0s autopkgtest [19:10:50]: starting date and time: 2024-03-22 19:10:50+0000 0s autopkgtest [19:10:50]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [19:10:50]: host juju-7f2275-prod-proposed-migration-environment-4; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.o6aa730a/out --timeout-copy=6000 --setup-commands 'ln -s /dev/null /etc/systemd/system/bluetooth.service; printf "http_proxy=http://squid.internal:3128\nhttps_proxy=http://squid.internal:3128\nno_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com\n" >> /etc/environment' --apt-pocket=proposed --apt-upgrade ataqv --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ataqv/1.3.1+ds-2build2 boost1.83/1.83.0-2.1ubuntu2 curl/8.5.0-2ubuntu7 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- lxd -r lxd-armhf-10.145.243.213 lxd-armhf-10.145.243.213:autopkgtest/ubuntu/noble/armhf 23s autopkgtest [19:11:13]: testbed dpkg architecture: armhf 25s autopkgtest [19:11:15]: testbed apt version: 2.7.12 25s autopkgtest [19:11:15]: @@@@@@@@@@@@@@@@@@@@ test bed setup 32s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 32s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [58.8 kB] 32s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 32s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [4047 kB] 33s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [498 kB] 33s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main armhf Packages [640 kB] 33s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main armhf c-n-f Metadata [2492 B] 33s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf Packages [1372 B] 33s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted armhf c-n-f Metadata [116 B] 33s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf Packages [4006 kB] 33s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf c-n-f Metadata [7776 B] 33s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf Packages [47.7 kB] 33s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse armhf c-n-f Metadata [116 B] 35s Fetched 9434 kB in 2s (4905 kB/s) 36s Reading package lists... 45s tee: /proc/self/fd/2: Permission denied 67s Hit:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease 67s Hit:2 http://ftpmaster.internal/ubuntu noble InRelease 67s Hit:3 http://ftpmaster.internal/ubuntu noble-updates InRelease 67s Hit:4 http://ftpmaster.internal/ubuntu noble-security InRelease 69s Reading package lists... 69s Reading package lists... 70s Building dependency tree... 70s Reading state information... 71s Calculating upgrade... 72s The following packages were automatically installed and are no longer required: 72s linux-headers-6.8.0-11 python3-lib2to3 72s Use 'apt autoremove' to remove them. 72s The following packages will be REMOVED: 72s libapt-pkg6.0 libarchive13 libatm1 libcurl3-gnutls libcurl4 libdb5.3 libelf1 72s libext2fs2 libgdbm-compat4 libgdbm6 libglib2.0-0 libgnutls30 libgpgme11 72s libhogweed6 libmagic1 libnetplan0 libnettle8 libnpth0 libnvme1 libparted2 72s libpcap0.8 libperl5.38 libpng16-16 libpsl5 libreadline8 libreiserfscore0 72s libssl3 libtirpc3 libuv1 linux-headers-6.8.0-11-generic python3-distutils 72s The following NEW packages will be installed: 72s libapt-pkg6.0t64 libarchive13t64 libatm1t64 libcurl3t64-gnutls libcurl4t64 72s libdb5.3t64 libelf1t64 libext2fs2t64 libgdbm-compat4t64 libgdbm6t64 72s libglib2.0-0t64 libgnutls30t64 libgpgme11t64 libhogweed6t64 libmagic1t64 72s libnetplan1 libnettle8t64 libnpth0t64 libnvme1t64 libparted2t64 72s libpcap0.8t64 libperl5.38t64 libpng16-16t64 libpsl5t64 libreadline8t64 72s libreiserfscore0t64 libssl3t64 libtirpc3t64 libuv1t64 linux-headers-6.8.0-20 72s linux-headers-6.8.0-20-generic xdg-user-dirs 72s The following packages have been kept back: 72s multipath-tools 72s The following packages will be upgraded: 72s apparmor apt apt-utils bind9-dnsutils bind9-host bind9-libs binutils 72s binutils-arm-linux-gnueabihf binutils-common bolt bsdextrautils bsdutils 72s btrfs-progs coreutils cryptsetup-bin curl dbus dbus-bin dbus-daemon 72s dbus-session-bus-common dbus-system-bus-common dbus-user-session dhcpcd-base 72s dirmngr dmsetup dpkg dpkg-dev e2fsprogs e2fsprogs-l10n eject fdisk file ftp 72s fwupd gawk gcc-13-base gcc-14-base gir1.2-girepository-2.0 gir1.2-glib-2.0 72s gnupg gnupg-l10n gnupg-utils gpg gpg-agent gpg-wks-client gpgconf gpgsm gpgv 72s groff-base ibverbs-providers inetutils-telnet info initramfs-tools 72s initramfs-tools-bin initramfs-tools-core install-info iproute2 jq keyboxd 72s kmod kpartx krb5-locales libapparmor1 libaudit-common libaudit1 libbinutils 72s libblkid1 libblockdev-crypto3 libblockdev-fs3 libblockdev-loop3 72s libblockdev-mdraid3 libblockdev-nvme3 libblockdev-part3 libblockdev-swap3 72s libblockdev-utils3 libblockdev3 libbpf1 libbrotli1 libbsd0 libc-bin libc6 72s libcap-ng0 libcom-err2 libcryptsetup12 libctf-nobfd0 libctf0 libdbus-1-3 72s libdebconfclient0 libdevmapper1.02.1 libdpkg-perl libevent-core-2.1-7 72s libexpat1 libfdisk1 libfido2-1 libftdi1-2 libfwupd2 libgcc-s1 72s libgirepository-1.0-1 libglib2.0-data libgssapi-krb5-2 libgudev-1.0-0 72s libgusb2 libibverbs1 libjcat1 libjq1 libjson-glib-1.0-0 72s libjson-glib-1.0-common libk5crypto3 libkmod2 libkrb5-3 libkrb5support0 72s libldap-common libldap2 liblocale-gettext-perl liblzma5 libmagic-mgc 72s libmbim-glib4 libmbim-proxy libmm-glib0 libmount1 libnghttp2-14 libnsl2 72s libnss-systemd libpam-modules libpam-modules-bin libpam-runtime 72s libpam-systemd libpam0g libplymouth5 libpolkit-agent-1-0 72s libpolkit-gobject-1-0 libprotobuf-c1 libpython3-stdlib libpython3.11-minimal 72s libpython3.11-stdlib libpython3.12-minimal libpython3.12-stdlib libqmi-glib5 72s libqmi-proxy libqrtr-glib0 librtmp1 libsasl2-2 libsasl2-modules 72s libsasl2-modules-db libseccomp2 libselinux1 libsemanage-common libsemanage2 72s libsframe1 libslang2 libsmartcols1 libsqlite3-0 libss2 libssh-4 libstdc++6 72s libsystemd-shared libsystemd0 libtext-charwidth-perl libtext-iconv-perl 72s libtirpc-common libudev1 libudisks2-0 libusb-1.0-0 libuuid1 libvolume-key1 72s libxml2 libxmlb2 libxmuu1 linux-headers-generic locales logsave lshw lsof 72s man-db mount mtr-tiny netplan-generator netplan.io openssh-client 72s openssh-server openssh-sftp-server openssl parted perl perl-base 72s perl-modules-5.38 pinentry-curses plymouth plymouth-theme-ubuntu-text psmisc 72s python-apt-common python3 python3-apt python3-cryptography python3-dbus 72s python3-gdbm python3-gi python3-lib2to3 python3-minimal python3-netplan 72s python3-pkg-resources python3-pyrsistent python3-setuptools 72s python3-typing-extensions python3-yaml python3.11 python3.11-minimal 72s python3.12 python3.12-minimal readline-common rsync shared-mime-info sudo 72s systemd systemd-dev systemd-resolved systemd-sysv systemd-timesyncd tcpdump 72s telnet tnftp ubuntu-pro-client ubuntu-pro-client-l10n udev udisks2 usb.ids 72s util-linux uuid-runtime vim-common vim-tiny wget xxd xz-utils zlib1g 72s 234 upgraded, 32 newly installed, 31 to remove and 1 not upgraded. 72s Need to get 106 MB of archives. 72s After this operation, 84.4 MB of additional disk space will be used. 72s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bsdutils armhf 1:2.39.3-9ubuntu2 [102 kB] 72s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-14-base armhf 14-20240315-1ubuntu1 [47.0 kB] 72s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgcc-s1 armhf 14-20240315-1ubuntu1 [41.5 kB] 72s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libstdc++6 armhf 14-20240315-1ubuntu1 [714 kB] 72s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc6 armhf 2.39-0ubuntu6 [2827 kB] 73s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbrotli1 armhf 1.1.0-2build1 [319 kB] 73s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgssapi-krb5-2 armhf 1.20.1-5.1ubuntu1 [119 kB] 73s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkrb5-3 armhf 1.20.1-5.1ubuntu1 [321 kB] 73s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkrb5support0 armhf 1.20.1-5.1ubuntu1 [31.4 kB] 73s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libk5crypto3 armhf 1.20.1-5.1ubuntu1 [78.6 kB] 73s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcom-err2 armhf 1.47.0-2.4~exp1ubuntu2 [21.9 kB] 73s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/main armhf zlib1g armhf 1:1.3.dfsg-3.1ubuntu1 [49.2 kB] 73s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/main armhf librtmp1 armhf 2.4+20151223.gitfa8646d.1-2build6 [51.3 kB] 73s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/main armhf udisks2 armhf 2.10.1-6 [276 kB] 73s Get:15 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libudisks2-0 armhf 2.10.1-6 [143 kB] 73s Get:16 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblkid1 armhf 2.39.3-9ubuntu2 [160 kB] 73s Get:17 http://ftpmaster.internal/ubuntu noble-proposed/main armhf liblzma5 armhf 5.6.0-0.2 [117 kB] 73s Get:18 http://ftpmaster.internal/ubuntu noble-proposed/main armhf kmod armhf 31+20240202-2ubuntu4 [91.8 kB] 73s Get:19 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libkmod2 armhf 31+20240202-2ubuntu4 [44.9 kB] 73s Get:20 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-dev all 255.4-1ubuntu5 [103 kB] 73s Get:21 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-timesyncd armhf 255.4-1ubuntu5 [36.0 kB] 73s Get:22 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-session-bus-common all 1.14.10-4ubuntu2 [80.3 kB] 73s Get:23 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libaudit-common all 1:3.1.2-2.1 [5674 B] 73s Get:24 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcap-ng0 armhf 0.8.4-2build1 [13.5 kB] 73s Get:25 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libaudit1 armhf 1:3.1.2-2.1 [44.3 kB] 73s Get:26 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam0g armhf 1.5.3-5ubuntu3 [62.0 kB] 73s Get:27 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libselinux1 armhf 3.5-2ubuntu1 [70.9 kB] 73s Get:28 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcurl4t64 armhf 8.5.0-2ubuntu7 [296 kB] 73s Get:29 http://ftpmaster.internal/ubuntu noble-proposed/main armhf curl armhf 8.5.0-2ubuntu7 [219 kB] 73s Get:30 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpsl5t64 armhf 0.21.2-1.1 [55.7 kB] 73s Get:31 http://ftpmaster.internal/ubuntu noble-proposed/main armhf wget armhf 1.21.4-1ubuntu2 [317 kB] 73s Get:32 http://ftpmaster.internal/ubuntu noble-proposed/main armhf tnftp armhf 20230507-2build1 [98.6 kB] 73s Get:33 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpcap0.8t64 armhf 1.10.4-4.1ubuntu1 [137 kB] 73s Get:34 http://ftpmaster.internal/ubuntu noble-proposed/main armhf tcpdump armhf 4.99.4-3ubuntu2 [425 kB] 73s Get:35 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsystemd-shared armhf 255.4-1ubuntu5 [2009 kB] 73s Get:36 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-resolved armhf 255.4-1ubuntu5 [289 kB] 73s Get:37 http://ftpmaster.internal/ubuntu noble-proposed/main armhf sudo armhf 1.9.15p5-3ubuntu3 [936 kB] 73s Get:38 http://ftpmaster.internal/ubuntu noble-proposed/main armhf rsync armhf 3.2.7-1build1 [413 kB] 73s Get:39 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-cryptography armhf 41.0.7-4build2 [788 kB] 73s Get:40 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssl armhf 3.0.13-0ubuntu2 [975 kB] 73s Get:41 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-sftp-server armhf 1:9.6p1-3ubuntu11 [35.5 kB] 73s Get:42 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-client armhf 1:9.6p1-3ubuntu11 [890 kB] 73s Get:43 http://ftpmaster.internal/ubuntu noble-proposed/main armhf openssh-server armhf 1:9.6p1-3ubuntu11 [503 kB] 73s Get:44 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-6.8.0-20 all 6.8.0-20.20 [13.6 MB] 74s Get:45 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-6.8.0-20-generic armhf 6.8.0-20.20 [1287 kB] 74s Get:46 http://ftpmaster.internal/ubuntu noble-proposed/main armhf linux-headers-generic armhf 6.8.0-20.20+1 [9610 B] 74s Get:47 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libssl3t64 armhf 3.0.13-0ubuntu2 [1558 kB] 74s Get:48 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnss-systemd armhf 255.4-1ubuntu5 [148 kB] 74s Get:49 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libudev1 armhf 255.4-1ubuntu5 [166 kB] 74s Get:50 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd armhf 255.4-1ubuntu5 [3502 kB] 74s Get:51 http://ftpmaster.internal/ubuntu noble-proposed/main armhf udev armhf 255.4-1ubuntu5 [1852 kB] 74s Get:52 http://ftpmaster.internal/ubuntu noble-proposed/main armhf systemd-sysv armhf 255.4-1ubuntu5 [11.9 kB] 74s Get:53 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-systemd armhf 255.4-1ubuntu5 [216 kB] 74s Get:54 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsystemd0 armhf 255.4-1ubuntu5 [410 kB] 74s Get:55 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-modules-bin armhf 1.5.3-5ubuntu3 [47.0 kB] 74s Get:56 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-modules armhf 1.5.3-5ubuntu3 [261 kB] 74s Get:57 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpam-runtime all 1.5.3-5ubuntu3 [40.8 kB] 74s Get:58 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-user-session armhf 1.14.10-4ubuntu2 [9962 B] 74s Get:59 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libapparmor1 armhf 4.0.0-beta3-0ubuntu2 [45.0 kB] 74s Get:60 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libexpat1 armhf 2.6.1-2 [65.9 kB] 74s Get:61 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-system-bus-common all 1.14.10-4ubuntu2 [81.5 kB] 74s Get:62 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-bin armhf 1.14.10-4ubuntu2 [37.1 kB] 74s Get:63 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus armhf 1.14.10-4ubuntu2 [28.1 kB] 74s Get:64 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dbus-daemon armhf 1.14.10-4ubuntu2 [109 kB] 74s Get:65 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdbus-1-3 armhf 1.14.10-4ubuntu2 [190 kB] 74s Get:66 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmount1 armhf 2.39.3-9ubuntu2 [171 kB] 74s Get:67 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libseccomp2 armhf 2.5.5-1ubuntu2 [49.5 kB] 74s Get:68 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdevmapper1.02.1 armhf 2:1.02.185-3ubuntu2 [135 kB] 74s Get:69 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libuuid1 armhf 2.39.3-9ubuntu2 [34.4 kB] 74s Get:70 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcryptsetup12 armhf 2:2.7.0-1ubuntu2 [238 kB] 74s Get:71 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfdisk1 armhf 2.39.3-9ubuntu2 [196 kB] 74s Get:72 http://ftpmaster.internal/ubuntu noble-proposed/main armhf mount armhf 2.39.3-9ubuntu2 [134 kB] 74s Get:73 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-utils3 armhf 3.1.0-1build1 [16.9 kB] 74s Get:74 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libvolume-key1 armhf 0.3.12-7build1 [38.4 kB] 74s Get:75 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjcat1 armhf 0.2.0-2build2 [30.4 kB] 74s Get:76 http://ftpmaster.internal/ubuntu noble-proposed/main armhf parted armhf 3.6-3.1build2 [39.4 kB] 74s Get:77 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libparted2t64 armhf 3.6-3.1build2 [143 kB] 74s Get:78 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.12 armhf 3.12.2-4build3 [645 kB] 74s Get:79 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.12-minimal armhf 3.12.2-4build3 [1942 kB] 74s Get:80 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.12-stdlib armhf 3.12.2-4build3 [1906 kB] 74s Get:81 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.12-minimal armhf 3.12.2-4build3 [816 kB] 74s Get:82 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-modules-db armhf 2.1.28+dfsg1-5ubuntu1 [19.0 kB] 74s Get:83 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.11 armhf 3.11.8-1build4 [589 kB] 74s Get:84 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3.11-minimal armhf 3.11.8-1build4 [1795 kB] 74s Get:85 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.11-stdlib armhf 3.11.8-1build4 [1810 kB] 74s Get:86 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3.11-minimal armhf 3.11.8-1build4 [826 kB] 75s Get:87 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsqlite3-0 armhf 3.45.1-1ubuntu1 [599 kB] 75s Get:88 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtext-iconv-perl armhf 1.7-8build2 [12.7 kB] 75s Get:89 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtext-charwidth-perl armhf 0.04-11build2 [8962 B] 75s Get:90 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 75s Get:91 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdb5.3t64 armhf 5.3.28+dfsg2-6 [661 kB] 75s Get:92 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-gdbm armhf 3.12.2-3ubuntu2 [17.1 kB] 