ... 266s Processing triggers for install-info (7.1-3build1) ... 266s Processing triggers for sgml-base (1.31) ... 266s Setting up w3c-sgml-lib (1.3-3) ... 290s Setting up python3-biopython (1.81+dfsg-3) ... 292s Setting up python3-presto (0.7.2-1) ... 292s /usr/lib/python3/dist-packages/presto/Annotation.py:293: SyntaxWarning: invalid escape sequence '\s' 292s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter)) 292s /usr/lib/python3/dist-packages/presto/Annotation.py:368: SyntaxWarning: invalid escape sequence '\s' 292s sub_regex = '[%s\s]+' % re.escape(''.join(delimiter[1:])) 292s /usr/lib/python3/dist-packages/presto/Annotation.py:491: SyntaxWarning: invalid escape sequence '\s' 292s header['SPECIES'] = re.sub('\s', '_', fields[2]) 292s /usr/lib/python3/dist-packages/presto/Annotation.py:493: SyntaxWarning: invalid escape sequence '\(' 292s header['FUNCTIONALITY'] = re.sub('[\(\)\[\]]', '', fields[3]) 292s /usr/lib/python3/dist-packages/presto/Annotation.py:494: SyntaxWarning: invalid escape sequence '\s' 292s header['PARTIAL'] = 'FALSE' if re.sub('\s', '', fields[13]) == '' else 'TRUE' 292s /usr/lib/python3/dist-packages/presto/Applications.py:61: SyntaxWarning: invalid escape sequence '\.' 292s version = re.sub('\.linux.*$','',version) 292s /usr/lib/python3/dist-packages/presto/Applications.py:288: SyntaxWarning: invalid escape sequence '\>' 292s id_regex = re.compile('([0-9]+\t[0-9]+nt, \>)(.+)(\.\.\.)') 292s /usr/lib/python3/dist-packages/presto/IO.py:34: SyntaxWarning: invalid escape sequence '\s' 292s if replace_special: parse_id = lambda x: re.sub('[\s,=|]+', '_', x) 292s Setting up presto (0.7.2-1) ... 292s Setting up autopkgtest-satdep (0) ... 310s (Reading database ... 69346 files and directories currently installed.) 310s Removing autopkgtest-satdep (0) ... 316s autopkgtest [00:18:58]: test pybuild-autopkgtest: pybuild-autopkgtest 316s autopkgtest [00:18:58]: test pybuild-autopkgtest: [----------------------- 317s pybuild-autopkgtest 318s I: pybuild pybuild:310: cp -r /tmp/autopkgtest.CovVsU/build.EMS/src/bin /tmp/autopkgtest.CovVsU/autopkgtest_tmp/build; rm /tmp/autopkgtest.CovVsU/build.EMS/src/tests/test_ClusterSets.py || echo "Test file already removed or moved"; 318s I: pybuild base:305: cd /tmp/autopkgtest.CovVsU/autopkgtest_tmp/build; python3.12 -m unittest discover -v 319s test_collapseAnnotation (tests.test_Annotation.TestAnnotation.test_collapseAnnotation) ... ok 319s test_getCoordKey (tests.test_Annotation.TestAnnotation.test_getCoordKey) ... ok 319s test_mergeAnnotation (tests.test_Annotation.TestAnnotation.test_mergeAnnotation) ... ok 319s test_renameAnnotation (tests.test_Annotation.TestAnnotation.test_renameAnnotation) ... ok 319s test_alignAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_alignAssembly) ... skipped '-> alignAssembly() skipped\n' 319s test_makeBlastnDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeBlastnDb) ... skipped '-> makeBlastnDb() skipped\n' 319s test_makeUSearchDb (tests.test_AssemblePairs.TestAssemblePairs.test_makeUSearchDb) ... skipped '-> makeUSearchDb() skipped\n' 319s test_referenceAssembly (tests.test_AssemblePairs.TestAssemblePairs.test_referenceAssembly) ... skipped '-> referenceAssembly() skipped\n' 319s test_runBlastn (tests.test_AssemblePairs.TestAssemblePairs.test_runBlastn) ... skipped '-> runBlastn() skipped\n' 319s test_runUSearch (tests.test_AssemblePairs.TestAssemblePairs.test_runUSearch) ... skipped '-> runUSearch() skipped\n' 319s test_calculateSetError (tests.test_BuildConsensus.TestBuildConsensus.test_calculateSetError) ... -> test_collapseAnnotation() 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A', 'TEST2': 1, 'TEST3': 'First'}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'B', 'TEST2': 2, 'TEST3': 'Second'}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': ['A', 'B'], 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'AB', 'TEST2': '12', 'TEST3': 'FirstSecond'}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '1', 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '2', 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B', 'TEST2': '3', 'TEST3': ['First', 'Second']}) 319s <- test_collapseAnnotation() 0.000 319s -> test_getCoordKey() 319s ['MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'MS6_33112:1:1101:18371:1066'] 319s ['SRR001666.1', 'SRR735691.1', 'SRR1383326.1', 'SRR1383326.1', 'ERR346596.6'] 319s ['000034_0199_0169', 'GXGJ56Z01AE06X'] 319s <- test_getCoordKey() 0.000 319s -> test_mergeAnnotation() 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,C,C', 'TEST2': '1,2,3', 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'C,C,A,B', 'TEST2': '3,1,2', 'TEST3': ['First', 'Second']}) 319s <- test_mergeAnnotation() 0.000 319s -> test_renameAnnotation() 319s OrderedDict({'ID': 'SEQ1', 'RENAMED1': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'RENAMED2': 'A,B', 'TEST2': [1, 2], 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2', 'TEST3': ['First', 'Second']}) 319s OrderedDict({'ID': 'SEQ1', 'TEST1': 'A,B,1,2,First,Second'}) 319s <- test_renameAnnotation() 0.000 319s -> test_calculateSetError() 319s Frequency consensus error> 319s REF> CGGCGTAA 319s SEQ1> CGGCGTAA 319s SEQ2> CCNNGTAA 319s SEQ3> CGGC--TA 319s SEQ4> CGNN--TA 319s SEQ5> CGGC--AA 319s ERROR> 0.250000 319s Quality consensus error> 319s REF> CGGCNNAA 319s SEQ1> CGGCGTAA 319s SEQ2> CCNNGTAA 319s SEQ3> CGGC--TA 319s SEQ4> CGNN--TA 319s SEQ5> CGGC--AA 319s ERROR> 0.233333 319s <- test_calculateSetError() 0.000 319s -> test_deleteSeqPositions() 319s MAX_GAP=0.4> CGGCAA 319s MAX_GAP=0.8> CGGCGTAA 319s <- test_deleteSeqPositions() 0.000 319s -> test_findGapPositions() 319s MAX_GAP=0.4> [4, 5] 319s MAX_GAP=0.8> [] 319s <- test_findGapPositions() 0.000 319s -> test_frequencyConsensus() 319s MIN_FREQ=0.2> CGGCGTAA 319s MIN_FREQ=0.8> CGGCGTNA 319s <- test_frequencyConsensus() 0.000 319s -> test_qualityConsensus() 319s MIN_QUAL=0> CGGCGTAA [90, 90, 36, 36, 16, 16, 72, 90] 319s MIN_QUAL=20> CGGCNNAA [90, 90, 36, 36, 0, 0, 72, 90] 319s MIN_FREQ=0.8> CGGCNNNA [90, 90, 36, 36, 0, 0, 0, 90] 319s <- test_qualityConsensus() 0.000 319s -> test_checkSeqEqual() 319s DNA Equality> 319s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 319s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 319s EQUAL> True 319s 319s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 319s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 319s EQUAL> False 319s 319s SEQ1|COUNT=1> CCACGTTTTAGTAATTAATA 319s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 319s EQUAL> True 319s 319s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 319s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 319s EQUAL> False 319s 319s SEQ2|COUNT=2> CCACGTTTTAGTAATTAATA 319s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 319s EQUAL> True 319s 319s SEQ3|COUNT=3> CCACGTTTTACTAATTAATA 319s SEQ4|COUNT=4> CCACGTTTTANTAATTAATA 319s EQUAL> True 319s 319s <- test_checkSeqEqual() 0.000 319s -> test_convert454Header() 319s OrderedDict({'ID': '000034_0199_0169', 'LENGTH': '437', 'UACCNO': 'GNDG01201ARRCR'}) 319s OrderedDict({'ID': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 319s <- test_convert454Header() 0.000 319s -> test_convertGenbankHeader() 319s OrderedDict({'ID': 'CM000663.2', 'GI': '568336023', 'SOURCE': 'gb', 'DESC': 'Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 