75s Get:93 http://ftpmaster.internal/ubuntu noble-proposed/main armhf man-db armhf 2.12.0-3build4 [1196 kB] 75s Get:94 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgdbm6t64 armhf 1.23-5.1 [30.3 kB] 75s Get:95 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgdbm-compat4t64 armhf 1.23-5.1 [6208 B] 75s Get:96 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libperl5.38t64 armhf 5.38.2-3.2 [4101 kB] 75s Get:97 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl armhf 5.38.2-3.2 [231 kB] 75s Get:98 http://ftpmaster.internal/ubuntu noble-proposed/main armhf perl-base armhf 5.38.2-3.2 [1671 kB] 75s Get:99 http://ftpmaster.internal/ubuntu noble-proposed/main armhf liblocale-gettext-perl armhf 1.07-6ubuntu3 [15.0 kB] 75s Get:100 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnettle8t64 armhf 3.9.1-2.2 [187 kB] 75s Get:101 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libhogweed6t64 armhf 3.9.1-2.2 [187 kB] 75s Get:102 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgnutls30t64 armhf 3.8.3-1.1ubuntu2 [1046 kB] 75s Get:103 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libldap2 armhf 2.6.7+dfsg-1~exp1ubuntu6 [172 kB] 75s Get:104 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libcurl3t64-gnutls armhf 8.5.0-2ubuntu7 [290 kB] 75s Get:105 http://ftpmaster.internal/ubuntu noble-proposed/main armhf shared-mime-info armhf 2.4-1build1 [470 kB] 75s Get:106 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gir1.2-girepository-2.0 armhf 1.79.1-1ubuntu6 [24.8 kB] 75s Get:107 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gir1.2-glib-2.0 armhf 2.79.3-3ubuntu5 [182 kB] 76s Get:108 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgirepository-1.0-1 armhf 1.79.1-1ubuntu6 [106 kB] 76s Get:109 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-gi armhf 3.47.0-3build1 [219 kB] 76s Get:110 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-dbus armhf 1.3.2-5build2 [94.7 kB] 76s Get:111 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnetplan1 armhf 1.0-1 [113 kB] 76s Get:112 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-netplan armhf 1.0-1 [22.5 kB] 76s Get:113 http://ftpmaster.internal/ubuntu noble-proposed/main armhf netplan-generator armhf 1.0-1 [58.7 kB] 76s Get:114 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools-bin armhf 0.142ubuntu23 [20.3 kB] 76s Get:115 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools-core all 0.142ubuntu23 [50.1 kB] 76s Get:116 http://ftpmaster.internal/ubuntu noble-proposed/main armhf initramfs-tools all 0.142ubuntu23 [9058 B] 76s Get:117 http://ftpmaster.internal/ubuntu noble-proposed/main armhf netplan.io armhf 1.0-1 [64.3 kB] 76s Get:118 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxmlb2 armhf 0.3.15-1build1 [57.0 kB] 76s Get:119 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqrtr-glib0 armhf 1.2.2-1ubuntu3 [15.4 kB] 76s Get:120 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqmi-glib5 armhf 1.35.2-0ubuntu1 [908 kB] 76s Get:121 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libqmi-proxy armhf 1.35.2-0ubuntu1 [5732 B] 76s Get:122 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpolkit-agent-1-0 armhf 124-1ubuntu1 [15.3 kB] 76s Get:123 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpolkit-gobject-1-0 armhf 124-1ubuntu1 [44.1 kB] 76s Get:124 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libglib2.0-0t64 armhf 2.79.3-3ubuntu5 [1414 kB] 76s Get:125 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfwupd2 armhf 1.9.15-1 [123 kB] 76s Get:126 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libarchive13t64 armhf 3.7.2-1.1ubuntu2 [330 kB] 76s Get:127 http://ftpmaster.internal/ubuntu noble-proposed/main armhf fwupd armhf 1.9.15-1 [4349 kB] 76s Get:128 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apt-utils armhf 2.7.13ubuntu1 [210 kB] 76s Get:129 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libapt-pkg6.0t64 armhf 2.7.13ubuntu1 [986 kB] 76s Get:130 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apt armhf 2.7.13ubuntu1 [1367 kB] 76s Get:131 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ubuntu-pro-client-l10n armhf 31.2.1 [19.4 kB] 76s Get:132 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ubuntu-pro-client armhf 31.2.1 [216 kB] 76s Get:133 http://ftpmaster.internal/ubuntu noble-proposed/main armhf keyboxd armhf 2.4.4-2ubuntu15 [111 kB] 76s Get:134 http://ftpmaster.internal/ubuntu noble/main armhf libnpth0t64 armhf 1.6-3.1 [6940 B] 76s Get:135 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgv armhf 2.4.4-2ubuntu15 [224 kB] 76s Get:136 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg armhf 2.4.4-2ubuntu15 [524 kB] 76s Get:137 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg-wks-client armhf 2.4.4-2ubuntu15 [87.4 kB] 76s Get:138 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg-utils armhf 2.4.4-2ubuntu15 [158 kB] 76s Get:139 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpg-agent armhf 2.4.4-2ubuntu15 [235 kB] 76s Get:140 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgsm armhf 2.4.4-2ubuntu15 [241 kB] 76s Get:141 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libreadline8t64 armhf 8.2-3.1build1 [129 kB] 76s Get:142 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gawk armhf 1:5.2.1-2build2 [415 kB] 76s Get:143 http://ftpmaster.internal/ubuntu noble-proposed/main armhf fdisk armhf 2.39.3-9ubuntu2 [135 kB] 76s Get:144 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gpgconf armhf 2.4.4-2ubuntu15 [115 kB] 76s Get:145 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dirmngr armhf 2.4.4-2ubuntu15 [346 kB] 76s Get:146 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg all 2.4.4-2ubuntu15 [359 kB] 76s Get:147 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-apt armhf 2.7.6build1 [162 kB] 76s Get:148 http://ftpmaster.internal/ubuntu noble-proposed/main armhf pinentry-curses armhf 1.2.1-3ubuntu4 [36.7 kB] 76s Get:149 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-yaml armhf 6.0.1-2build1 [117 kB] 76s Get:150 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python-apt-common all 2.7.6build1 [19.8 kB] 76s Get:151 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-setuptools all 68.1.2-2ubuntu1 [396 kB] 76s Get:152 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-pkg-resources all 68.1.2-2ubuntu1 [168 kB] 76s Get:153 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dpkg armhf 1.22.6ubuntu4 [1229 kB] 76s Get:154 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-minimal armhf 3.12.2-0ubuntu1 [27.1 kB] 76s Get:155 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3 armhf 3.12.2-0ubuntu1 [24.1 kB] 76s Get:156 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpython3-stdlib armhf 3.12.2-0ubuntu1 [9802 B] 76s Get:157 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsmartcols1 armhf 2.39.3-9ubuntu2 [117 kB] 76s Get:158 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bsdextrautils armhf 2.39.3-9ubuntu2 [78.7 kB] 76s Get:159 http://ftpmaster.internal/ubuntu noble-proposed/main armhf groff-base armhf 1.23.0-3build1 [946 kB] 76s Get:160 http://ftpmaster.internal/ubuntu noble-proposed/main armhf readline-common all 8.2-3.1build1 [56.5 kB] 76s Get:161 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgpgme11t64 armhf 1.18.0-4.1ubuntu3 [120 kB] 76s Get:162 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-crypto3 armhf 3.1.0-1build1 [20.3 kB] 76s Get:163 http://ftpmaster.internal/ubuntu noble-proposed/main armhf e2fsprogs-l10n all 1.47.0-2.4~exp1ubuntu2 [5996 B] 76s Get:164 http://ftpmaster.internal/ubuntu noble-proposed/main armhf logsave armhf 1.47.0-2.4~exp1ubuntu2 [21.9 kB] 76s Get:165 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dhcpcd-base armhf 1:10.0.6-1ubuntu2 [186 kB] 76s Get:166 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-fs3 armhf 3.1.0-1build1 [34.4 kB] 76s Get:167 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libreiserfscore0t64 armhf 1:3.6.27-7.1 [66.2 kB] 77s Get:168 http://ftpmaster.internal/ubuntu noble-proposed/main armhf btrfs-progs armhf 6.6.3-1.1build1 [852 kB] 77s Get:169 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libext2fs2t64 armhf 1.47.0-2.4~exp1ubuntu2 [201 kB] 77s Get:170 http://ftpmaster.internal/ubuntu noble-proposed/main armhf e2fsprogs armhf 1.47.0-2.4~exp1ubuntu2 [571 kB] 77s Get:171 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-loop3 armhf 3.1.0-1build1 [6502 B] 77s Get:172 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-mdraid3 armhf 3.1.0-1build1 [13.3 kB] 77s Get:173 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-nvme3 armhf 3.1.0-1build1 [17.5 kB] 77s Get:174 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnvme1t64 armhf 1.8-3 [67.5 kB] 77s Get:175 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-part3 armhf 3.1.0-1build1 [16.4 kB] 77s Get:176 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev-swap3 armhf 3.1.0-1build1 [8894 B] 77s Get:177 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libblockdev3 armhf 3.1.0-1build1 [42.9 kB] 77s Get:178 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgudev-1.0-0 armhf 1:238-3ubuntu2 [13.6 kB] 77s Get:179 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxml2 armhf 2.9.14+dfsg-1.3ubuntu2 [595 kB] 77s Get:180 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbpf1 armhf 1:1.3.0-2build1 [146 kB] 77s Get:181 http://ftpmaster.internal/ubuntu noble-proposed/main armhf iproute2 armhf 6.1.0-1ubuntu5 [1060 kB] 77s Get:182 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libelf1t64 armhf 0.190-1.1build2 [49.9 kB] 77s Get:183 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtirpc-common all 1.3.4+ds-1.1 [8018 B] 77s Get:184 http://ftpmaster.internal/ubuntu noble-proposed/main armhf lsof armhf 4.95.0-1build2 [248 kB] 77s Get:185 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnsl2 armhf 1.3.0-3build2 [36.5 kB] 77s Get:186 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libtirpc3t64 armhf 1.3.4+ds-1.1 [73.2 kB] 77s Get:187 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmbim-proxy armhf 1.31.2-0ubuntu2 [5748 B] 77s Get:188 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmbim-glib4 armhf 1.31.2-0ubuntu2 [216 kB] 77s Get:189 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjson-glib-1.0-common all 1.8.0-2build1 [4210 B] 77s Get:190 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjson-glib-1.0-0 armhf 1.8.0-2build1 [61.2 kB] 77s Get:191 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libnghttp2-14 armhf 1.59.0-1build1 [68.1 kB] 77s Get:192 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libssh-4 armhf 0.10.6-2build1 [169 kB] 77s Get:193 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libusb-1.0-0 armhf 2:1.0.27-1 [48.7 kB] 77s Get:194 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libgusb2 armhf 0.4.8-1build1 [34.6 kB] 77s Get:195 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmm-glib0 armhf 1.23.4-0ubuntu1 [214 kB] 77s Get:196 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libprotobuf-c1 armhf 1.4.1-1ubuntu3 [17.7 kB] 77s Get:197 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-2 armhf 2.1.28+dfsg1-5ubuntu1 [49.7 kB] 77s Get:198 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libibverbs1 armhf 50.0-2build1 [57.9 kB] 77s Get:199 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libfido2-1 armhf 1.14.0-1build1 [75.8 kB] 77s Get:200 http://ftpmaster.internal/ubuntu noble-proposed/main armhf coreutils armhf 9.4-3ubuntu3 [1280 kB] 77s Get:201 http://ftpmaster.internal/ubuntu noble-proposed/main armhf util-linux armhf 2.39.3-9ubuntu2 [1216 kB] 77s Get:202 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libc-bin armhf 2.39-0ubuntu6 [530 kB] 77s Get:203 http://ftpmaster.internal/ubuntu noble-proposed/main armhf file armhf 1:5.45-3 [21.1 kB] 77s Get:204 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmagic-mgc armhf 1:5.45-3 [307 kB] 78s Get:205 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libmagic1t64 armhf 1:5.45-3 [81.4 kB] 78s Get:206 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libplymouth5 armhf 24.004.60-1ubuntu6 [140 kB] 78s Get:207 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libpng16-16t64 armhf 1.6.43-3 [166 kB] 78s Get:208 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-host armhf 1:9.18.24-0ubuntu3 [47.4 kB] 78s Get:209 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-dnsutils armhf 1:9.18.24-0ubuntu3 [149 kB] 78s Get:210 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bind9-libs armhf 1:9.18.24-0ubuntu3 [1148 kB] 78s Get:211 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libuv1t64 armhf 1.48.0-1.1 [82.9 kB] 78s Get:212 http://ftpmaster.internal/ubuntu noble-proposed/main armhf uuid-runtime armhf 2.39.3-9ubuntu2 [41.7 kB] 78s Get:213 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdebconfclient0 armhf 0.271ubuntu2 [10.8 kB] 78s Get:214 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsemanage-common all 3.5-1build4 [10.1 kB] 78s Get:215 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsemanage2 armhf 3.5-1build4 [84.5 kB] 78s Get:216 http://ftpmaster.internal/ubuntu noble-proposed/main armhf install-info armhf 7.1-3build1 [60.5 kB] 78s Get:217 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gcc-13-base armhf 13.2.0-19ubuntu1 [47.7 kB] 78s Get:218 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libss2 armhf 1.47.0-2.4~exp1ubuntu2 [14.7 kB] 78s Get:219 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dmsetup armhf 2:1.02.185-3ubuntu2 [81.1 kB] 78s Get:220 http://ftpmaster.internal/ubuntu noble-proposed/main armhf eject armhf 2.39.3-9ubuntu2 [43.2 kB] 78s Get:221 http://ftpmaster.internal/ubuntu noble-proposed/main armhf krb5-locales all 1.20.1-5.1ubuntu1 [13.9 kB] 78s Get:222 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbsd0 armhf 0.12.1-1 [36.6 kB] 78s Get:223 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libglib2.0-data all 2.79.3-3ubuntu5 [46.6 kB] 78s Get:224 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libslang2 armhf 2.3.3-3build1 [478 kB] 78s Get:225 http://ftpmaster.internal/ubuntu noble-proposed/main armhf locales all 2.39-0ubuntu6 [4232 kB] 78s Get:226 http://ftpmaster.internal/ubuntu noble-proposed/main armhf vim-tiny armhf 2:9.1.0016-1ubuntu5 [665 kB] 78s Get:227 http://ftpmaster.internal/ubuntu noble-proposed/main armhf vim-common all 2:9.1.0016-1ubuntu5 [385 kB] 78s Get:228 http://ftpmaster.internal/ubuntu noble/main armhf xdg-user-dirs armhf 0.18-1 [17.3 kB] 78s Get:229 http://ftpmaster.internal/ubuntu noble-proposed/main armhf xxd armhf 2:9.1.0016-1ubuntu5 [62.4 kB] 78s Get:230 http://ftpmaster.internal/ubuntu noble-proposed/main armhf apparmor armhf 4.0.0-beta3-0ubuntu2 [562 kB] 78s Get:231 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ftp all 20230507-2build1 [4724 B] 78s Get:232 http://ftpmaster.internal/ubuntu noble-proposed/main armhf inetutils-telnet armhf 2:2.5-3ubuntu3 [90.7 kB] 78s Get:233 http://ftpmaster.internal/ubuntu noble-proposed/main armhf info armhf 7.1-3build1 [127 kB] 78s Get:234 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libxmuu1 armhf 2:1.1.3-3build1 [8004 B] 78s Get:235 http://ftpmaster.internal/ubuntu noble-proposed/main armhf lshw armhf 02.19.git.2021.06.19.996aaad9c7-2build2 [310 kB] 78s Get:236 http://ftpmaster.internal/ubuntu noble-proposed/main armhf mtr-tiny armhf 0.95-1.1build1 [51.7 kB] 78s Get:237 http://ftpmaster.internal/ubuntu noble-proposed/main armhf plymouth-theme-ubuntu-text armhf 24.004.60-1ubuntu6 [9818 B] 78s Get:238 http://ftpmaster.internal/ubuntu noble-proposed/main armhf plymouth armhf 24.004.60-1ubuntu6 [142 kB] 78s Get:239 http://ftpmaster.internal/ubuntu noble-proposed/main armhf psmisc armhf 23.7-1 [176 kB] 78s Get:240 http://ftpmaster.internal/ubuntu noble-proposed/main armhf telnet all 0.17+2.5-3ubuntu3 [3682 B] 78s Get:241 http://ftpmaster.internal/ubuntu noble-proposed/main armhf usb.ids all 2024.03.18-1 [223 kB] 78s Get:242 http://ftpmaster.internal/ubuntu noble-proposed/main armhf xz-utils armhf 5.6.0-0.2 [271 kB] 78s Get:243 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libctf0 armhf 2.42-4ubuntu1 [87.7 kB] 78s Get:244 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libctf-nobfd0 armhf 2.42-4ubuntu1 [88.0 kB] 78s Get:245 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils-arm-linux-gnueabihf armhf 2.42-4ubuntu1 [2925 kB] 78s Get:246 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libbinutils armhf 2.42-4ubuntu1 [464 kB] 78s Get:247 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils armhf 2.42-4ubuntu1 [3078 B] 78s Get:248 http://ftpmaster.internal/ubuntu noble-proposed/main armhf binutils-common armhf 2.42-4ubuntu1 [217 kB] 78s Get:249 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsframe1 armhf 2.42-4ubuntu1 [13.1 kB] 78s Get:250 http://ftpmaster.internal/ubuntu noble-proposed/main armhf bolt armhf 0.9.6-2build1 [138 kB] 78s Get:251 http://ftpmaster.internal/ubuntu noble-proposed/main armhf cryptsetup-bin armhf 2:2.7.0-1ubuntu2 [214 kB] 78s Get:252 http://ftpmaster.internal/ubuntu noble-proposed/main armhf dpkg-dev all 1.22.6ubuntu4 [1074 kB] 78s Get:253 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libdpkg-perl all 1.22.6ubuntu4 [268 kB] 78s Get:254 http://ftpmaster.internal/ubuntu noble-proposed/main armhf gnupg-l10n all 2.4.4-2ubuntu15 [65.8 kB] 78s Get:255 http://ftpmaster.internal/ubuntu noble-proposed/main armhf ibverbs-providers armhf 50.0-2build1 [27.4 kB] 78s Get:256 http://ftpmaster.internal/ubuntu noble-proposed/main armhf jq armhf 1.7.1-3 [65.2 kB] 78s Get:257 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libjq1 armhf 1.7.1-3 [156 kB] 78s Get:258 http://ftpmaster.internal/ubuntu noble/main armhf libatm1t64 armhf 1:2.5.1-5.1 [20.0 kB] 78s Get:259 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libevent-core-2.1-7 armhf 2.1.12-stable-9build1 [82.3 kB] 78s Get:260 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libftdi1-2 armhf 1.5-6build4 [25.7 kB] 78s Get:261 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libldap-common all 2.6.7+dfsg-1~exp1ubuntu6 [31.3 kB] 78s Get:262 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libsasl2-modules armhf 2.1.28+dfsg1-5ubuntu1 [61.3 kB] 78s Get:263 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-lib2to3 all 3.12.2-3ubuntu2 [79.3 kB] 78s Get:264 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-pyrsistent armhf 0.20.0-1build1 [53.0 kB] 78s Get:265 http://ftpmaster.internal/ubuntu noble-proposed/main armhf python3-typing-extensions all 4.10.0-1 [60.7 kB] 78s Get:266 http://ftpmaster.internal/ubuntu noble-proposed/main armhf kpartx armhf 0.9.4-5ubuntu6 [31.5 kB] 80s Preconfiguring packages ... 