319s OrderedDict({'ID': 'CM000663.2', 'DESC': 'Homo_sapiens_chromosome_1__GRCh38_reference_primary_assembly'}) 319s <- test_convertGenbankHeader() 0.000 319s -> test_convertGenericHeader() 319s OrderedDict({'ID': 'gi_568336023_gb_CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 319s OrderedDict({'ID': 'CM000663.2_Homo_sapiens_chromosome_1_GRCh38_reference_primary_assembly'}) 319s OrderedDict({'ID': 'M99641_IGHV1-18*01_Homo_sapiens_F_V-REGION_188..483_296_nt_1_296+24_320_'}) 319s OrderedDict({'ID': "Z29978_IGHV1-69*07_Homo_sapiens_F_V-REGION_1..233_233_nt_1_233+58_291_partial_in_5'_and_in_3'_"}) 319s OrderedDict({'ID': 'AB019439_IGHV(III)-22-2*01_Homo_sapiens_P_L-PART1+V-EXON_168065..168119+168222..168262_96_nt_1_96+0_96_'}) 319s OrderedDict({'ID': 'AE000659_TRAV11*01_Homo_sapiens_(P)_V-REGION_85121..85397_276_nt_1_276+42_318_'}) 319s <- test_convertGenericHeader() 0.000 319s -> test_convertIMGTHeader() 319s OrderedDict({'ID': 'IGHV1-18*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'FALSE', 'ACCESSION': 'M99641'}) 319s OrderedDict({'ID': 'IGHV1-69*07', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'F', 'PARTIAL': 'TRUE', 'ACCESSION': 'Z29978'}) 319s OrderedDict({'ID': 'IGHV(III)-22-2*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'L-PART1+V-EXON', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AB019439'}) 319s OrderedDict({'ID': 'TRAV11*01', 'SPECIES': 'Homo_sapiens', 'REGION': 'V-REGION', 'FUNCTIONALITY': 'P', 'PARTIAL': 'FALSE', 'ACCESSION': 'AE000659'}) 319s OrderedDict({'ID': 'IGHV1-18*01'}) 319s OrderedDict({'ID': 'IGHV1-69*07'}) 319s OrderedDict({'ID': 'IGHV(III)-22-2*01'}) 319s OrderedDict({'ID': 'TRAV11*01'}) 319s <- test_convertIMGTHeader() 0.000 319s -> test_convertIlluminaHeader() 319s OrderedDict({'ID': 'MISEQ:132:000000000-A2F3U:1:1101:14340:1555', 'INDEX': 'ATCACG', 'READ': '1'}) 319s OrderedDict({'ID': 'HWI-EAS209_0006_FC706VJ:5:58:5894:21141', 'INDEX': 'ATCACG', 'READ': '1'}) 319s OrderedDict({'ID': 'MS6_33112:1:1101:18371:1066', 'READ': '1'}) 319s <- test_convertIlluminaHeader() 0.000 319s -> test_convertSRAHeader() 319s OrderedDict({'ID': 'SRR001666.1', 'DESC': '071112_SLXA-EAS1_s_7:5:1:817:345', 'LENGTH': '36'}) 319s OrderedDict({'ID': 'SRR735691.1', 'DESC': 'GXGJ56Z01AE06X', 'LENGTH': '222'}) 319s OrderedDict({'ID': 'SRR1383326.1', 'DESC': '1', 'LENGTH': '250'}) 319s OrderedDict({'ID': 'SRR1383326.1', 'READ': '2', 'DESC': '1', 'LENGTH': '250'}) 319s OrderedDict({'ID': 'ERR346596.6', 'DESC': 'BS-DSFCONTROL04:4:000000000-A3F0Y:1:1101:13220:1649/1'}) 319s <- test_convertSRAHeader() 0.000 319s -> test_calculateDistances() 319s <- test_calculateDistances() 0.001 319s -> test_countMismatches() 319s <- test_countMismatches() 0.001 319s -> test_initializeMismatchDictionary() 319s <- test_initializeMismatchDictionary() 0.000 319s -> test_getFileType() 319s <- test_getFileType() 0.000 319s -> test_extractAlignment() 319s SEQ1> 319s SEQ> CCACGTTTTAGTAATTAATA 319s ALN-SEQ> CCACGTTTTAGT 319s ALN-PR> ----GTTTTAGT 319s PRIMER> GTTTTAGT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ2> 319s SEQ> CCNCGTTTTAGTAATTAATA 319s ALN-SEQ> CCNCGTTTTAGT 319s ALN-PR> ----GTTTTAGT 319s PRIMER> GTTTTAGT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ3> 319s SEQ> GGGCGTTTTAGTAATTAATA 319s ALN-SEQ> GGGCGTTTTAGT 319s ALN-PR> ----GTTTTAGT 319s PRIMER> GTTTTAGT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ4> 319s SEQ> GGNNGTTTTACTAATTAATA 319s ALN-SEQ> GGNNGTTTTACT 319s ALN-PR> ----GTTTTACT 319s PRIMER> GTTTTACT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ5> 319s SEQ> NNGCNNNNNACTAATTAATA 319s ALN-SEQ> NNGCNNNNNACT 319s ALN-PR> ----NNNNNACT 319s