81s Fetched 106 MB in 7s (16.1 MB/s) 81s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 81s Preparing to unpack .../bsdutils_1%3a2.39.3-9ubuntu2_armhf.deb ... 81s Unpacking bsdutils (1:2.39.3-9ubuntu2) over (1:2.39.3-6ubuntu2) ... 81s Setting up bsdutils (1:2.39.3-9ubuntu2) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 82s Preparing to unpack .../gcc-14-base_14-20240315-1ubuntu1_armhf.deb ... 82s Unpacking gcc-14-base:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 82s Setting up gcc-14-base:armhf (14-20240315-1ubuntu1) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 82s Preparing to unpack .../libgcc-s1_14-20240315-1ubuntu1_armhf.deb ... 82s Unpacking libgcc-s1:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 82s Setting up libgcc-s1:armhf (14-20240315-1ubuntu1) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 82s Preparing to unpack .../libstdc++6_14-20240315-1ubuntu1_armhf.deb ... 82s Unpacking libstdc++6:armhf (14-20240315-1ubuntu1) over (14-20240303-1ubuntu1) ... 82s Setting up libstdc++6:armhf (14-20240315-1ubuntu1) ... 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 82s Preparing to unpack .../libc6_2.39-0ubuntu6_armhf.deb ... 82s Unpacking libc6:armhf (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 82s Setting up libc6:armhf (2.39-0ubuntu6) ... 83s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 83s Preparing to unpack .../0-libbrotli1_1.1.0-2build1_armhf.deb ... 83s Unpacking libbrotli1:armhf (1.1.0-2build1) over (1.1.0-2) ... 83s Preparing to unpack .../1-libgssapi-krb5-2_1.20.1-5.1ubuntu1_armhf.deb ... 83s Unpacking libgssapi-krb5-2:armhf (1.20.1-5.1ubuntu1) over (1.20.1-5build1) ... 83s Preparing to unpack .../2-libkrb5-3_1.20.1-5.1ubuntu1_armhf.deb ... 83s Unpacking libkrb5-3:armhf (1.20.1-5.1ubuntu1) over (1.20.1-5build1) ... 83s Preparing to unpack .../3-libkrb5support0_1.20.1-5.1ubuntu1_armhf.deb ... 83s Unpacking libkrb5support0:armhf (1.20.1-5.1ubuntu1) over (1.20.1-5build1) ... 83s Preparing to unpack .../4-libk5crypto3_1.20.1-5.1ubuntu1_armhf.deb ... 83s Unpacking libk5crypto3:armhf (1.20.1-5.1ubuntu1) over (1.20.1-5build1) ... 83s Preparing to unpack .../5-libcom-err2_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 83s Unpacking libcom-err2:armhf (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 83s Preparing to unpack .../6-zlib1g_1%3a1.3.dfsg-3.1ubuntu1_armhf.deb ... 83s Unpacking zlib1g:armhf (1:1.3.dfsg-3.1ubuntu1) over (1:1.3.dfsg-3ubuntu1) ... 83s Setting up zlib1g:armhf (1:1.3.dfsg-3.1ubuntu1) ... 84s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 84s Preparing to unpack .../librtmp1_2.4+20151223.gitfa8646d.1-2build6_armhf.deb ... 84s Unpacking librtmp1:armhf (2.4+20151223.gitfa8646d.1-2build6) over (2.4+20151223.gitfa8646d.1-2build4) ... 84s Preparing to unpack .../udisks2_2.10.1-6_armhf.deb ... 84s Unpacking udisks2 (2.10.1-6) over (2.10.1-1ubuntu2) ... 84s Preparing to unpack .../libudisks2-0_2.10.1-6_armhf.deb ... 84s Unpacking libudisks2-0:armhf (2.10.1-6) over (2.10.1-1ubuntu2) ... 84s Preparing to unpack .../libblkid1_2.39.3-9ubuntu2_armhf.deb ... 84s Unpacking libblkid1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 84s Setting up libblkid1:armhf (2.39.3-9ubuntu2) ... 84s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 84s Preparing to unpack .../liblzma5_5.6.0-0.2_armhf.deb ... 84s Unpacking liblzma5:armhf (5.6.0-0.2) over (5.4.5-0.3) ... 84s Setting up liblzma5:armhf (5.6.0-0.2) ... 84s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 84s Preparing to unpack .../0-kmod_31+20240202-2ubuntu4_armhf.deb ... 84s Unpacking kmod (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 84s dpkg: warning: unable to delete old directory '/lib/modprobe.d': Directory not empty 84s Preparing to unpack .../1-libkmod2_31+20240202-2ubuntu4_armhf.deb ... 84s Unpacking libkmod2:armhf (31+20240202-2ubuntu4) over (30+20230601-2ubuntu1) ... 84s Preparing to unpack .../2-systemd-dev_255.4-1ubuntu5_all.deb ... 84s Unpacking systemd-dev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 84s Preparing to unpack .../3-systemd-timesyncd_255.4-1ubuntu5_armhf.deb ... 84s Unpacking systemd-timesyncd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 84s Preparing to unpack .../4-dbus-session-bus-common_1.14.10-4ubuntu2_all.deb ... 84s Unpacking dbus-session-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 84s Preparing to unpack .../5-libaudit-common_1%3a3.1.2-2.1_all.deb ... 84s Unpacking libaudit-common (1:3.1.2-2.1) over (1:3.1.2-2) ... 84s Setting up libaudit-common (1:3.1.2-2.1) ... 84s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58618 files and directories currently installed.) 84s Preparing to unpack .../libcap-ng0_0.8.4-2build1_armhf.deb ... 84s Unpacking libcap-ng0:armhf (0.8.4-2build1) over (0.8.4-2) ... 84s Setting up libcap-ng0:armhf (0.8.4-2build1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58618 files and directories currently installed.) 85s Preparing to unpack .../libaudit1_1%3a3.1.2-2.1_armhf.deb ... 85s Unpacking libaudit1:armhf (1:3.1.2-2.1) over (1:3.1.2-2) ... 85s Setting up libaudit1:armhf (1:3.1.2-2.1) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58618 files and directories currently installed.) 85s Preparing to unpack .../libpam0g_1.5.3-5ubuntu3_armhf.deb ... 85s Unpacking libpam0g:armhf (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 85s Setting up libpam0g:armhf (1.5.3-5ubuntu3) ... 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58618 files and directories currently installed.) 85s Preparing to unpack .../libselinux1_3.5-2ubuntu1_armhf.deb ... 85s Unpacking libselinux1:armhf (3.5-2ubuntu1) over (3.5-2build1) ... 85s Setting up libselinux1:armhf (3.5-2ubuntu1) ... 85s dpkg: libcurl4:armhf: dependency problems, but removing anyway as you requested: 85s curl depends on libcurl4 (= 8.5.0-2ubuntu2). 85s 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58618 files and directories currently installed.) 85s Removing libcurl4:armhf (8.5.0-2ubuntu2) ... 85s Selecting previously unselected package libcurl4t64:armhf. 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58613 files and directories currently installed.) 85s Preparing to unpack .../libcurl4t64_8.5.0-2ubuntu7_armhf.deb ... 85s Unpacking libcurl4t64:armhf (8.5.0-2ubuntu7) ... 85s Preparing to unpack .../curl_8.5.0-2ubuntu7_armhf.deb ... 85s Unpacking curl (8.5.0-2ubuntu7) over (8.5.0-2ubuntu2) ... 85s dpkg: libpsl5:armhf: dependency problems, but removing anyway as you requested: 85s wget depends on libpsl5 (>= 0.16.0). 85s libcurl3-gnutls:armhf depends on libpsl5 (>= 0.16.0). 85s 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58619 files and directories currently installed.) 85s Removing libpsl5:armhf (0.21.2-1build1) ... 85s Selecting previously unselected package libpsl5t64:armhf. 85s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58614 files and directories currently installed.) 85s Preparing to unpack .../libpsl5t64_0.21.2-1.1_armhf.deb ... 85s Unpacking libpsl5t64:armhf (0.21.2-1.1) ... 85s Preparing to unpack .../wget_1.21.4-1ubuntu2_armhf.deb ... 85s Unpacking wget (1.21.4-1ubuntu2) over (1.21.4-1ubuntu1) ... 85s Preparing to unpack .../tnftp_20230507-2build1_armhf.deb ... 85s Unpacking tnftp (20230507-2build1) over (20230507-2) ... 86s dpkg: libpcap0.8:armhf: dependency problems, but removing anyway as you requested: 86s tcpdump depends on libpcap0.8 (>= 1.9.1). 86s 86s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58620 files and directories currently installed.) 86s Removing libpcap0.8:armhf (1.10.4-4ubuntu3) ... 86s Selecting previously unselected package libpcap0.8t64:armhf. 86s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58609 files and directories currently installed.) 86s Preparing to unpack .../00-libpcap0.8t64_1.10.4-4.1ubuntu1_armhf.deb ... 86s Unpacking libpcap0.8t64:armhf (1.10.4-4.1ubuntu1) ... 86s Preparing to unpack .../01-tcpdump_4.99.4-3ubuntu2_armhf.deb ... 86s Unpacking tcpdump (4.99.4-3ubuntu2) over (4.99.4-3ubuntu1) ... 86s Preparing to unpack .../02-libsystemd-shared_255.4-1ubuntu5_armhf.deb ... 86s Unpacking libsystemd-shared:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 86s Preparing to unpack .../03-systemd-resolved_255.4-1ubuntu5_armhf.deb ... 86s Unpacking systemd-resolved (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 86s Preparing to unpack .../04-sudo_1.9.15p5-3ubuntu3_armhf.deb ... 86s Unpacking sudo (1.9.15p5-3ubuntu3) over (1.9.15p5-3ubuntu1) ... 86s Preparing to unpack .../05-rsync_3.2.7-1build1_armhf.deb ... 86s Unpacking rsync (3.2.7-1build1) over (3.2.7-1) ... 86s Preparing to unpack .../06-python3-cryptography_41.0.7-4build2_armhf.deb ... 86s Unpacking python3-cryptography (41.0.7-4build2) over (41.0.7-3) ... 87s Preparing to unpack .../07-openssl_3.0.13-0ubuntu2_armhf.deb ... 87s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 87s Preparing to unpack .../08-openssh-sftp-server_1%3a9.6p1-3ubuntu11_armhf.deb ... 87s Unpacking openssh-sftp-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 87s Preparing to unpack .../09-openssh-client_1%3a9.6p1-3ubuntu11_armhf.deb ... 87s Unpacking openssh-client (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 87s Preparing to unpack .../10-openssh-server_1%3a9.6p1-3ubuntu11_armhf.deb ... 87s Unpacking openssh-server (1:9.6p1-3ubuntu11) over (1:9.6p1-3ubuntu2) ... 87s Selecting previously unselected package linux-headers-6.8.0-20. 87s Preparing to unpack .../11-linux-headers-6.8.0-20_6.8.0-20.20_all.deb ... 87s Unpacking linux-headers-6.8.0-20 (6.8.0-20.20) ... 90s Selecting previously unselected package linux-headers-6.8.0-20-generic. 90s Preparing to unpack .../12-linux-headers-6.8.0-20-generic_6.8.0-20.20_armhf.deb ... 90s Unpacking linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 92s Preparing to unpack .../13-linux-headers-generic_6.8.0-20.20+1_armhf.deb ... 92s Unpacking linux-headers-generic (6.8.0-20.20+1) over (6.8.0-11.11+1) ... 92s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 89772 files and directories currently installed.) 92s Removing linux-headers-6.8.0-11-generic (6.8.0-11.11) ... 93s dpkg: libssl3:armhf: dependency problems, but removing anyway as you requested: 93s systemd depends on libssl3 (>= 3.0.0). 93s libssh-4:armhf depends on libssl3 (>= 3.0.0). 93s libsasl2-modules:armhf depends on libssl3 (>= 3.0.0). 93s libsasl2-2:armhf depends on libssl3 (>= 3.0.0). 93s libpython3.12-minimal:armhf depends on libssl3 (>= 3.0.0). 93s libpython3.11-minimal:armhf depends on libssl3 (>= 3.0.0). 93s libnvme1 depends on libssl3 (>= 3.0.0). 93s libfido2-1:armhf depends on libssl3 (>= 3.0.0). 93s libcryptsetup12:armhf depends on libssl3 (>= 3.0.0). 93s dhcpcd-base depends on libssl3 (>= 3.0.0). 93s bind9-libs:armhf depends on libssl3 (>= 3.0.0). 93s 93s Removing libssl3:armhf (3.0.10-1ubuntu4) ... 93s Selecting previously unselected package libssl3t64:armhf. 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 93s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_armhf.deb ... 93s Unpacking libssl3t64:armhf (3.0.13-0ubuntu2) ... 93s Setting up libssl3t64:armhf (3.0.13-0ubuntu2) ... 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78635 files and directories currently installed.) 93s Preparing to unpack .../libnss-systemd_255.4-1ubuntu5_armhf.deb ... 93s Unpacking libnss-systemd:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 93s Preparing to unpack .../libudev1_255.4-1ubuntu5_armhf.deb ... 93s Unpacking libudev1:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 93s Setting up libudev1:armhf (255.4-1ubuntu5) ... 93s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78635 files and directories currently installed.) 93s Preparing to unpack .../systemd_255.4-1ubuntu5_armhf.deb ... 93s Unpacking systemd (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 94s Preparing to unpack .../udev_255.4-1ubuntu5_armhf.deb ... 94s Unpacking udev (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 94s Preparing to unpack .../libsystemd0_255.4-1ubuntu5_armhf.deb ... 94s Unpacking libsystemd0:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 94s Setting up libsystemd0:armhf (255.4-1ubuntu5) ... 94s Setting up libkmod2:armhf (31+20240202-2ubuntu4) ... 94s Setting up libsystemd-shared:armhf (255.4-1ubuntu5) ... 94s Setting up systemd-dev (255.4-1ubuntu5) ... 94s Setting up systemd (255.4-1ubuntu5) ... 95s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78635 files and directories currently installed.) 95s Preparing to unpack .../systemd-sysv_255.4-1ubuntu5_armhf.deb ... 95s Unpacking systemd-sysv (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 95s Preparing to unpack .../libpam-systemd_255.4-1ubuntu5_armhf.deb ... 95s Unpacking libpam-systemd:armhf (255.4-1ubuntu5) over (255.2-3ubuntu2) ... 95s Preparing to unpack .../libpam-modules-bin_1.5.3-5ubuntu3_armhf.deb ... 95s Unpacking libpam-modules-bin (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 95s Setting up libpam-modules-bin (1.5.3-5ubuntu3) ... 95s pam_namespace.service is a disabled or a static unit not running, not starting it. 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78635 files and directories currently installed.) 96s Preparing to unpack .../libpam-modules_1.5.3-5ubuntu3_armhf.deb ... 96s Unpacking libpam-modules:armhf (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 96s Setting up libpam-modules:armhf (1.5.3-5ubuntu3) ... 96s Installing new version of config file /etc/security/namespace.init ... 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 96s Preparing to unpack .../libpam-runtime_1.5.3-5ubuntu3_all.deb ... 96s Unpacking libpam-runtime (1.5.3-5ubuntu3) over (1.5.2-9.1ubuntu3) ... 96s Setting up libpam-runtime (1.5.3-5ubuntu3) ... 96s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 96s Preparing to unpack .../0-dbus-user-session_1.14.10-4ubuntu2_armhf.deb ... 96s Unpacking dbus-user-session (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 96s Preparing to unpack .../1-libapparmor1_4.0.0-beta3-0ubuntu2_armhf.deb ... 96s Unpacking libapparmor1:armhf (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 96s Preparing to unpack .../2-libexpat1_2.6.1-2_armhf.deb ... 96s Unpacking libexpat1:armhf (2.6.1-2) over (2.6.0-1) ... 96s Preparing to unpack .../3-dbus-system-bus-common_1.14.10-4ubuntu2_all.deb ... 97s Unpacking dbus-system-bus-common (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 97s Preparing to unpack .../4-dbus-bin_1.14.10-4ubuntu2_armhf.deb ... 97s Unpacking dbus-bin (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 97s Preparing to unpack .../5-dbus_1.14.10-4ubuntu2_armhf.deb ... 97s Unpacking dbus (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 97s Preparing to unpack .../6-dbus-daemon_1.14.10-4ubuntu2_armhf.deb ... 97s Unpacking dbus-daemon (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 97s Preparing to unpack .../7-libdbus-1-3_1.14.10-4ubuntu2_armhf.deb ... 97s Unpacking libdbus-1-3:armhf (1.14.10-4ubuntu2) over (1.14.10-4ubuntu1) ... 97s Preparing to unpack .../8-libmount1_2.39.3-9ubuntu2_armhf.deb ... 97s Unpacking libmount1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 97s Setting up libmount1:armhf (2.39.3-9ubuntu2) ... 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 97s Preparing to unpack .../libseccomp2_2.5.5-1ubuntu2_armhf.deb ... 97s Unpacking libseccomp2:armhf (2.5.5-1ubuntu2) over (2.5.5-1ubuntu1) ... 97s Setting up libseccomp2:armhf (2.5.5-1ubuntu2) ... 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 97s Preparing to unpack .../libdevmapper1.02.1_2%3a1.02.185-3ubuntu2_armhf.deb ... 97s Unpacking libdevmapper1.02.1:armhf (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 97s Preparing to unpack .../libuuid1_2.39.3-9ubuntu2_armhf.deb ... 97s Unpacking libuuid1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 97s Setting up libuuid1:armhf (2.39.3-9ubuntu2) ... 97s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 97s Preparing to unpack .../0-libcryptsetup12_2%3a2.7.0-1ubuntu2_armhf.deb ... 97s Unpacking libcryptsetup12:armhf (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 97s Preparing to unpack .../1-libfdisk1_2.39.3-9ubuntu2_armhf.deb ... 97s Unpacking libfdisk1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 97s Preparing to unpack .../2-mount_2.39.3-9ubuntu2_armhf.deb ... 97s Unpacking mount (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 97s Preparing to unpack .../3-libblockdev-utils3_3.1.0-1build1_armhf.deb ... 97s Unpacking libblockdev-utils3:armhf (3.1.0-1build1) over (3.1.0-1) ... 97s Preparing to unpack .../4-libvolume-key1_0.3.12-7build1_armhf.deb ... 97s Unpacking libvolume-key1:armhf (0.3.12-7build1) over (0.3.12-5build2) ... 98s Preparing to unpack .../5-libjcat1_0.2.0-2build2_armhf.deb ... 98s Unpacking libjcat1:armhf (0.2.0-2build2) over (0.2.0-2) ... 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78633 files and directories currently installed.) 98s Removing libgpgme11:armhf (1.18.0-4ubuntu1) ... 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78627 files and directories currently installed.) 98s Preparing to unpack .../parted_3.6-3.1build2_armhf.deb ... 98s Unpacking parted (3.6-3.1build2) over (3.6-3) ... 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78627 files and directories currently installed.) 98s Removing libparted2:armhf (3.6-3) ... 98s Selecting previously unselected package libparted2t64:armhf. 98s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 98s Preparing to unpack .../00-libparted2t64_3.6-3.1build2_armhf.deb ... 98s Unpacking libparted2t64:armhf (3.6-3.1build2) ... 98s Preparing to unpack .../01-python3.12_3.12.2-4build3_armhf.deb ... 98s Unpacking python3.12 (3.12.2-4build3) over (3.12.2-1) ... 98s Preparing to unpack .../02-python3.12-minimal_3.12.2-4build3_armhf.deb ... 98s Unpacking python3.12-minimal (3.12.2-4build3) over (3.12.2-1) ... 98s Preparing to unpack .../03-libpython3.12-stdlib_3.12.2-4build3_armhf.deb ... 98s Unpacking libpython3.12-stdlib:armhf (3.12.2-4build3) over (3.12.2-1) ... 98s Preparing to unpack .../04-libpython3.12-minimal_3.12.2-4build3_armhf.deb ... 99s Unpacking libpython3.12-minimal:armhf (3.12.2-4build3) over (3.12.2-1) ... 99s Preparing to unpack .../05-libsasl2-modules-db_2.1.28+dfsg1-5ubuntu1_armhf.deb ... 99s Unpacking libsasl2-modules-db:armhf (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 99s Preparing to unpack .../06-python3.11_3.11.8-1build4_armhf.deb ... 99s Unpacking python3.11 (3.11.8-1build4) over (3.11.8-1) ... 99s Preparing to unpack .../07-python3.11-minimal_3.11.8-1build4_armhf.deb ... 99s Unpacking python3.11-minimal (3.11.8-1build4) over (3.11.8-1) ... 99s Preparing to unpack .../08-libpython3.11-stdlib_3.11.8-1build4_armhf.deb ... 99s Unpacking libpython3.11-stdlib:armhf (3.11.8-1build4) over (3.11.8-1) ... 99s Preparing to unpack .../09-libpython3.11-minimal_3.11.8-1build4_armhf.deb ... 99s Unpacking libpython3.11-minimal:armhf (3.11.8-1build4) over (3.11.8-1) ... 99s Preparing to unpack .../10-libsqlite3-0_3.45.1-1ubuntu1_armhf.deb ... 99s Unpacking libsqlite3-0:armhf (3.45.1-1ubuntu1) over (3.45.1-1) ... 100s Preparing to unpack .../11-libtext-iconv-perl_1.7-8build2_armhf.deb ... 100s Unpacking libtext-iconv-perl:armhf (1.7-8build2) over (1.7-8build1) ... 100s Preparing to unpack .../12-libtext-charwidth-perl_0.04-11build2_armhf.deb ... 100s Unpacking libtext-charwidth-perl:armhf (0.04-11build2) over (0.04-11build1) ... 100s Preparing to unpack .../13-perl-modules-5.38_5.38.2-3.2_all.deb ... 100s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 100s dpkg: libperl5.38:armhf: dependency problems, but removing anyway as you requested: 100s perl depends on libperl5.38 (= 5.38.2-3). 100s 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78624 files and directories currently installed.) 100s Removing libperl5.38:armhf (5.38.2-3) ... 100s dpkg: libdb5.3:armhf: dependency problems, but removing anyway as you requested: 100s iproute2 depends on libdb5.3. 100s apt-utils depends on libdb5.3. 100s 100s Removing libdb5.3:armhf (5.3.28+dfsg2-4) ... 100s Selecting previously unselected package libdb5.3t64:armhf. 100s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78099 files and directories currently installed.) 100s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-6_armhf.deb ... 100s Unpacking libdb5.3t64:armhf (5.3.28+dfsg2-6) ... 100s Preparing to unpack .../python3-gdbm_3.12.2-3ubuntu2_armhf.deb ... 100s Unpacking python3-gdbm:armhf (3.12.2-3ubuntu2) over (3.11.5-1) ... 101s Preparing to unpack .../man-db_2.12.0-3build4_armhf.deb ... 101s Unpacking man-db (2.12.0-3build4) over (2.12.0-3) ... 101s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78105 files and directories currently installed.) 101s Removing libgdbm-compat4:armhf (1.23-5) ... 101s Removing libgdbm6:armhf (1.23-5) ... 101s Selecting previously unselected package libgdbm6t64:armhf. 101s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78095 files and directories currently installed.) 101s Preparing to unpack .../libgdbm6t64_1.23-5.1_armhf.deb ... 101s Unpacking libgdbm6t64:armhf (1.23-5.1) ... 101s Selecting previously unselected package libgdbm-compat4t64:armhf. 101s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_armhf.deb ... 101s Unpacking libgdbm-compat4t64:armhf (1.23-5.1) ... 101s Selecting previously unselected package libperl5.38t64:armhf. 101s Preparing to unpack .../libperl5.38t64_5.38.2-3.2_armhf.deb ... 101s Unpacking libperl5.38t64:armhf (5.38.2-3.2) ... 101s Preparing to unpack .../perl_5.38.2-3.2_armhf.deb ... 101s Unpacking perl (5.38.2-3.2) over (5.38.2-3) ... 102s Preparing to unpack .../perl-base_5.38.2-3.2_armhf.deb ... 102s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 102s Setting up perl-base (5.38.2-3.2) ... 102s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78626 files and directories currently installed.) 102s Preparing to unpack .../liblocale-gettext-perl_1.07-6ubuntu3_armhf.deb ... 102s Unpacking liblocale-gettext-perl (1.07-6ubuntu3) over (1.07-6build1) ... 102s dpkg: libnettle8:armhf: dependency problems, but removing anyway as you requested: 102s libhogweed6:armhf depends on libnettle8. 102s libgnutls30:armhf depends on libnettle8 (>= 3.9~). 102s libcurl3-gnutls:armhf depends on libnettle8. 102s libarchive13:armhf depends on libnettle8. 102s 102s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78626 files and directories currently installed.) 102s Removing libnettle8:armhf (3.9.1-2) ... 102s Selecting previously unselected package libnettle8t64:armhf. 102s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78619 files and directories currently installed.) 102s Preparing to unpack .../libnettle8t64_3.9.1-2.2_armhf.deb ... 102s Unpacking libnettle8t64:armhf (3.9.1-2.2) ... 102s Setting up libnettle8t64:armhf (3.9.1-2.2) ... 102s dpkg: libhogweed6:armhf: dependency problems, but removing anyway as you requested: 102s libgnutls30:armhf depends on libhogweed6 (>= 3.6). 102s 102s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78627 files and directories currently installed.) 102s Removing libhogweed6:armhf (3.9.1-2) ... 102s Selecting previously unselected package libhogweed6t64:armhf. 102s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 102s Preparing to unpack .../libhogweed6t64_3.9.1-2.2_armhf.deb ... 102s Unpacking libhogweed6t64:armhf (3.9.1-2.2) ... 102s Setting up libhogweed6t64:armhf (3.9.1-2.2) ... 102s dpkg: libgnutls30:armhf: dependency problems, but removing anyway as you requested: 102s libldap2:armhf depends on libgnutls30 (>= 3.8.2). 102s libcurl3-gnutls:armhf depends on libgnutls30 (>= 3.8.2). 102s fwupd depends on libgnutls30 (>= 3.7.3). 102s dirmngr depends on libgnutls30 (>= 3.8.1). 102s apt depends on libgnutls30 (>= 3.8.1). 102s 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78628 files and directories currently installed.) 103s Removing libgnutls30:armhf (3.8.3-1ubuntu1) ... 103s Selecting previously unselected package libgnutls30t64:armhf. 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78619 files and directories currently installed.) 103s Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu2_armhf.deb ... 103s Unpacking libgnutls30t64:armhf (3.8.3-1.1ubuntu2) ... 103s Setting up libgnutls30t64:armhf (3.8.3-1.1ubuntu2) ... 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78647 files and directories currently installed.) 103s Preparing to unpack .../libldap2_2.6.7+dfsg-1~exp1ubuntu6_armhf.deb ... 103s Unpacking libldap2:armhf (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 103s dpkg: libcurl3-gnutls:armhf: dependency problems, but removing anyway as you requested: 103s libfwupd2:armhf depends on libcurl3-gnutls (>= 7.63.0). 103s fwupd depends on libcurl3-gnutls (>= 7.63.0). 103s 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78647 files and directories currently installed.) 103s Removing libcurl3-gnutls:armhf (8.5.0-2ubuntu2) ... 103s Selecting previously unselected package libcurl3t64-gnutls:armhf. 103s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78640 files and directories currently installed.) 103s Preparing to unpack .../00-libcurl3t64-gnutls_8.5.0-2ubuntu7_armhf.deb ... 103s Unpacking libcurl3t64-gnutls:armhf (8.5.0-2ubuntu7) ... 103s Preparing to unpack .../01-shared-mime-info_2.4-1build1_armhf.deb ... 103s Unpacking shared-mime-info (2.4-1build1) over (2.4-1) ... 103s Preparing to unpack .../02-gir1.2-girepository-2.0_1.79.1-1ubuntu6_armhf.deb ... 103s Unpacking gir1.2-girepository-2.0:armhf (1.79.1-1ubuntu6) over (1.79.1-1) ... 103s Preparing to unpack .../03-gir1.2-glib-2.0_2.79.3-3ubuntu5_armhf.deb ... 103s Unpacking gir1.2-glib-2.0:armhf (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 103s Preparing to unpack .../04-libgirepository-1.0-1_1.79.1-1ubuntu6_armhf.deb ... 103s Unpacking libgirepository-1.0-1:armhf (1.79.1-1ubuntu6) over (1.79.1-1) ... 103s Preparing to unpack .../05-python3-gi_3.47.0-3build1_armhf.deb ... 104s Unpacking python3-gi (3.47.0-3build1) over (3.47.0-3) ... 104s Preparing to unpack .../06-python3-dbus_1.3.2-5build2_armhf.deb ... 104s Unpacking python3-dbus (1.3.2-5build2) over (1.3.2-5build1) ... 104s Selecting previously unselected package libnetplan1:armhf. 104s Preparing to unpack .../07-libnetplan1_1.0-1_armhf.deb ... 104s Unpacking libnetplan1:armhf (1.0-1) ... 104s Preparing to unpack .../08-python3-netplan_1.0-1_armhf.deb ... 104s Unpacking python3-netplan (1.0-1) over (0.107.1-3) ... 104s Preparing to unpack .../09-netplan-generator_1.0-1_armhf.deb ... 104s Adding 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 104s Unpacking netplan-generator (1.0-1) over (0.107.1-3) ... 104s Preparing to unpack .../10-initramfs-tools-bin_0.142ubuntu23_armhf.deb ... 104s Unpacking initramfs-tools-bin (0.142ubuntu23) over (0.142ubuntu20) ... 104s Preparing to unpack .../11-initramfs-tools-core_0.142ubuntu23_all.deb ... 104s Unpacking initramfs-tools-core (0.142ubuntu23) over (0.142ubuntu20) ... 104s Preparing to unpack .../12-initramfs-tools_0.142ubuntu23_all.deb ... 104s Unpacking initramfs-tools (0.142ubuntu23) over (0.142ubuntu20) ... 105s Preparing to unpack .../13-netplan.io_1.0-1_armhf.deb ... 105s Unpacking netplan.io (1.0-1) over (0.107.1-3) ... 105s Preparing to unpack .../14-libxmlb2_0.3.15-1build1_armhf.deb ... 105s Unpacking libxmlb2:armhf (0.3.15-1build1) over (0.3.15-1) ... 105s Preparing to unpack .../15-libqrtr-glib0_1.2.2-1ubuntu3_armhf.deb ... 105s Unpacking libqrtr-glib0:armhf (1.2.2-1ubuntu3) over (1.2.2-1ubuntu2) ... 105s Preparing to unpack .../16-libqmi-glib5_1.35.2-0ubuntu1_armhf.deb ... 105s Unpacking libqmi-glib5:armhf (1.35.2-0ubuntu1) over (1.34.0-2) ... 105s Preparing to unpack .../17-libqmi-proxy_1.35.2-0ubuntu1_armhf.deb ... 105s Unpacking libqmi-proxy (1.35.2-0ubuntu1) over (1.34.0-2) ... 105s Preparing to unpack .../18-libpolkit-agent-1-0_124-1ubuntu1_armhf.deb ... 105s Unpacking libpolkit-agent-1-0:armhf (124-1ubuntu1) over (124-1) ... 105s Preparing to unpack .../19-libpolkit-gobject-1-0_124-1ubuntu1_armhf.deb ... 105s Unpacking libpolkit-gobject-1-0:armhf (124-1ubuntu1) over (124-1) ... 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78651 files and directories currently installed.) 105s Removing libnetplan0:armhf (0.107.1-3) ... 105s dpkg: libglib2.0-0:armhf: dependency problems, but removing anyway as you requested: 105s libmm-glib0:armhf depends on libglib2.0-0 (>= 2.62.0). 105s libmbim-proxy depends on libglib2.0-0 (>= 2.56). 105s libmbim-glib4:armhf depends on libglib2.0-0 (>= 2.56). 105s libjson-glib-1.0-0:armhf depends on libglib2.0-0 (>= 2.75.3). 105s libgusb2:armhf depends on libglib2.0-0 (>= 2.75.3). 105s libgudev-1.0-0:armhf depends on libglib2.0-0 (>= 2.38.0). 105s libfwupd2:armhf depends on libglib2.0-0 (>= 2.79.0). 105s libblockdev3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-swap3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-part3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-nvme3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-mdraid3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-loop3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-fs3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s libblockdev-crypto3:armhf depends on libglib2.0-0 (>= 2.42.2). 105s fwupd depends on libglib2.0-0 (>= 2.79.0). 105s bolt depends on libglib2.0-0 (>= 2.56.0). 105s 105s Removing libglib2.0-0:armhf (2.79.2-1~ubuntu1) ... 105s Selecting previously unselected package libglib2.0-0t64:armhf. 105s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78622 files and directories currently installed.) 105s Preparing to unpack .../libglib2.0-0t64_2.79.3-3ubuntu5_armhf.deb ... 105s libglib2.0-0t64.preinst: Removing /var/lib/dpkg/info/libglib2.0-0:armhf.postrm to avoid loss of /usr/share/glib-2.0/schemas/gschemas.compiled... 105s removed '/var/lib/dpkg/info/libglib2.0-0:armhf.postrm' 105s Unpacking libglib2.0-0t64:armhf (2.79.3-3ubuntu5) ... 105s Preparing to unpack .../libfwupd2_1.9.15-1_armhf.deb ... 105s Unpacking libfwupd2:armhf (1.9.15-1) over (1.9.14-1) ... 106s dpkg: libarchive13:armhf: dependency problems, but removing anyway as you requested: 106s fwupd depends on libarchive13 (>= 3.2.1). 106s 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78647 files and directories currently installed.) 106s Removing libarchive13:armhf (3.7.2-1ubuntu2) ... 106s Selecting previously unselected package libarchive13t64:armhf. 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78641 files and directories currently installed.) 106s Preparing to unpack .../libarchive13t64_3.7.2-1.1ubuntu2_armhf.deb ... 106s Unpacking libarchive13t64:armhf (3.7.2-1.1ubuntu2) ... 106s Preparing to unpack .../fwupd_1.9.15-1_armhf.deb ... 106s Unpacking fwupd (1.9.15-1) over (1.9.14-1) ... 106s Preparing to unpack .../apt-utils_2.7.13ubuntu1_armhf.deb ... 106s Unpacking apt-utils (2.7.13ubuntu1) over (2.7.12) ... 106s dpkg: libapt-pkg6.0:armhf: dependency problems, but removing anyway as you requested: 106s ubuntu-pro-client depends on libapt-pkg6.0 (>= 1.9~). 106s python3-apt depends on libapt-pkg6.0 (>= 2.7.11). 106s apt depends on libapt-pkg6.0 (>= 2.7.12). 106s 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78648 files and directories currently installed.) 106s Removing libapt-pkg6.0:armhf (2.7.12) ... 106s Selecting previously unselected package libapt-pkg6.0t64:armhf. 106s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78599 files and directories currently installed.) 106s Preparing to unpack .../libapt-pkg6.0t64_2.7.13ubuntu1_armhf.deb ... 