PRIMER> NNNNNACT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ6> 319s SEQ> GGGATANNNACTAATTAATA 319s ALN-SEQ> GGGATANNNACT 319s ALN-PR> ----TANNNACT 319s PRIMER> TANNNACT 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ7> 319s SEQ> NNNNNNNNNNNNNNNNNNNN 319s ALN-SEQ> NNNNNNNNNNNN 319s ALN-PR> ----NNNNNNNN 319s PRIMER> NNNNNNNN 319s START> 4 319s END> 12 319s GAPS> 0 319s ERROR> 0.000000 319s 319s <- test_extractAlignment() 0.000 319s -> test_localAlignment() 319s TEST Ns> 319s SEQ1> 319s SEQ> CCACGTTTTAGTAATTAATA 319s ALN-SEQ> CCACGTTTTAGTAATTAATA 319s ALN-PR> -CACGTTTT----------- 319s PRIMER> PR1 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ2> 319s SEQ> CCNCGTTTTAGTAATTAATA 319s ALN-SEQ> CCNCGTTTTAGTAATTAATA 319s ALN-PR> -CACGTTTT----------- 319s PRIMER> PR1 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.125000 319s 319s SEQ3> 319s SEQ> GGGCGTTTTAGTAATTAATA 319s ALN-SEQ> GGGCGTTTTAGTAATTAATA 319s ALN-PR> -GGCGTTTT----------- 319s PRIMER> PR2 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ4> 319s SEQ> GGNNGTTTTACTAATTAATA 319s ALN-SEQ> GGNNGTTTTACTAATTAATA 319s ALN-PR> GGC-GTTTT----------- 319s PRIMER> PR2 319s START> 0 319s END> 9 319s GAPS> 1 319s ERROR> 0.250000 319s 319s SEQ5> 319s SEQ> NNGCNNNNNACTAATTAATA 319s ALN-SEQ> NNGCNNNNNACTAATTAATA 319s ALN-PR> ------------ANATAA-- 319s PRIMER> PR3 319s START> 12 319s END> 18 319s GAPS> 0 319s ERROR> 0.375000 319s 319s SEQ6> 319s SEQ> GGGATANNNACTAATTAATA 319s ALN-SEQ> GGGATANNNACTAATTAATA 319s ALN-PR> -GGANA-------------- 319s PRIMER> PR3 319s START> 1 319s END> 6 319s GAPS> 0 319s ERROR> 0.375000 319s 319s SEQ7> 319s SEQ> NNNNNNNNNNNNNNNNNNNN 319s ALN-SEQ> None 319s ALN-PR> None 319s PRIMER> None 319s START> None 319s END> None 319s GAPS> 0 319s ERROR> 1.000000 319s 319s TEST INDELS> 319s SEQ1> 319s SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 319s ALN-SEQ> CGGATCTTCTACTCCATACGTCCGTCAGTCGTGGATCTGATCTAGCTGCGCCTTTTTCTCAG 319s ALN-PR> ---------------ATACGTCCGTCAGTCGTGGATGT------------------------ 319s PRIMER> PR1 319s START> 15 319s END> 38 319s GAPS> 0 319s ERROR> 0.083333 319s 319s SEQ2> 319s SEQ> CGGATCTTCTACTCAAAACCGTCCTCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 319s ALN-SEQ> CGGATCTTCTACTCAAAACCGTCC-TCAGTCGTGGATCTGGTCTAGCTGGGGCTGTTTCCCTG 319s ALN-PR> --------------AATAC-GTCCGTCAGTCGTGGATGT------------------------ 319s PRIMER> PR1 319s START> 14 319s END> 38 319s GAPS> 2 319s ERROR> 0.208333 319s 319s SEQ3> 319s SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTGATCTGTTTTACATGGGGGCATCACCCAG 319s ALN-SEQ> GGTTTAAGTTAAGATAATACGTCCGTCAGTCGTG-ATCTGTTTTACATGGGGGCATCACCCAG 319s ALN-PR> ---------------AATACGTCCGTCAGTCGTGGATGT------------------------ 319s PRIMER> PR1 319s START> 15 319s END> 38 319s GAPS> 1 319s ERROR> 0.125000 319s 319s SEQ4> 319s SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 319s ALN-SEQ> CAACCACATGGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCT 319s ALN-PR> ------CATCT-TCCTCTA------------------------------------------- 319s PRIMER> PR2 319s START> 6 319s END> 19 319s GAPS> 1 319s ERROR> 0.250000 319s 319s SEQ5> 319s SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 319s ALN-SEQ> CAACCACATGGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTG 319s ALN-PR> ------CATCTTCCTCTA-------------------------------------------- 319s PRIMER> PR2 319s START> 6 319s END> 18 319s GAPS> 0 319s ERROR> 0.166667 319s 319s SEQ6> 319s SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 319s ALN-SEQ> TCTGTCCTCTAGAGAATCCCCTGAGAGCTCCGTTCCTCACCATGGACTGGACCTCAACCACA 319s ALN-PR> TCT-TCCTCTA--------------------------------------------------- 319s PRIMER> PR2 319s START> 0 319s END> 11 319s GAPS> 1 319s ERROR> 