106s Unpacking libapt-pkg6.0t64:armhf (2.7.13ubuntu1) ... 106s Setting up libapt-pkg6.0t64:armhf (2.7.13ubuntu1) ... 107s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78649 files and directories currently installed.) 107s Preparing to unpack .../apt_2.7.13ubuntu1_armhf.deb ... 107s Unpacking apt (2.7.13ubuntu1) over (2.7.12) ... 107s Setting up apt (2.7.13ubuntu1) ... 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78649 files and directories currently installed.) 108s Preparing to unpack .../ubuntu-pro-client-l10n_31.2.1_armhf.deb ... 108s Unpacking ubuntu-pro-client-l10n (31.2.1) over (31.1) ... 108s Preparing to unpack .../ubuntu-pro-client_31.2.1_armhf.deb ... 108s Unpacking ubuntu-pro-client (31.2.1) over (31.1) ... 108s Preparing to unpack .../keyboxd_2.4.4-2ubuntu15_armhf.deb ... 108s Unpacking keyboxd (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 108s dpkg: libnpth0:armhf: dependency problems, but removing anyway as you requested: 108s gpgv depends on libnpth0 (>= 0.90). 108s gpgsm depends on libnpth0 (>= 0.90). 108s gpg-agent depends on libnpth0 (>= 0.90). 108s gpg depends on libnpth0 (>= 0.90). 108s dirmngr depends on libnpth0 (>= 0.90). 108s 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78649 files and directories currently installed.) 108s Removing libnpth0:armhf (1.6-3build2) ... 108s Selecting previously unselected package libnpth0t64:armhf. 108s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78644 files and directories currently installed.) 108s Preparing to unpack .../libnpth0t64_1.6-3.1_armhf.deb ... 108s Unpacking libnpth0t64:armhf (1.6-3.1) ... 109s Setting up libnpth0t64:armhf (1.6-3.1) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 109s Preparing to unpack .../gpgv_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gpgv (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s Setting up gpgv (2.4.4-2ubuntu15) ... 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 109s Preparing to unpack .../gpg_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gpg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s Preparing to unpack .../gpg-wks-client_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gpg-wks-client (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s Preparing to unpack .../gnupg-utils_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gnupg-utils (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s Preparing to unpack .../gpg-agent_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gpg-agent (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s Preparing to unpack .../gpgsm_2.4.4-2ubuntu15_armhf.deb ... 109s Unpacking gpgsm (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 109s dpkg: libreadline8:armhf: dependency problems, but removing anyway as you requested: 109s gpgconf depends on libreadline8 (>= 6.0). 109s gawk depends on libreadline8 (>= 6.0). 109s fdisk depends on libreadline8 (>= 6.0). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78650 files and directories currently installed.) 109s Removing libreadline8:armhf (8.2-3) ... 109s Selecting previously unselected package libreadline8t64:armhf. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78638 files and directories currently installed.) 109s Preparing to unpack .../libreadline8t64_8.2-3.1build1_armhf.deb ... 109s Adding 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8 to /lib/arm-linux-gnueabihf/libhistory.so.8.usr-is-merged by libreadline8t64' 109s Adding 'diversion of /lib/arm-linux-gnueabihf/libhistory.so.8.2 to /lib/arm-linux-gnueabihf/libhistory.so.8.2.usr-is-merged by libreadline8t64' 109s Adding 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8 to /lib/arm-linux-gnueabihf/libreadline.so.8.usr-is-merged by libreadline8t64' 109s Adding 'diversion of /lib/arm-linux-gnueabihf/libreadline.so.8.2 to /lib/arm-linux-gnueabihf/libreadline.so.8.2.usr-is-merged by libreadline8t64' 109s Unpacking libreadline8t64:armhf (8.2-3.1build1) ... 110s Setting up libreadline8t64:armhf (8.2-3.1build1) ... 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78658 files and directories currently installed.) 110s Preparing to unpack .../00-gawk_1%3a5.2.1-2build2_armhf.deb ... 110s Unpacking gawk (1:5.2.1-2build2) over (1:5.2.1-2) ... 110s Preparing to unpack .../01-fdisk_2.39.3-9ubuntu2_armhf.deb ... 110s Unpacking fdisk (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 110s Preparing to unpack .../02-gpgconf_2.4.4-2ubuntu15_armhf.deb ... 110s Unpacking gpgconf (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 110s Preparing to unpack .../03-dirmngr_2.4.4-2ubuntu15_armhf.deb ... 110s Unpacking dirmngr (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 110s Preparing to unpack .../04-gnupg_2.4.4-2ubuntu15_all.deb ... 110s Unpacking gnupg (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 110s Preparing to unpack .../05-python3-apt_2.7.6build1_armhf.deb ... 110s Unpacking python3-apt (2.7.6build1) over (2.7.6) ... 110s Preparing to unpack .../06-pinentry-curses_1.2.1-3ubuntu4_armhf.deb ... 110s Unpacking pinentry-curses (1.2.1-3ubuntu4) over (1.2.1-3ubuntu1) ... 110s Preparing to unpack .../07-python3-yaml_6.0.1-2build1_armhf.deb ... 110s Unpacking python3-yaml (6.0.1-2build1) over (6.0.1-2) ... 111s Preparing to unpack .../08-python-apt-common_2.7.6build1_all.deb ... 111s Unpacking python-apt-common (2.7.6build1) over (2.7.6) ... 111s Preparing to unpack .../09-python3-setuptools_68.1.2-2ubuntu1_all.deb ... 111s Unpacking python3-setuptools (68.1.2-2ubuntu1) over (68.1.2-2) ... 111s Preparing to unpack .../10-python3-pkg-resources_68.1.2-2ubuntu1_all.deb ... 111s Unpacking python3-pkg-resources (68.1.2-2ubuntu1) over (68.1.2-2) ... 112s Preparing to unpack .../11-dpkg_1.22.6ubuntu4_armhf.deb ... 112s Unpacking dpkg (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 112s Setting up dpkg (1.22.6ubuntu4) ... 113s Setting up libpython3.12-minimal:armhf (3.12.2-4build3) ... 113s Setting up libexpat1:armhf (2.6.1-2) ... 113s Setting up python3.12-minimal (3.12.2-4build3) ... 114s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78655 files and directories currently installed.) 114s Preparing to unpack .../python3-minimal_3.12.2-0ubuntu1_armhf.deb ... 114s Unpacking python3-minimal (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 114s Setting up python3-minimal (3.12.2-0ubuntu1) ... 115s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78655 files and directories currently installed.) 115s Preparing to unpack .../python3_3.12.2-0ubuntu1_armhf.deb ... 115s Unpacking python3 (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 115s Preparing to unpack .../libpython3-stdlib_3.12.2-0ubuntu1_armhf.deb ... 115s Unpacking libpython3-stdlib:armhf (3.12.2-0ubuntu1) over (3.12.1-0ubuntu2) ... 115s Preparing to unpack .../libsmartcols1_2.39.3-9ubuntu2_armhf.deb ... 115s Unpacking libsmartcols1:armhf (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 115s Setting up libsmartcols1:armhf (2.39.3-9ubuntu2) ... 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78655 files and directories currently installed.) 116s Preparing to unpack .../0-bsdextrautils_2.39.3-9ubuntu2_armhf.deb ... 116s Unpacking bsdextrautils (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 116s Preparing to unpack .../1-groff-base_1.23.0-3build1_armhf.deb ... 116s Unpacking groff-base (1.23.0-3build1) over (1.23.0-3) ... 116s Preparing to unpack .../2-readline-common_8.2-3.1build1_all.deb ... 116s Unpacking readline-common (8.2-3.1build1) over (8.2-3) ... 116s Selecting previously unselected package libgpgme11t64:armhf. 116s Preparing to unpack .../3-libgpgme11t64_1.18.0-4.1ubuntu3_armhf.deb ... 116s Unpacking libgpgme11t64:armhf (1.18.0-4.1ubuntu3) ... 116s Preparing to unpack .../4-libblockdev-crypto3_3.1.0-1build1_armhf.deb ... 116s Unpacking libblockdev-crypto3:armhf (3.1.0-1build1) over (3.1.0-1) ... 116s Preparing to unpack .../5-e2fsprogs-l10n_1.47.0-2.4~exp1ubuntu2_all.deb ... 116s Unpacking e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 116s Preparing to unpack .../6-logsave_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 116s Unpacking logsave (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 116s Preparing to unpack .../7-dhcpcd-base_1%3a10.0.6-1ubuntu2_armhf.deb ... 116s Unpacking dhcpcd-base (1:10.0.6-1ubuntu2) over (1:10.0.6-1ubuntu1) ... 116s Preparing to unpack .../8-libblockdev-fs3_3.1.0-1build1_armhf.deb ... 116s Unpacking libblockdev-fs3:armhf (3.1.0-1build1) over (3.1.0-1) ... 116s dpkg: libreiserfscore0: dependency problems, but removing anyway as you requested: 116s btrfs-progs depends on libreiserfscore0 (>= 1:3.6.27). 116s 116s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78662 files and directories currently installed.) 116s Removing libreiserfscore0 (1:3.6.27-7) ... 117s Selecting previously unselected package libreiserfscore0t64. 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78657 files and directories currently installed.) 117s Preparing to unpack .../libreiserfscore0t64_1%3a3.6.27-7.1_armhf.deb ... 117s Unpacking libreiserfscore0t64 (1:3.6.27-7.1) ... 117s Preparing to unpack .../btrfs-progs_6.6.3-1.1build1_armhf.deb ... 117s Unpacking btrfs-progs (6.6.3-1.1build1) over (6.6.3-1.1) ... 117s dpkg: libext2fs2:armhf: dependency problems, but removing anyway as you requested: 117s e2fsprogs depends on libext2fs2 (= 1.47.0-2ubuntu1). 117s 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78663 files and directories currently installed.) 117s Removing libext2fs2:armhf (1.47.0-2ubuntu1) ... 117s Selecting previously unselected package libext2fs2t64:armhf. 117s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78656 files and directories currently installed.) 117s Preparing to unpack .../libext2fs2t64_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 117s Adding 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2 to /lib/arm-linux-gnueabihf/libe2p.so.2.usr-is-merged by libext2fs2t64' 117s Adding 'diversion of /lib/arm-linux-gnueabihf/libe2p.so.2.3 to /lib/arm-linux-gnueabihf/libe2p.so.2.3.usr-is-merged by libext2fs2t64' 117s Adding 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2 to /lib/arm-linux-gnueabihf/libext2fs.so.2.usr-is-merged by libext2fs2t64' 117s Adding 'diversion of /lib/arm-linux-gnueabihf/libext2fs.so.2.4 to /lib/arm-linux-gnueabihf/libext2fs.so.2.4.usr-is-merged by libext2fs2t64' 117s Unpacking libext2fs2t64:armhf (1.47.0-2.4~exp1ubuntu2) ... 117s Setting up libcom-err2:armhf (1.47.0-2.4~exp1ubuntu2) ... 117s Setting up libext2fs2t64:armhf (1.47.0-2.4~exp1ubuntu2) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78672 files and directories currently installed.) 118s Preparing to unpack .../e2fsprogs_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 118s Unpacking e2fsprogs (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 118s Preparing to unpack .../libblockdev-loop3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev-loop3:armhf (3.1.0-1build1) over (3.1.0-1) ... 118s Preparing to unpack .../libblockdev-mdraid3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev-mdraid3:armhf (3.1.0-1build1) over (3.1.0-1) ... 118s Preparing to unpack .../libblockdev-nvme3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev-nvme3:armhf (3.1.0-1build1) over (3.1.0-1) ... 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78672 files and directories currently installed.) 118s Removing libnvme1 (1.8-2) ... 118s Selecting previously unselected package libnvme1t64. 118s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78665 files and directories currently installed.) 118s Preparing to unpack .../0-libnvme1t64_1.8-3_armhf.deb ... 118s Unpacking libnvme1t64 (1.8-3) ... 118s Preparing to unpack .../1-libblockdev-part3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev-part3:armhf (3.1.0-1build1) over (3.1.0-1) ... 118s Preparing to unpack .../2-libblockdev-swap3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev-swap3:armhf (3.1.0-1build1) over (3.1.0-1) ... 118s Preparing to unpack .../3-libblockdev3_3.1.0-1build1_armhf.deb ... 118s Unpacking libblockdev3:armhf (3.1.0-1build1) over (3.1.0-1) ... 119s Preparing to unpack .../4-libgudev-1.0-0_1%3a238-3ubuntu2_armhf.deb ... 119s Unpacking libgudev-1.0-0:armhf (1:238-3ubuntu2) over (1:238-3) ... 119s Preparing to unpack .../5-libxml2_2.9.14+dfsg-1.3ubuntu2_armhf.deb ... 119s Unpacking libxml2:armhf (2.9.14+dfsg-1.3ubuntu2) over (2.9.14+dfsg-1.3ubuntu1) ... 119s Preparing to unpack .../6-libbpf1_1%3a1.3.0-2build1_armhf.deb ... 119s Unpacking libbpf1:armhf (1:1.3.0-2build1) over (1:1.3.0-2) ... 119s Preparing to unpack .../7-iproute2_6.1.0-1ubuntu5_armhf.deb ... 119s Unpacking iproute2 (6.1.0-1ubuntu5) over (6.1.0-1ubuntu2) ... 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 119s Removing libelf1:armhf (0.190-1) ... 119s Selecting previously unselected package libelf1t64:armhf. 119s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78668 files and directories currently installed.) 119s Preparing to unpack .../libelf1t64_0.190-1.1build2_armhf.deb ... 119s Unpacking libelf1t64:armhf (0.190-1.1build2) ... 119s Preparing to unpack .../libtirpc-common_1.3.4+ds-1.1_all.deb ... 119s Unpacking libtirpc-common (1.3.4+ds-1.1) over (1.3.4+ds-1build1) ... 119s Preparing to unpack .../lsof_4.95.0-1build2_armhf.deb ... 119s Unpacking lsof (4.95.0-1build2) over (4.95.0-1build1) ... 120s Preparing to unpack .../libnsl2_1.3.0-3build2_armhf.deb ... 120s Unpacking libnsl2:armhf (1.3.0-3build2) over (1.3.0-3) ... 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 120s Removing libtirpc3:armhf (1.3.4+ds-1build1) ... 120s Selecting previously unselected package libtirpc3t64:armhf. 120s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78667 files and directories currently installed.) 120s Preparing to unpack .../00-libtirpc3t64_1.3.4+ds-1.1_armhf.deb ... 120s Adding 'diversion of /lib/arm-linux-gnueabihf/libtirpc.so.3 to /lib/arm-linux-gnueabihf/libtirpc.so.3.usr-is-merged by libtirpc3t64' 120s Adding 'diversion of /lib/arm-linux-gnueabihf/libtirpc.so.3.0.0 to /lib/arm-linux-gnueabihf/libtirpc.so.3.0.0.usr-is-merged by libtirpc3t64' 120s Unpacking libtirpc3t64:armhf (1.3.4+ds-1.1) ... 120s Preparing to unpack .../01-libmbim-proxy_1.31.2-0ubuntu2_armhf.deb ... 120s Unpacking libmbim-proxy (1.31.2-0ubuntu2) over (1.30.0-1) ... 120s Preparing to unpack .../02-libmbim-glib4_1.31.2-0ubuntu2_armhf.deb ... 120s Unpacking libmbim-glib4:armhf (1.31.2-0ubuntu2) over (1.30.0-1) ... 120s Preparing to unpack .../03-libjson-glib-1.0-common_1.8.0-2build1_all.deb ... 120s Unpacking libjson-glib-1.0-common (1.8.0-2build1) over (1.8.0-2) ... 121s Preparing to unpack .../04-libjson-glib-1.0-0_1.8.0-2build1_armhf.deb ... 121s Unpacking libjson-glib-1.0-0:armhf (1.8.0-2build1) over (1.8.0-2) ... 121s Preparing to unpack .../05-libnghttp2-14_1.59.0-1build1_armhf.deb ... 121s Unpacking libnghttp2-14:armhf (1.59.0-1build1) over (1.59.0-1) ... 121s Preparing to unpack .../06-libssh-4_0.10.6-2build1_armhf.deb ... 121s Unpacking libssh-4:armhf (0.10.6-2build1) over (0.10.6-2) ... 121s Preparing to unpack .../07-libusb-1.0-0_2%3a1.0.27-1_armhf.deb ... 121s Unpacking libusb-1.0-0:armhf (2:1.0.27-1) over (2:1.0.26-1) ... 121s Preparing to unpack .../08-libgusb2_0.4.8-1build1_armhf.deb ... 121s Unpacking libgusb2:armhf (0.4.8-1build1) over (0.4.8-1) ... 121s Preparing to unpack .../09-libmm-glib0_1.23.4-0ubuntu1_armhf.deb ... 121s Unpacking libmm-glib0:armhf (1.23.4-0ubuntu1) over (1.22.0-3) ... 122s Preparing to unpack .../10-libprotobuf-c1_1.4.1-1ubuntu3_armhf.deb ... 122s Unpacking libprotobuf-c1:armhf (1.4.1-1ubuntu3) over (1.4.1-1ubuntu2) ... 123s Preparing to unpack .../11-libsasl2-2_2.1.28+dfsg1-5ubuntu1_armhf.deb ... 123s Unpacking libsasl2-2:armhf (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 123s Preparing to unpack .../12-libibverbs1_50.0-2build1_armhf.deb ... 123s Unpacking libibverbs1:armhf (50.0-2build1) over (50.0-2) ... 123s Preparing to unpack .../13-libfido2-1_1.14.0-1build1_armhf.deb ... 123s Unpacking libfido2-1:armhf (1.14.0-1build1) over (1.14.0-1) ... 123s Preparing to unpack .../14-coreutils_9.4-3ubuntu3_armhf.deb ... 123s Unpacking coreutils (9.4-3ubuntu3) over (9.4-2ubuntu4) ... 123s Setting up coreutils (9.4-3ubuntu3) ... 123s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78678 files and directories currently installed.) 123s Preparing to unpack .../util-linux_2.39.3-9ubuntu2_armhf.deb ... 123s Unpacking util-linux (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 124s Setting up util-linux (2.39.3-9ubuntu2) ... 125s fstrim.service is a disabled or a static unit not running, not starting it. 126s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78678 files and directories currently installed.) 