0.250000 319s 319s SEQ7> 319s SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-SEQ> AGGTGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-PR> --GTGAAGA-GCCTG----------------------------------------------- 319s PRIMER> PR3 319s START> 2 319s END> 15 319s GAPS> 1 319s ERROR> 0.083333 319s 319s SEQ8> 319s SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-SEQ> A--TGAAGAAGCCTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 319s PRIMER> PR3 319s START> 3 319s END> 15 319s GAPS> 1 319s ERROR> 0.166667 319s 319s SEQ9> 319s SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-SEQ> ANNTGAAGAAGNNTGGGGCCTCCGTGAAGGTCTCCTGCTCGGCTTCTGGATACGCCTTCACC 319s ALN-PR> ---TGAAGA-GCCTG----------------------------------------------- 319s PRIMER> PR3 319s START> 3 319s END> 15 319s GAPS> 1 319s ERROR> 0.333333 319s 319s SEQ10> 319s SEQ> -------------------------------------------------------------- 319s ALN-SEQ> None 319s ALN-PR> None 319s PRIMER> None 319s START> None 319s END> None 319s GAPS> 0 319s ERROR> 1.000000 319s 319s <- test_localAlignment() 0.028 319s -> test_maskSeq() 319s TEST CUT> 319s ID> SEQ|PRIMER=A|BARCODE=CCA 319s SEQ> AGTAATTAATA 319s 319s TEST MASK> 319s ID> SEQ|PRIMER=A|BARCODE=CCA 319s SEQ> NNNNNNAGTAATTAATA 319s 319s TEST TRIM> 319s ID> SEQ|PRIMER=A|BARCODE=CCA 319s SEQ> CGTTTTAGTAATTAATA 319s 319s TEST TAG> 319s ID> SEQ|PRIMER=A|BARCODE=CCA 319s SEQ> CCACGTTTTAGTAATTAATA 319s 319s <- test_maskSeq() 0.001 319s -> test_scoreAlignment() 319s SEQ1> 319s SEQ> CCACGTTTTAGTAATTAATA 319s ALN-SEQ> CCACGTTTT 319s ALN-PR> -CACGTTTT 319s PRIMER> PR1 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ2> 319s SEQ> CCNCGTTTTAGTAATTAATA 319s ALN-SEQ> CCNCGTTTT 319s ALok 319s test_deleteSeqPositions (tests.test_BuildConsensus.TestBuildConsensus.test_deleteSeqPositions) ... ok 319s test_findGapPositions (tests.test_BuildConsensus.TestBuildConsensus.test_findGapPositions) ... ok 319s test_frequencyConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_frequencyConsensus) ... ok 319s test_qualityConsensus (tests.test_BuildConsensus.TestBuildConsensus.test_qualityConsensus) ... ok 319s test_checkSeqEqual (tests.test_CollapseSeq.TestCollapseSeq.test_checkSeqEqual) ... ok 319s test_convert454Header (tests.test_ConvertHeaders.TestConvertHeaders.test_convert454Header) ... ok 319s test_convertGenbankHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenbankHeader) ... ok 319s test_convertGenericHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertGenericHeader) ... ok 319s test_convertIMGTHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIMGTHeader) ... ok 319s test_convertIlluminaHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertIlluminaHeader) ... ok 319s test_convertSRAHeader (tests.test_ConvertHeaders.TestConvertHeaders.test_convertSRAHeader) ... ok 319s test_calculateDistances (tests.test_EstimateError.TestEstimateError.test_calculateDistances) ... ok 319s test_countMismatches (tests.test_EstimateError.TestEstimateError.test_countMismatches) ... ok 319s test_initializeMismatchDictionary (tests.test_EstimateError.TestEstimateError.test_initializeMismatchDictionary) ... ok 319s test_getFileType (tests.test_IO.TestIO.test_getFileType) ... ok 319s test_extractAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_extractAlignment) ... ok 319s test_localAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_localAlignment) ... ok 319s test_maskSeq (tests.test_MaskPrimers.TestMaskPrimers.test_maskSeq) ... ok 319s test_scoreAlignment (tests.test_MaskPrimers.TestMaskPrimers.test_scoreAlignment) ... ok 319s test_calculateSetError (tests.test_Sequence.TestSequence.test_calculateSetError) ... ok 319s