126s Preparing to unpack .../libc-bin_2.39-0ubuntu6_armhf.deb ... 126s Unpacking libc-bin (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 126s Setting up libc-bin (2.39-0ubuntu6) ... 127s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78678 files and directories currently installed.) 127s Removing libatm1:armhf (1:2.5.1-5) ... 127s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 127s Preparing to unpack .../file_1%3a5.45-3_armhf.deb ... 128s Unpacking file (1:5.45-3) over (1:5.45-2) ... 128s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78673 files and directories currently installed.) 128s Removing libmagic1:armhf (1:5.45-2) ... 128s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78663 files and directories currently installed.) 128s Preparing to unpack .../libmagic-mgc_1%3a5.45-3_armhf.deb ... 128s Unpacking libmagic-mgc (1:5.45-3) over (1:5.45-2) ... 128s Selecting previously unselected package libmagic1t64:armhf. 128s Preparing to unpack .../libmagic1t64_1%3a5.45-3_armhf.deb ... 128s Unpacking libmagic1t64:armhf (1:5.45-3) ... 129s Preparing to unpack .../libplymouth5_24.004.60-1ubuntu6_armhf.deb ... 129s Unpacking libplymouth5:armhf (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 129s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78674 files and directories currently installed.) 129s Removing libpng16-16:armhf (1.6.43-1) ... 129s Selecting previously unselected package libpng16-16t64:armhf. 130s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78664 files and directories currently installed.) 130s Preparing to unpack .../libpng16-16t64_1.6.43-3_armhf.deb ... 130s Unpacking libpng16-16t64:armhf (1.6.43-3) ... 130s Preparing to unpack .../bind9-host_1%3a9.18.24-0ubuntu3_armhf.deb ... 130s Unpacking bind9-host (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 131s Preparing to unpack .../bind9-dnsutils_1%3a9.18.24-0ubuntu3_armhf.deb ... 131s Unpacking bind9-dnsutils (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 131s Preparing to unpack .../bind9-libs_1%3a9.18.24-0ubuntu3_armhf.deb ... 131s Unpacking bind9-libs:armhf (1:9.18.24-0ubuntu3) over (1:9.18.21-0ubuntu1) ... 132s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78675 files and directories currently installed.) 132s Removing libuv1:armhf (1.48.0-1) ... 132s Selecting previously unselected package libuv1t64:armhf. 132s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78670 files and directories currently installed.) 132s Preparing to unpack .../libuv1t64_1.48.0-1.1_armhf.deb ... 132s Unpacking libuv1t64:armhf (1.48.0-1.1) ... 133s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78676 files and directories currently installed.) 133s Removing python3-distutils (3.11.5-1) ... 134s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 134s Preparing to unpack .../uuid-runtime_2.39.3-9ubuntu2_armhf.deb ... 134s Unpacking uuid-runtime (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 134s Preparing to unpack .../libdebconfclient0_0.271ubuntu2_armhf.deb ... 134s Unpacking libdebconfclient0:armhf (0.271ubuntu2) over (0.271ubuntu1) ... 134s Setting up libdebconfclient0:armhf (0.271ubuntu2) ... 134s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 134s Preparing to unpack .../libsemanage-common_3.5-1build4_all.deb ... 134s Unpacking libsemanage-common (3.5-1build4) over (3.5-1build2) ... 134s Setting up libsemanage-common (3.5-1build4) ... 135s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 135s Preparing to unpack .../libsemanage2_3.5-1build4_armhf.deb ... 135s Unpacking libsemanage2:armhf (3.5-1build4) over (3.5-1build2) ... 135s Setting up libsemanage2:armhf (3.5-1build4) ... 135s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 135s Preparing to unpack .../install-info_7.1-3build1_armhf.deb ... 135s Unpacking install-info (7.1-3build1) over (7.1-3) ... 135s Setting up install-info (7.1-3build1) ... 136s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78621 files and directories currently installed.) 136s Preparing to unpack .../00-gcc-13-base_13.2.0-19ubuntu1_armhf.deb ... 136s Unpacking gcc-13-base:armhf (13.2.0-19ubuntu1) over (13.2.0-17ubuntu2) ... 136s Preparing to unpack .../01-libss2_1.47.0-2.4~exp1ubuntu2_armhf.deb ... 136s Unpacking libss2:armhf (1.47.0-2.4~exp1ubuntu2) over (1.47.0-2ubuntu1) ... 136s Preparing to unpack .../02-dmsetup_2%3a1.02.185-3ubuntu2_armhf.deb ... 136s Unpacking dmsetup (2:1.02.185-3ubuntu2) over (2:1.02.185-3ubuntu1) ... 136s Preparing to unpack .../03-eject_2.39.3-9ubuntu2_armhf.deb ... 136s Unpacking eject (2.39.3-9ubuntu2) over (2.39.3-6ubuntu2) ... 136s Preparing to unpack .../04-krb5-locales_1.20.1-5.1ubuntu1_all.deb ... 136s Unpacking krb5-locales (1.20.1-5.1ubuntu1) over (1.20.1-5build1) ... 136s Preparing to unpack .../05-libbsd0_0.12.1-1_armhf.deb ... 136s Unpacking libbsd0:armhf (0.12.1-1) over (0.11.8-1) ... 136s Preparing to unpack .../06-libglib2.0-data_2.79.3-3ubuntu5_all.deb ... 136s Unpacking libglib2.0-data (2.79.3-3ubuntu5) over (2.79.2-1~ubuntu1) ... 136s Preparing to unpack .../07-libslang2_2.3.3-3build1_armhf.deb ... 136s Unpacking libslang2:armhf (2.3.3-3build1) over (2.3.3-3) ... 136s Preparing to unpack .../08-locales_2.39-0ubuntu6_all.deb ... 136s Unpacking locales (2.39-0ubuntu6) over (2.39-0ubuntu2) ... 137s Preparing to unpack .../09-vim-tiny_2%3a9.1.0016-1ubuntu5_armhf.deb ... 137s Unpacking vim-tiny (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 137s Preparing to unpack .../10-vim-common_2%3a9.1.0016-1ubuntu5_all.deb ... 137s Unpacking vim-common (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 137s Selecting previously unselected package xdg-user-dirs. 137s Preparing to unpack .../11-xdg-user-dirs_0.18-1_armhf.deb ... 137s Unpacking xdg-user-dirs (0.18-1) ... 137s Preparing to unpack .../12-xxd_2%3a9.1.0016-1ubuntu5_armhf.deb ... 137s Unpacking xxd (2:9.1.0016-1ubuntu5) over (2:9.1.0016-1ubuntu2) ... 137s Preparing to unpack .../13-apparmor_4.0.0-beta3-0ubuntu2_armhf.deb ... 138s Unpacking apparmor (4.0.0-beta3-0ubuntu2) over (4.0.0~alpha4-0ubuntu1) ... 139s Preparing to unpack .../14-ftp_20230507-2build1_all.deb ... 139s Unpacking ftp (20230507-2build1) over (20230507-2) ... 139s Preparing to unpack .../15-inetutils-telnet_2%3a2.5-3ubuntu3_armhf.deb ... 139s Unpacking inetutils-telnet (2:2.5-3ubuntu3) over (2:2.5-3ubuntu1) ... 140s Preparing to unpack .../16-info_7.1-3build1_armhf.deb ... 140s Unpacking info (7.1-3build1) over (7.1-3) ... 140s Preparing to unpack .../17-libxmuu1_2%3a1.1.3-3build1_armhf.deb ... 140s Unpacking libxmuu1:armhf (2:1.1.3-3build1) over (2:1.1.3-3) ... 140s Preparing to unpack .../18-lshw_02.19.git.2021.06.19.996aaad9c7-2build2_armhf.deb ... 140s Unpacking lshw (02.19.git.2021.06.19.996aaad9c7-2build2) over (02.19.git.2021.06.19.996aaad9c7-2build1) ... 140s Preparing to unpack .../19-mtr-tiny_0.95-1.1build1_armhf.deb ... 140s Unpacking mtr-tiny (0.95-1.1build1) over (0.95-1.1) ... 140s Preparing to unpack .../20-plymouth-theme-ubuntu-text_24.004.60-1ubuntu6_armhf.deb ... 140s Unpacking plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 140s Preparing to unpack .../21-plymouth_24.004.60-1ubuntu6_armhf.deb ... 141s Unpacking plymouth (24.004.60-1ubuntu6) over (24.004.60-1ubuntu3) ... 141s Preparing to unpack .../22-psmisc_23.7-1_armhf.deb ... 141s Unpacking psmisc (23.7-1) over (23.6-2) ... 141s Preparing to unpack .../23-telnet_0.17+2.5-3ubuntu3_all.deb ... 141s Unpacking telnet (0.17+2.5-3ubuntu3) over (0.17+2.5-3ubuntu1) ... 141s Preparing to unpack .../24-usb.ids_2024.03.18-1_all.deb ... 141s Unpacking usb.ids (2024.03.18-1) over (2024.01.30-1) ... 141s Preparing to unpack .../25-xz-utils_5.6.0-0.2_armhf.deb ... 141s Unpacking xz-utils (5.6.0-0.2) over (5.4.5-0.3) ... 141s Preparing to unpack .../26-libctf0_2.42-4ubuntu1_armhf.deb ... 141s Unpacking libctf0:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 141s Preparing to unpack .../27-libctf-nobfd0_2.42-4ubuntu1_armhf.deb ... 141s Unpacking libctf-nobfd0:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 141s Preparing to unpack .../28-binutils-arm-linux-gnueabihf_2.42-4ubuntu1_armhf.deb ... 141s Unpacking binutils-arm-linux-gnueabihf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 141s Preparing to unpack .../29-libbinutils_2.42-4ubuntu1_armhf.deb ... 141s Unpacking libbinutils:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 141s Preparing to unpack .../30-binutils_2.42-4ubuntu1_armhf.deb ... 141s Unpacking binutils (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 142s Preparing to unpack .../31-binutils-common_2.42-4ubuntu1_armhf.deb ... 142s Unpacking binutils-common:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 142s Preparing to unpack .../32-libsframe1_2.42-4ubuntu1_armhf.deb ... 142s Unpacking libsframe1:armhf (2.42-4ubuntu1) over (2.42-3ubuntu1) ... 142s Preparing to unpack .../33-bolt_0.9.6-2build1_armhf.deb ... 142s Unpacking bolt (0.9.6-2build1) over (0.9.6-2) ... 142s Preparing to unpack .../34-cryptsetup-bin_2%3a2.7.0-1ubuntu2_armhf.deb ... 142s Unpacking cryptsetup-bin (2:2.7.0-1ubuntu2) over (2:2.7.0-1ubuntu1) ... 142s Preparing to unpack .../35-dpkg-dev_1.22.6ubuntu4_all.deb ... 142s Unpacking dpkg-dev (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 142s Preparing to unpack .../36-libdpkg-perl_1.22.6ubuntu4_all.deb ... 142s Unpacking libdpkg-perl (1.22.6ubuntu4) over (1.22.4ubuntu5) ... 142s Preparing to unpack .../37-gnupg-l10n_2.4.4-2ubuntu15_all.deb ... 142s Unpacking gnupg-l10n (2.4.4-2ubuntu15) over (2.4.4-2ubuntu7) ... 143s Preparing to unpack .../38-ibverbs-providers_50.0-2build1_armhf.deb ... 143s Unpacking ibverbs-providers:armhf (50.0-2build1) over (50.0-2) ... 143s Preparing to unpack .../39-jq_1.7.1-3_armhf.deb ... 143s Unpacking jq (1.7.1-3) over (1.7.1-2) ... 143s Preparing to unpack .../40-libjq1_1.7.1-3_armhf.deb ... 143s Unpacking libjq1:armhf (1.7.1-3) over (1.7.1-2) ... 143s Selecting previously unselected package libatm1t64:armhf. 143s Preparing to unpack .../41-libatm1t64_1%3a2.5.1-5.1_armhf.deb ... 143s Unpacking libatm1t64:armhf (1:2.5.1-5.1) ... 143s Preparing to unpack .../42-libevent-core-2.1-7_2.1.12-stable-9build1_armhf.deb ... 143s Unpacking libevent-core-2.1-7:armhf (2.1.12-stable-9build1) over (2.1.12-stable-9) ... 143s Preparing to unpack .../43-libftdi1-2_1.5-6build4_armhf.deb ... 143s Unpacking libftdi1-2:armhf (1.5-6build4) over (1.5-6build3) ... 143s Preparing to unpack .../44-libldap-common_2.6.7+dfsg-1~exp1ubuntu6_all.deb ... 143s Unpacking libldap-common (2.6.7+dfsg-1~exp1ubuntu6) over (2.6.7+dfsg-1~exp1ubuntu1) ... 143s Preparing to unpack .../45-libsasl2-modules_2.1.28+dfsg1-5ubuntu1_armhf.deb ... 144s Unpacking libsasl2-modules:armhf (2.1.28+dfsg1-5ubuntu1) over (2.1.28+dfsg1-4) ... 144s Preparing to unpack .../46-python3-lib2to3_3.12.2-3ubuntu2_all.deb ... 144s Unpacking python3-lib2to3 (3.12.2-3ubuntu2) over (3.11.5-1) ... 144s Preparing to unpack .../47-python3-pyrsistent_0.20.0-1build1_armhf.deb ... 144s Unpacking python3-pyrsistent:armhf (0.20.0-1build1) over (0.20.0-1) ... 145s Preparing to unpack .../48-python3-typing-extensions_4.10.0-1_all.deb ... 145s Unpacking python3-typing-extensions (4.10.0-1) over (4.9.0-1) ... 145s Preparing to unpack .../49-kpartx_0.9.4-5ubuntu6_armhf.deb ... 145s Unpacking kpartx (0.9.4-5ubuntu6) over (0.9.4-5ubuntu3) ... 145s Setting up pinentry-curses (1.2.1-3ubuntu4) ... 145s Setting up libtext-iconv-perl:armhf (1.7-8build2) ... 145s Setting up libtext-charwidth-perl:armhf (0.04-11build2) ... 145s Setting up libibverbs1:armhf (50.0-2build1) ... 145s Setting up systemd-sysv (255.4-1ubuntu5) ... 145s Setting up libapparmor1:armhf (4.0.0-beta3-0ubuntu2) ... 145s Setting up libatm1t64:armhf (1:2.5.1-5.1) ... 145s Setting up libgdbm6t64:armhf (1.23-5.1) ... 145s Setting up bsdextrautils (2.39.3-9ubuntu2) ... 145s Setting up libgdbm-compat4t64:armhf (1.23-5.1) ... 145s Setting up xdg-user-dirs (0.18-1) ... 145s Setting up ibverbs-providers:armhf (50.0-2build1) ... 145s Setting up linux-headers-6.8.0-20 (6.8.0-20.20) ... 145s Setting up libmagic-mgc (1:5.45-3) ... 145s Setting up gawk (1:5.2.1-2build2) ... 145s Setting up psmisc (23.7-1) ... 145s Setting up libjq1:armhf (1.7.1-3) ... 145s Setting up libtirpc-common (1.3.4+ds-1.1) ... 145s Setting up libbrotli1:armhf (1.1.0-2build1) ... 145s Setting up libsqlite3-0:armhf (3.45.1-1ubuntu1) ... 145s Setting up libsasl2-modules:armhf (2.1.28+dfsg1-5ubuntu1) ... 145s Setting up libuv1t64:armhf (1.48.0-1.1) ... 145s Setting up libmagic1t64:armhf (1:5.45-3) ... 145s Setting up binutils-common:armhf (2.42-4ubuntu1) ... 145s Setting up libpsl5t64:armhf (0.21.2-1.1) ... 145s Setting up libnghttp2-14:armhf (1.59.0-1build1) ... 145s Setting up libreiserfscore0t64 (1:3.6.27-7.1) ... 145s Setting up libctf-nobfd0:armhf (2.42-4ubuntu1) ... 145s Setting up libnss-systemd:armhf (255.4-1ubuntu5) ... 145s Setting up krb5-locales (1.20.1-5.1ubuntu1) ... 145s Setting up file (1:5.45-3) ... 145s Setting up kmod (31+20240202-2ubuntu4) ... 145s Setting up lshw (02.19.git.2021.06.19.996aaad9c7-2build2) ... 145s Setting up locales (2.39-0ubuntu6) ... 147s Generating locales (this might take a while)... 150s en_US.UTF-8... done 150s Generation complete. 150s Setting up libldap-common (2.6.7+dfsg-1~exp1ubuntu6) ... 150s Setting up libprotobuf-c1:armhf (1.4.1-1ubuntu3) ... 150s Setting up xxd (2:9.1.0016-1ubuntu5) ... 150s Setting up libsframe1:armhf (2.42-4ubuntu1) ... 150s Setting up libelf1t64:armhf (0.190-1.1build2) ... 150s Setting up libkrb5support0:armhf (1.20.1-5.1ubuntu1) ... 150s Setting up linux-headers-6.8.0-20-generic (6.8.0-20.20) ... 150s Setting up eject (2.39.3-9ubuntu2) ... 150s Setting up apparmor (4.0.0-beta3-0ubuntu2) ... 150s Installing new version of config file /etc/apparmor.d/abstractions/authentication ... 150s Installing new version of config file /etc/apparmor.d/abstractions/crypto ... 150s Installing new version of config file /etc/apparmor.d/abstractions/kde-open5 ... 150s Installing new version of config file /etc/apparmor.d/abstractions/openssl ... 150s Installing new version of config file /etc/apparmor.d/code ... 150s Installing new version of config file /etc/apparmor.d/firefox ... 150s apparmor_parser: Unable to replace "lsb_release". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s apparmor_parser: Unable to replace "kmod". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 150s apparmor_parser: Unable to replace "nvidia_modprobe". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 150s 151s sysctl: cannot stat /proc/sys/kernel/apparmor_restrict_unprivileged_userns: No such file or directory 151s Reloading AppArmor profiles 151s /sbin/apparmor_parser: Unable to replace "1password". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "Discord". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "MongoDB Compass". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "brave". /sbin/apparmor_parser: Unable to replace "buildah". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "busybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "cam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "ch-checkns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "ch-run". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "chrome". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "vscode". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "crun". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "devhelp". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "element-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "evolution". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "epiphany". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "flatpak". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "geary". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "firefox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "github-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "goldendict". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "ipa_verify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "kchmviewer". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "keybase". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lc-compliance". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "libcamerify". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "linux-sandbox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "loupe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-attach". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-create". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-destroy". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-execute". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-stop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-unshare". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "msedge". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "mmdebstrap". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "nautilus". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lxc-usernsexec". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "notepadqq". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "obsidian". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "opam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "opera". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "pageedit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "podman". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "polypane". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "privacybrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "qcam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "qmapshack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "qutebrowser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "rootlesskit". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "rssguard". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "rpm". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "runc". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-abort". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-apt". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-checkpackages". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-clean". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-adduser". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "QtWebEngineProcess". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "plasmashell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-createchroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-hold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-distupgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-shell". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-update". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-unhold". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-destroychroot". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "signal-desktop". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "scide". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "slack". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "sbuild-upgrade". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "slirp4netns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "lsb_release". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "steam". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "surfshark". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "systemd-coredump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "thunderbird". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "toybox". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "trinity". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "stress-ng". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "tuxedo-control-center". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "tup". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "kmod". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "nvidia_modprobe". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "userbindmount". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "unprivileged_userns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "uwsgi-core". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "vdens". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "vpnns". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "vivaldi-bin". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "wpcom". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "virtiofsd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "rsyslogd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "unix-chkpwd". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "ubuntu_pro_apt_news". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "/usr/bin/man". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s /sbin/apparmor_parser: Unable to replace "tcpdump". /sbin/apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 151s 151s Error: At least one profile failed to load 152s Setting up libglib2.0-0t64:armhf (2.79.3-3ubuntu5) ... 152s No schema files found: doing nothing. 152s Setting up libglib2.0-data (2.79.3-3ubuntu5) ... 152s Setting up vim-common (2:9.1.0016-1ubuntu5) ... 152s Setting up gcc-13-base:armhf (13.2.0-19ubuntu1) ... 152s Setting up libqrtr-glib0:armhf (1.2.2-1ubuntu3) ... 152s Setting up libslang2:armhf (2.3.3-3build1) ... 152s Setting up libnvme1t64 (1.8-3) ... 152s Setting up mtr-tiny (0.95-1.1build1) ... 152s Setting up gnupg-l10n (2.4.4-2ubuntu15) ... 152s Setting up librtmp1:armhf (2.4+20151223.gitfa8646d.1-2build6) ... 152s Setting up libdbus-1-3:armhf (1.14.10-4ubuntu2) ... 152s Setting up xz-utils (5.6.0-0.2) ... 152s Setting up perl-modules-5.38 (5.38.2-3.2) ... 152s Setting up libblockdev-utils3:armhf (3.1.0-1build1) ... 152s Setting up libpng16-16t64:armhf (1.6.43-3) ... 152s Setting up systemd-timesyncd (255.4-1ubuntu5) ... 152s Setting up libevent-core-2.1-7:armhf (2.1.12-stable-9build1) ... 152s Setting up udev (255.4-1ubuntu5) ... 153s Setting up libss2:armhf (1.47.0-2.4~exp1ubuntu2) ... 153s Setting up usb.ids (2024.03.18-1) ... 153s Setting up sudo (1.9.15p5-3ubuntu3) ... 153s Setting up dhcpcd-base (1:10.0.6-1ubuntu2) ... 153s Setting up gir1.2-glib-2.0:armhf (2.79.3-3ubuntu5) ... 153s Setting up libk5crypto3:armhf (1.20.1-5.1ubuntu1) ... 153s Setting up logsave (1.47.0-2.4~exp1ubuntu2) ... 153s Setting up libfdisk1:armhf (2.39.3-9ubuntu2) ... 153s Setting up libdb5.3t64:armhf (5.3.28+dfsg2-6) ... 153s Setting up libblockdev-nvme3:armhf (3.1.0-1build1) ... 153s Setting up libdevmapper1.02.1:armhf (2:1.02.185-3ubuntu2) ... 153s Setting up libblockdev-fs3:armhf (3.1.0-1build1) ... 153s Setting up python-apt-common (2.7.6build1) ... 153s Setting up mount (2.39.3-9ubuntu2) ... 153s Setting up dmsetup (2:1.02.185-3ubuntu2) ... 153s Setting up uuid-runtime (2.39.3-9ubuntu2) ... 154s uuidd.service is a disabled or a static unit not running, not starting it. 154s Setting up libmm-glib0:armhf (1.23.4-0ubuntu1) ... 154s Setting up groff-base (1.23.0-3build1) ... 154s Setting up libplymouth5:armhf (24.004.60-1ubuntu6) ... 154s Setting up dbus-session-bus-common (1.14.10-4ubuntu2) ... 154s Setting up kpartx (0.9.4-5ubuntu6) ... 154s Setting up jq (1.7.1-3) ... 154s Setting up gpgconf (2.4.4-2ubuntu15) ... 154s Setting up libpcap0.8t64:armhf (1.10.4-4.1ubuntu1) ... 154s Setting up libcryptsetup12:armhf (2:2.7.0-1ubuntu2) ... 154s Setting up libgirepository-1.0-1:armhf (1.79.1-1ubuntu6) ... 154s Setting up libjson-glib-1.0-common (1.8.0-2build1) ... 154s Setting up libkrb5-3:armhf (1.20.1-5.1ubuntu1) ... 154s Setting up libpython3.11-minimal:armhf (3.11.8-1build4) ... 154s Setting up libusb-1.0-0:armhf (2:1.0.27-1) ... 154s Setting up libperl5.38t64:armhf (5.38.2-3.2) ... 154s Setting up tnftp (20230507-2build1) ... 154s Setting up libbinutils:armhf (2.42-4ubuntu1) ... 154s Setting up dbus-system-bus-common (1.14.10-4ubuntu2) ... 154s Setting up libfido2-1:armhf (1.14.0-1build1) ... 154s Setting up openssl (3.0.13-0ubuntu2) ... 154s Setting up libbsd0:armhf (0.12.1-1) ... 154s Setting up readline-common (8.2-3.1build1) ... 154s Setting up libxml2:armhf (2.9.14+dfsg-1.3ubuntu2) ... 154s Setting up libxmuu1:armhf (2:1.1.3-3build1) ... 154s Setting up dbus-bin (1.14.10-4ubuntu2) ... 154s Setting up info (7.1-3build1) ... 154s Setting up liblocale-gettext-perl (1.07-6ubuntu3) ... 154s Setting up gpg (2.4.4-2ubuntu15) ... 154s Setting up libgudev-1.0-0:armhf (1:238-3ubuntu2) ... 154s Setting up libpolkit-gobject-1-0:armhf (124-1ubuntu1) ... 154s Setting up libbpf1:armhf (1:1.3.0-2build1) ... 154s Setting up libmbim-glib4:armhf (1.31.2-0ubuntu2) ... 154s Setting up rsync (3.2.7-1build1) ... 155s rsync.service is a disabled or a static unit not running, not starting it. 155s Setting up libudisks2-0:armhf (2.10.1-6) ... 155s Setting up bolt (0.9.6-2build1) ... 156s bolt.service is a disabled or a static unit not running, not starting it. 156s Setting up gnupg-utils (2.4.4-2ubuntu15) ... 156s Setting up initramfs-tools-bin (0.142ubuntu23) ... 156s Setting up libctf0:armhf (2.42-4ubuntu1) ... 156s Setting up cryptsetup-bin (2:2.7.0-1ubuntu2) ... 156s Setting up python3.11-minimal (3.11.8-1build4) ... 157s Setting up tcpdump (4.99.4-3ubuntu2) ... 157s apparmor_parser: Unable to replace "tcpdump". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 157s 157s Setting up apt-utils (2.7.13ubuntu1) ... 157s Setting up gpg-agent (2.4.4-2ubuntu15) ... 158s Setting up libpython3.12-stdlib:armhf (3.12.2-4build3) ... 158s Setting up libblockdev-mdraid3:armhf (3.1.0-1build1) ... 158s Setting up wget (1.21.4-1ubuntu2) ... 158s Setting up libblockdev-swap3:armhf (3.1.0-1build1) ... 158s Setting up plymouth (24.004.60-1ubuntu6) ... 158s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 158s update-rc.d: warning: start and stop actions are no longer supported; falling back to defaults 159s Setting up libxmlb2:armhf (0.3.15-1build1) ... 159s Setting up btrfs-progs (6.6.3-1.1build1) ... 159s Setting up libpython3.11-stdlib:armhf (3.11.8-1build4) ... 159s Setting up python3.12 (3.12.2-4build3) ... 160s Setting up libblockdev-loop3:armhf (3.1.0-1build1) ... 160s Setting up gpgsm (2.4.4-2ubuntu15) ... 160s Setting up inetutils-telnet (2:2.5-3ubuntu3) ... 160s Setting up e2fsprogs (1.47.0-2.4~exp1ubuntu2) ... 160s update-initramfs: deferring update (trigger activated) 161s e2scrub_all.service is a disabled or a static unit not running, not starting it. 161s Setting up libparted2t64:armhf (3.6-3.1build2) ... 161s Setting up linux-headers-generic (6.8.0-20.20+1) ... 161s Setting up dbus-daemon (1.14.10-4ubuntu2) ... 161s Setting up libmbim-proxy (1.31.2-0ubuntu2) ... 161s Setting up vim-tiny (2:9.1.0016-1ubuntu5) ... 161s Setting up libnetplan1:armhf (1.0-1) ... 161s Setting up man-db (2.12.0-3build4) ... 162s Updating database of manual pages ... 163s apparmor_parser: Unable to replace "/usr/bin/man". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 163s 164s man-db.service is a disabled or a static unit not running, not starting it. 164s Setting up libblockdev3:armhf (3.1.0-1build1) ... 164s Setting up fdisk (2.39.3-9ubuntu2) ... 164s Setting up libjson-glib-1.0-0:armhf (1.8.0-2build1) ... 164s Setting up libblockdev-part3:armhf (3.1.0-1build1) ... 164s Setting up libsasl2-modules-db:armhf (2.1.28+dfsg1-5ubuntu1) ... 164s Setting up libftdi1-2:armhf (1.5-6build4) ... 164s Setting up perl (5.38.2-3.2) ... 164s Setting up plymouth-theme-ubuntu-text (24.004.60-1ubuntu6) ... 165s update-initramfs: deferring update (trigger activated) 165s Setting up gir1.2-girepository-2.0:armhf (1.79.1-1ubuntu6) ... 165s Setting up dbus (1.14.10-4ubuntu2) ... 165s A reboot is required to replace the running dbus-daemon. 165s Please reboot the system when convenient. 165s Setting up shared-mime-info (2.4-1build1) ... 166s Setting up libgssapi-krb5-2:armhf (1.20.1-5.1ubuntu1) ... 166s Setting up ftp (20230507-2build1) ... 166s Setting up keyboxd (2.4.4-2ubuntu15) ... 166s Setting up libdpkg-perl (1.22.6ubuntu4) ... 166s Setting up libsasl2-2:armhf (2.1.28+dfsg1-5ubuntu1) ... 166s Setting up libssh-4:armhf (0.10.6-2build1) ... 166s Setting up libpam-systemd:armhf (255.4-1ubuntu5) ... 166s Setting up libpolkit-agent-1-0:armhf (124-1ubuntu1) ... 166s Setting up libgpgme11t64:armhf (1.18.0-4.1ubuntu3) ... 166s Setting up netplan-generator (1.0-1) ... 167s Removing 'diversion of /lib/systemd/system-generators/netplan to /lib/systemd/system-generators/netplan.usr-is-merged by netplan-generator' 167s Setting up initramfs-tools-core (0.142ubuntu23) ... 167s Setting up binutils-arm-linux-gnueabihf (2.42-4ubuntu1) ... 167s Setting up libarchive13t64:armhf (3.7.2-1.1ubuntu2) ... 167s Setting up libldap2:armhf (2.6.7+dfsg-1~exp1ubuntu6) ... 167s Setting up libpython3-stdlib:armhf (3.12.2-0ubuntu1) ... 167s Setting up systemd-resolved (255.4-1ubuntu5) ... 168s Setting up python3.11 (3.11.8-1build4) ... 169s Setting up telnet (0.17+2.5-3ubuntu3) ... 169s Setting up initramfs-tools (0.142ubuntu23) ... 169s update-initramfs: deferring update (trigger activated) 169s Setting up libcurl4t64:armhf (8.5.0-2ubuntu7) ... 169s Setting up bind9-libs:armhf (1:9.18.24-0ubuntu3) ... 169s Setting up libtirpc3t64:armhf (1.3.4+ds-1.1) ... 169s Setting up e2fsprogs-l10n (1.47.0-2.4~exp1ubuntu2) ... 169s Setting up iproute2 (6.1.0-1ubuntu5) ... 169s Setting up openssh-client (1:9.6p1-3ubuntu11) ... 169s Setting up libgusb2:armhf (0.4.8-1build1) ... 169s Setting up libcurl3t64-gnutls:armhf (8.5.0-2ubuntu7) ... 169s Setting up parted (3.6-3.1build2) ... 169s Setting up libqmi-glib5:armhf (1.35.2-0ubuntu1) ... 169s Setting up python3 (3.12.2-0ubuntu1) ... 170s Setting up binutils (2.42-4ubuntu1) ... 170s Setting up libjcat1:armhf (0.2.0-2build2) ... 170s Setting up dpkg-dev (1.22.6ubuntu4) ... 170s Setting up dirmngr (2.4.4-2ubuntu15) ... 170s Setting up dbus-user-session (1.14.10-4ubuntu2) ... 170s Setting up python3-cryptography (41.0.7-4build2) ... 170s Setting up python3-gi (3.47.0-3build1) ... 170s Setting up python3-typing-extensions (4.10.0-1) ... 171s Setting up lsof (4.95.0-1build2) ... 171s Setting up python3-pyrsistent:armhf (0.20.0-1build1) ... 171s Setting up libnsl2:armhf (1.3.0-3build2) ... 171s Setting up gnupg (2.4.4-2ubuntu15) ... 171s Setting up python3-netplan (1.0-1) ... 171s Setting up curl (8.5.0-2ubuntu7) ... 171s Setting up libvolume-key1:armhf (0.3.12-7build1) ... 171s Setting up bind9-host (1:9.18.24-0ubuntu3) ... 171s Setting up python3-lib2to3 (3.12.2-3ubuntu2) ... 171s Setting up python3-pkg-resources (68.1.2-2ubuntu1) ... 172s Setting up openssh-sftp-server (1:9.6p1-3ubuntu11) ... 172s Setting up python3-dbus (1.3.2-5build2) ... 172s Setting up python3-setuptools (68.1.2-2ubuntu1) ... 173s Setting up gpg-wks-client (2.4.4-2ubuntu15) ... 173s Setting up openssh-server (1:9.6p1-3ubuntu11) ... 173s Replacing config file /etc/ssh/sshd_config with new version 175s Created symlink /etc/systemd/system/ssh.service.requires/ssh.socket → /usr/lib/systemd/system/ssh.socket. 176s Setting up libblockdev-crypto3:armhf (3.1.0-1build1) ... 176s Setting up python3-gdbm:armhf (3.12.2-3ubuntu2) ... 176s Setting up python3-apt (2.7.6build1) ... 176s Setting up libfwupd2:armhf (1.9.15-1) ... 176s Setting up python3-yaml (6.0.1-2build1) ... 177s Setting up libqmi-proxy (1.35.2-0ubuntu1) ... 177s Setting up netplan.io (1.0-1) ... 177s Setting up bind9-dnsutils (1:9.18.24-0ubuntu3) ... 177s Setting up ubuntu-pro-client (31.2.1) ... 177s apparmor_parser: Unable to replace "ubuntu_pro_apt_news". apparmor_parser: Access denied. You need policy admin privileges to manage profiles. 177s 178s Setting up fwupd (1.9.15-1) ... 179s fwupd-offline-update.service is a disabled or a static unit not running, not starting it. 179s fwupd-refresh.service is a disabled or a static unit not running, not starting it. 179s fwupd.service is a disabled or a static unit not running, not starting it. 179s Setting up ubuntu-pro-client-l10n (31.2.1) ... 179s Setting up udisks2 (2.10.1-6) ... 179s vda: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/uevent': Permission denied 179s vda1: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda1/uevent': Permission denied 179s vda15: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda15/uevent': Permission denied 179s vda2: Failed to write 'change' to '/sys/devices/pci0000:00/0000:00:01.3/0000:04:00.0/virtio2/block/vda/vda2/uevent': Permission denied 179s loop0: Failed to write 'change' to '/sys/devices/virtual/block/loop0/uevent': Permission denied 179s loop1: Failed to write 'change' to '/sys/devices/virtual/block/loop1/uevent': Permission denied 179s loop2: Failed to write 'change' to '/sys/devices/virtual/block/loop2/uevent': Permission denied 179s loop3: Failed to write 'change' to '/sys/devices/virtual/block/loop3/uevent': Permission denied 179s loop4: Failed to write 'change' to '/sys/devices/virtual/block/loop4/uevent': Permission denied 179s loop5: Failed to write 'change' to '/sys/devices/virtual/block/loop5/uevent': Permission denied 179s loop6: Failed to write 'change' to '/sys/devices/virtual/block/loop6/uevent': Permission denied 179s loop7: Failed to write 'change' to '/sys/devices/virtual/block/loop7/uevent': Permission denied 180s Processing triggers for ufw (0.36.2-5) ... 180s Processing triggers for systemd (255.4-1ubuntu5) ... 180s Processing triggers for install-info (7.1-3build1) ... 