test_filterQuality (tests.test_Sequence.TestSequence.test_filterQuality) ... ok 319s test_meanQuality (tests.test_Sequence.TestSequence.test_meanQuality) ... ok 319s test_scoreDNA (tests.test_Sequence.TestSequence.test_scoreDNA) ... ok 319s test_scoreSeqPair (tests.test_Sequence.TestSequence.test_scoreSeqPair) ... ok 319s test_weightDNA (tests.test_Sequence.TestSequence.test_weightDNA) ... ok 319s test_consensusUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_consensusUnify) ... ok 319s test_deletionUnify (tests.test_UnifyHeaders.TestConvertHeaders.test_deletionUnify) ... ok 319s 319s ---------------------------------------------------------------------- 319s Ran 38 tests in 0.056s 319s 319s OK (skipped=6) 319s N-PR> -CACGTTTT 319s PRIMER> PR1 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.125000 319s 319s SEQ3> 319s SEQ> GGGCGTTTTAGTAATTAATA 319s ALN-SEQ> GGGCGTTTT 319s ALN-PR> -GGCGTTTT 319s PRIMER> PR2 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.000000 319s 319s SEQ4> 319s SEQ> GGNNGTTTTACTAATTAATA 319s ALN-SEQ> GGNNGTTTT 319s ALN-PR> -GGCGTTTT 319s PRIMER> PR2 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.250000 319s 319s SEQ5> 319s SEQ> NNGCNNNNNACTAATTAATA 319s ALN-SEQ> NNGCNNNNN 319s ALN-PR> -GGCGTTTT 319s PRIMER> PR2 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.750000 319s 319s SEQ6> 319s SEQ> GGGATANNNACTAATTAATA 319s ALN-SEQ> GGGATANNN 319s ALN-PR> -GGANATAA 319s PRIMER> PR3 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 0.375000 319s 319s SEQ7> 319s SEQ> NNNNNNNNNNNNNNNNNNNN 319s ALN-SEQ> NNNNNNNNN 319s ALN-PR> -CACGTTTT 319s PRIMER> None 319s START> 1 319s END> 9 319s GAPS> 0 319s ERROR> 1.000000 319s 319s <- test_scoreAlignment() 0.009 319s -> test_calculateSetError() 319s REF> CGGCGTAA 0.4347826086956522 319s REF> NNNNNNNN 1.0 319s <- test_calculateSetError() 0.000 319s -> test_filterQuality() 319s RESULT> True 25 319s RESULT> False 5 319s RESULT> False 0 319s <- test_filterQuality() 0.000 319s -> test_meanQuality() 319s RESULT> 25 [30, 30, 20, 20, 30, 30, 40, 40] 319s RESULT> 5 [30, 30, 0, 0, 30, 30, 20, 20] 319s RESULT> 0 [0, 0, 0, 0, 0, 0, 0, 0] 319s <- test_meanQuality() 0.000 319s -> test_scoreDNA() 319s Default DNA Scores> 319s A==A> 1 319s A==T> 0 319s A==R> 1 319s U==T> 1 319s A==N> 1 319s N==A> 1 319s A==-> 0 319s -==A> 0 319s Symmetric DNA Scores> 319s A==A> 1 319s A==T> 0 319s A==R> 1 319s U==T> 1 319s A==N> 1 319s N==A> 1 319s A==-> 1 319s -==A> 1 319s Asymmetric DNA Scores> 319s A==A> 1 319s A==T> 0 319s A==R> 1 319s U==T> 1 319s A==N> 1 319s N==A> 0 319s A==-> 1 319s -==A> 0 319s <- test_scoreDNA() 0.000 319s -> test_scoreSeqPair() 319s Default DNA Scores> 319s SEQ1> CGGCGTAA 319s SEQ2> CGNNGTAG 319s SCORE> 7 319s WEIGHT> 8 319s ERROR> 0.125000 319s 319s SEQ1> CGGCGTAA 319s SEQ3> CGGC--AA 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ1> CGGCGTAA 319s SEQ4> CGNN--AG 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ1> CGGCGTAA 319s SEQ5> NNNNNNNN 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ6> NNNNNNAA 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ2> CGNNGTAG 319s SEQ3> CGGC--AA 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ2> CGNNGTAG 319s SEQ4> CGNN--AG 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ2> CGNNGTAG 319s SEQ5> NNNNNNNN 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ2> CGNNGTAG 319s SEQ6> NNNNNNAA 319s SCORE> 7 319s WEIGHT> 8 319s ERROR> 0.125000 319s 319s SEQ2> CGNNGTAG 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ2> CGNNGTAG 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ3> CGGC--AA 319s SEQ4> CGNN--AG 319s SCORE> 7 319s WEIGHT> 8 319s ERROR> 0.125000 319s 319s SEQ3> CGGC--AA 319s SEQ5> NNNNNNNN 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ6> NNNNNNAA 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ7> -------- 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ3> CGGC--AA 319s SEQ8> CG------ 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ4> CGNN--AG 319s SEQ5> NNNNNNNN 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ4> CGNN--AG 319s SEQ6> NNNNNNAA 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ4> CGNN--AG 319s SEQ7> -------- 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ4> CGNN--AG 319s SEQ8> CG------ 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ5> NNNNNNNN 319s SEQ6> NNNNNNAA 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ6> NNNNNNAA 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ6> NNNNNNAA 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ7> -------- 319s SEQ8> CG------ 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s Asymmetric DNA Scores> 319s SEQ1> CGGCGTAA 319s SEQ2> CGNNGTAG 319s SCORE> 7 319s WEIGHT> 8 319s ERROR> 0.125000 319s 319s SEQ1> CGGCGTAA 319s SEQ3> CGGC--AA 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ4> CGNN--AG 319s SCORE> 7 319s WEIGHT> 8 319s ERROR> 0.125000 319s 319s SEQ1> CGGCGTAA 319s SEQ5> NNNNNNNN 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ6> NNNNNNAA 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ7> -------- 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ8> CG------ 319s SCORE> 8 319s WEIGHT> 8 319s ERROR> 0.000000 319s 319s SEQ2> CGNNGTAG 319s SEQ3> CGGC--AA 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ2> CGNNGTAG 319s SEQ4> CGNN--AG 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ2> CGNNGTAG 319s SEQ5> NNNNNNNN 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ2> CGNNGTAG 319s SEQ6> NNNNNNAA 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ2> CGNNGTAG 319s SEQ7> -------- 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ2> CGNNGTAG 319s SEQ8> CG------ 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ4> CGNN--AG 319s SCORE> 5 319s WEIGHT> 8 319s ERROR> 0.375000 319s 319s SEQ3> CGGC--AA 319s SEQ5> NNNNNNNN 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ6> NNNNNNAA 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ7> -------- 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ3> CGGC--AA 319s SEQ8> CG------ 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ4> CGNN--AG 319s SEQ5> NNNNNNNN 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ4> CGNN--AG 319s SEQ6> NNNNNNAA 319s SCORE> 3 319s WEIGHT> 8 319s ERROR> 0.625000 319s 319s SEQ4> CGNN--AG 319s SEQ7> -------- 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ4> CGNN--AG 319s SEQ8> CG------ 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ5> NNNNNNNN 319s SEQ6> NNNNNNAA 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ8> CG------ 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ6> NNNNNNAA 319s SEQ7> -------- 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ6> NNNNNNAA 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ7> -------- 319s SEQ8> CG------ 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s Masked DNA Scores> 319s SEQ1> CGGCGTAA 319s SEQ2> CGNNGTAG 319s SCORE> 5 319s WEIGHT> 6 319s ERROR> 0.166667 319s 319s SEQ1> CGGCGTAA 319s SEQ3> CGGC--AA 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s SEQ1> CGGCGTAA 319s SEQ4> CGNN--AG 319s SCORE> 3 319s WEIGHT> 6 319s ERROR> 0.500000 319s 319s SEQ1> CGGCGTAA 319s SEQ5> NNNNNNNN 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ6> NNNNNNAA 319s SCORE> 2 319s WEIGHT> 2 319s ERROR> 0.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 8 319s ERROR> 1.000000 319s 319s SEQ1> CGGCGTAA 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ2> CGNNGTAG 319s SEQ3> CGGC--AA 319s SCORE> 3 319s WEIGHT> 6 319s ERROR> 0.500000 319s 319s SEQ2> CGNNGTAG 319s SEQ4> CGNN--AG 319s SCORE> 4 319s WEIGHT> 6 319s ERROR> 0.333333 319s 319s SEQ2> CGNNGTAG 319s SEQ5> NNNNNNNN 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ2> CGNNGTAG 319s SEQ6> NNNNNNAA 319s SCORE> 1 319s WEIGHT> 2 319s ERROR> 0.500000 319s 319s SEQ2> CGNNGTAG 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 6 319s ERROR> 1.000000 319s 319s SEQ2> CGNNGTAG 319s SEQ8> CG------ 319s SCORE> 2 319s WEIGHT> 6 319s ERROR> 0.666667 319s 319s SEQ3> CGGC--AA 319s SEQ4> CGNN--AG 319s SCORE> 5 319s WEIGHT> 6 319s ERROR> 0.166667 319s 319s SEQ3> CGGC--AA 319s SEQ5> NNNNNNNN 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ3> CGGC--AA 319s SEQ6> NNNNNNAA 319s SCORE> 2 319s WEIGHT> 2 319s ERROR> 0.000000 319s 319s SEQ3> CGGC--AA 319s SEQ7> -------- 319s SCORE> 2 319s WEIGHT> 8 319s ERROR> 0.750000 319s 319s SEQ3> CGGC--AA 319s SEQ8> CG------ 319s SCORE> 4 319s WEIGHT> 8 319s ERROR> 0.500000 319s 319s SEQ4> CGNN--AG 319s SEQ5> NNNNNNNN 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ4> CGNN--AG 319s SEQ6> NNNNNNAA 319s SCORE> 1 319s WEIGHT> 2 319s ERROR> 0.500000 319s 319s SEQ4> CGNN--AG 319s SEQ7> -------- 319s SCORE> 2 319s WEIGHT> 6 319s ERROR> 0.666667 319s 319s SEQ4> CGNN--AG 319s SEQ8> CG------ 319s SCORE> 4 319s WEIGHT> 6 319s ERROR> 0.333333 319s 319s SEQ5> NNNNNNNN 319s SEQ6> NNNNNNAA 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ5> NNNNNNNN 319s SEQ8> CG------ 319s SCORE> 0 319s WEIGHT> 0 319s ERROR> 1.000000 319s 319s SEQ6> NNNNNNAA 319s SEQ7> -------- 319s SCORE> 0 319s WEIGHT> 2 319s ERROR> 1.000000 319s 319s SEQ6> NNNNNNAA 319s SEQ8> CG------ 319s SCORE> 0 319s WEIGHT> 2 319s ERROR> 1.000000 319s 319s SEQ7> -------- 319s SEQ8> CG------ 319s SCORE> 6 319s WEIGHT> 8 319s ERROR> 0.250000 319s 319s <- test_scoreSeqPair() 0.007 319s -> test_weightDNA() 319s DNA Weight> 319s SEQ1> 8 319s SEQ2> 6 319s SEQ3> 8 319s SEQ4> 6 319s SEQ5> 0 319s SEQ6> 2 319s SEQ7> 8 319s SEQ8> 8 319s AA Weight> 319s SEQ1> 8 319s SEQ2> 6 319s SEQ3> 8 319s SEQ4> 6 319s <- test_weightDNA() 0.000 319s -> test_consensusUnify() 319s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> SEQ0|BARCODE=AAAA|SAMPLE=S1 319s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> SEQ1|BARCODE=AAAA|SAMPLE=S1 319s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> SEQ2|BARCODE=AAAA|SAMPLE=S1 319s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> SEQ3|BARCODE=AAAA|SAMPLE=S1 319s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> SEQ4|BARCODE=CCCC|SAMPLE=S1 319s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> SEQ5|BARCODE=CCCC|SAMPLE=S1 319s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> SEQ6|BARCODE=GGGG|SAMPLE=S2 319s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> SEQ7|BARCODE=GGGG|SAMPLE=S2 319s <- test_consensusUnify() 0.000 319s -> test_deletionUnify() 319s ID> SEQ0|BARCODE=AAAA|SAMPLE=S1 -> False 319s ID> SEQ1|BARCODE=AAAA|SAMPLE=S1 -> False 319s ID> SEQ2|BARCODE=AAAA|SAMPLE=S2 -> False 319s ID> SEQ3|BARCODE=AAAA|SAMPLE=S3 -> False 319s ID> SEQ4|BARCODE=CCCC|SAMPLE=S1 -> False 319s ID> SEQ5|BARCODE=CCCC|SAMPLE=S2 -> False 319s ID> SEQ6|BARCODE=GGGG|SAMPLE=S2 -> True 319s ID> SEQ7|BARCODE=GGGG|SAMPLE=S2 -> True 319s <- test_deletionUnify() 0.000 320s autopkgtest [00:19:02]: test pybuild-autopkgtest: -----------------------] 323s autopkgtest [00:19:05]: test pybuild-autopkgtest: - - - - - - - - - - results - - - - - - - - - - 323s pybuild-autopkgtest PASS 327s autopkgtest [00:19:09]: @@@@@@@@@@@@@@@@@@@@ summary 327s pybuild-autopkgtest PASS