180s Processing triggers for libc-bin (2.39-0ubuntu6) ... 180s Processing triggers for initramfs-tools (0.142ubuntu23) ... 182s Reading package lists... 183s Building dependency tree... 183s Reading state information... 184s The following packages will be REMOVED: 184s linux-headers-6.8.0-11* python3-lib2to3* 184s 0 upgraded, 0 newly installed, 2 to remove and 1 not upgraded. 184s After this operation, 85.8 MB disk space will be freed. 184s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 78592 files and directories currently installed.) 184s Removing linux-headers-6.8.0-11 (6.8.0-11.11) ... 185s Removing python3-lib2to3 (3.12.2-3ubuntu2) ... 187s autopkgtest [19:13:57]: rebooting testbed after setup commands that affected boot 228s autopkgtest [19:14:38]: testbed running kernel: Linux 5.15.0-101-generic #111-Ubuntu SMP Wed Mar 6 18:01:01 UTC 2024 253s autopkgtest [19:15:03]: @@@@@@@@@@@@@@@@@@@@ apt-source ataqv 263s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (dsc) [2348 B] 263s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (tar) [4068 kB] 263s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (diff) [9548 B] 263s gpgv: Signature made Fri Mar 22 15:29:42 2024 UTC 263s gpgv: using RSA key 4FB588A84C2DDE79A74C77876FA458DD1DB03F71 263s gpgv: issuer "juliank@ubuntu.com" 263s gpgv: Can't check signature: No public key 263s dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build2.dsc: no acceptable signature found 263s autopkgtest [19:15:13]: testing package ataqv version 1.3.1+ds-2build2 265s autopkgtest [19:15:15]: build not needed 267s autopkgtest [19:15:17]: test run-unit-test: preparing testbed 276s Reading package lists... 277s Building dependency tree... 277s Reading state information... 278s Starting pkgProblemResolver with broken count: 0 278s Starting 2 pkgProblemResolver with broken count: 0 278s Done 279s The following additional packages will be installed: 279s ataqv fonts-font-awesome libboost-chrono1.83.0t64 libboost-filesystem1.83.0 279s libboost-iostreams1.83.0 libdeflate0 libhts3t64 libhtscodecs2 279s libjs-d3-format libjs-jquery libjs-jquery-datatables 279s libjs-jquery-datatables-extensions node-commander node-d3 node-d3-array 279s node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color 279s node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease 279s node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 279s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 279s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 279s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 279s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 279s node-iconv-lite node-normalize.css node-rw node-safe-buffer 279s Suggested packages: 279s picard-tools samtools macs libjs-html5shiv 279s Recommended packages: 279s javascript-common 279s The following NEW packages will be installed: 279s ataqv autopkgtest-satdep fonts-font-awesome libboost-chrono1.83.0t64 279s libboost-filesystem1.83.0 libboost-iostreams1.83.0 libdeflate0 libhts3t64 279s libhtscodecs2 libjs-d3-format libjs-jquery libjs-jquery-datatables 279s libjs-jquery-datatables-extensions node-commander node-d3 node-d3-array 279s node-d3-axis node-d3-brush node-d3-chord node-d3-collection node-d3-color 279s node-d3-contour node-d3-dispatch node-d3-drag node-d3-dsv node-d3-ease 279s node-d3-fetch node-d3-force node-d3-format node-d3-geo node-d3-hierarchy 279s node-d3-interpolate node-d3-path node-d3-polygon node-d3-quadtree 279s node-d3-queue node-d3-random node-d3-scale node-d3-scale-chromatic 279s node-d3-selection node-d3-shape node-d3-time node-d3-time-format 279s node-d3-timer node-d3-transition node-d3-voronoi node-d3-zoom 279s node-iconv-lite node-normalize.css node-rw node-safe-buffer 280s 0 upgraded, 51 newly installed, 0 to remove and 1 not upgraded. 280s Need to get 7643 kB/7644 kB of archives. 280s After this operation, 26.1 MB of additional disk space will be used. 280s Get:1 /tmp/autopkgtest.dQYdfx/1-autopkgtest-satdep.deb autopkgtest-satdep armhf 0 [700 B] 280s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libboost-chrono1.83.0t64 armhf 1.83.0-2.1ubuntu2 [244 kB] 280s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libboost-filesystem1.83.0 armhf 1.83.0-2.1ubuntu2 [280 kB] 280s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main armhf libboost-iostreams1.83.0 armhf 1.83.0-2.1ubuntu2 [257 kB] 280s Get:5 http://ftpmaster.internal/ubuntu noble/main armhf libdeflate0 armhf 1.19-1 [41.3 kB] 280s Get:6 http://ftpmaster.internal/ubuntu noble/universe armhf libhtscodecs2 armhf 1.6.0-1 [65.9 kB] 280s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf libhts3t64 armhf 1.19+ds-1.1build2 [389 kB] 280s Get:8 http://ftpmaster.internal/ubuntu noble/main armhf libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] 280s Get:9 http://ftpmaster.internal/ubuntu noble/universe armhf libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] 280s Get:10 http://ftpmaster.internal/ubuntu noble/universe armhf libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] 280s Get:11 http://ftpmaster.internal/ubuntu noble/main armhf fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] 280s Get:12 http://ftpmaster.internal/ubuntu noble/universe armhf node-normalize.css all 8.0.1-5 [10.8 kB] 280s Get:13 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] 280s Get:14 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB] 280s Get:15 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B] 280s Get:16 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB] 280s Get:17 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB] 280s Get:18 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB] 280s Get:19 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB] 280s Get:20 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB] 280s Get:21 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB] 280s Get:22 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB] 280s Get:23 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-brush all 1.1.6+~1.1.5-1 [181 kB] 280s Get:24 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB] 280s Get:25 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB] 280s Get:26 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB] 280s Get:27 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB] 280s Get:28 http://ftpmaster.internal/ubuntu noble/universe armhf node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] 280s Get:29 http://ftpmaster.internal/ubuntu noble/universe armhf node-iconv-lite all 0.6.3-3 [158 kB] 280s Get:30 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-queue all 3.0.7-13 [10.2 kB] 280s Get:31 http://ftpmaster.internal/ubuntu noble/universe armhf node-rw all 1.3.3-5 [7570 B] 280s Get:32 http://ftpmaster.internal/ubuntu noble/universe armhf node-commander all 9.4.1-1 [50.6 kB] 280s Get:33 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB] 280s Get:34 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB] 281s Get:35 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB] 281s Get:36 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB] 281s Get:37 http://ftpmaster.internal/ubuntu noble/universe armhf libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB] 281s Get:38 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB] 281s Get:39 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB] 281s Get:40 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB] 281s Get:41 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B] 281s Get:42 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-random all 1.1.2+~1.1.3-1 [9140 B] 281s Get:43 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB] 281s Get:44 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB] 281s Get:45 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB] 281s Get:46 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB] 281s Get:47 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB] 281s Get:48 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB] 281s Get:49 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB] 281s Get:50 http://ftpmaster.internal/ubuntu noble/universe armhf node-d3 all 5.16.0+~cs5.28.10-1 [194 kB] 281s Get:51 http://ftpmaster.internal/ubuntu noble-proposed/universe armhf ataqv armhf 1.3.1+ds-2build2 [3376 kB] 282s Fetched 7643 kB in 1s (5627 kB/s) 282s Selecting previously unselected package libboost-chrono1.83.0t64:armhf. 282s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 58435 files and directories currently installed.) 282s Preparing to unpack .../00-libboost-chrono1.83.0t64_1.83.0-2.1ubuntu2_armhf.deb ... 282s Unpacking libboost-chrono1.83.0t64:armhf (1.83.0-2.1ubuntu2) ... 282s Selecting previously unselected package libboost-filesystem1.83.0:armhf. 282s Preparing to unpack .../01-libboost-filesystem1.83.0_1.83.0-2.1ubuntu2_armhf.deb ... 282s Unpacking libboost-filesystem1.83.0:armhf (1.83.0-2.1ubuntu2) ... 282s Selecting previously unselected package libboost-iostreams1.83.0:armhf. 282s Preparing to unpack .../02-libboost-iostreams1.83.0_1.83.0-2.1ubuntu2_armhf.deb ... 282s Unpacking libboost-iostreams1.83.0:armhf (1.83.0-2.1ubuntu2) ... 282s Selecting previously unselected package libdeflate0:armhf. 282s Preparing to unpack .../03-libdeflate0_1.19-1_armhf.deb ... 282s Unpacking libdeflate0:armhf (1.19-1) ... 282s Selecting previously unselected package libhtscodecs2:armhf. 282s Preparing to unpack .../04-libhtscodecs2_1.6.0-1_armhf.deb ... 282s Unpacking libhtscodecs2:armhf (1.6.0-1) ... 282s Selecting previously unselected package libhts3t64:armhf. 282s Preparing to unpack .../05-libhts3t64_1.19+ds-1.1build2_armhf.deb ... 282s Unpacking libhts3t64:armhf (1.19+ds-1.1build2) ... 282s Selecting previously unselected package libjs-jquery. 282s Preparing to unpack .../06-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... 282s Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 282s Selecting previously unselected package libjs-jquery-datatables. 282s Preparing to unpack .../07-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... 282s Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... 282s Selecting previously unselected package libjs-jquery-datatables-extensions. 282s Preparing to unpack .../08-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... 282s Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 282s Selecting previously unselected package fonts-font-awesome. 282s Preparing to unpack .../09-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... 282s Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 282s Selecting previously unselected package node-normalize.css. 282s Preparing to unpack .../10-node-normalize.css_8.0.1-5_all.deb ... 282s Unpacking node-normalize.css (8.0.1-5) ... 282s Selecting previously unselected package node-d3-array. 282s Preparing to unpack .../11-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... 282s Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... 282s Selecting previously unselected package node-d3-axis. 282s Preparing to unpack .../12-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... 282s Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... 282s Selecting previously unselected package node-d3-dispatch. 282s Preparing to unpack .../13-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... 282s Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... 282s Selecting previously unselected package node-d3-selection. 282s Preparing to unpack .../14-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... 282s Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... 282s Selecting previously unselected package node-d3-drag. 282s Preparing to unpack .../15-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... 282s Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... 283s Selecting previously unselected package node-d3-color. 283s Preparing to unpack .../16-node-d3-color_1.4.1+~1.4.2-1_all.deb ... 283s Unpacking node-d3-color (1.4.1+~1.4.2-1) ... 283s Selecting previously unselected package node-d3-interpolate. 283s Preparing to unpack .../17-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... 283s Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... 283s Selecting previously unselected package node-d3-ease. 283s Preparing to unpack .../18-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... 283s Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... 283s Selecting previously unselected package node-d3-timer. 283s Preparing to unpack .../19-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... 283s Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... 283s Selecting previously unselected package node-d3-transition. 283s Preparing to unpack .../20-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... 283s Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... 283s Selecting previously unselected package node-d3-brush. 283s Preparing to unpack .../21-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... 283s Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... 283s Selecting previously unselected package node-d3-path. 283s Preparing to unpack .../22-node-d3-path_1.0.9+~1.0.9-1_all.deb ... 283s Unpacking node-d3-path (1.0.9+~1.0.9-1) ... 283s Selecting previously unselected package node-d3-chord. 283s Preparing to unpack .../23-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... 283s Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... 283s Selecting previously unselected package node-d3-collection. 283s Preparing to unpack .../24-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... 283s Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... 283s Selecting previously unselected package node-d3-contour. 283s Preparing to unpack .../25-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... 283s Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... 283s Selecting previously unselected package node-safe-buffer. 283s Preparing to unpack .../26-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... 283s Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... 283s Selecting previously unselected package node-iconv-lite. 283s Preparing to unpack .../27-node-iconv-lite_0.6.3-3_all.deb ... 283s Unpacking node-iconv-lite (0.6.3-3) ... 283s Selecting previously unselected package node-d3-queue. 283s Preparing to unpack .../28-node-d3-queue_3.0.7-13_all.deb ... 283s Unpacking node-d3-queue (3.0.7-13) ... 283s Selecting previously unselected package node-rw. 283s Preparing to unpack .../29-node-rw_1.3.3-5_all.deb ... 283s Unpacking node-rw (1.3.3-5) ... 283s Selecting previously unselected package node-commander. 283s Preparing to unpack .../30-node-commander_9.4.1-1_all.deb ... 283s Unpacking node-commander (9.4.1-1) ... 283s Selecting previously unselected package node-d3-dsv. 283s Preparing to unpack .../31-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... 283s Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... 283s Selecting previously unselected package node-d3-fetch. 283s Preparing to unpack .../32-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... 283s Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... 283s Selecting previously unselected package node-d3-quadtree. 283s Preparing to unpack .../33-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... 283s Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... 283s Selecting previously unselected package node-d3-force. 283s Preparing to unpack .../34-node-d3-force_2.1.1+~2.1.4-1_all.deb ... 283s Unpacking node-d3-force (2.1.1+~2.1.4-1) ... 283s Selecting previously unselected package libjs-d3-format. 283s Preparing to unpack .../35-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 283s Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... 283s Selecting previously unselected package node-d3-format. 283s Preparing to unpack .../36-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 283s Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... 283s Selecting previously unselected package node-d3-geo. 284s Preparing to unpack .../37-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... 284s Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... 284s Selecting previously unselected package node-d3-hierarchy. 284s Preparing to unpack .../38-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... 284s Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... 284s Selecting previously unselected package node-d3-polygon. 284s Preparing to unpack .../39-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... 284s Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... 284s Selecting previously unselected package node-d3-random. 284s Preparing to unpack .../40-node-d3-random_1.1.2+~1.1.3-1_all.deb ... 284s Unpacking node-d3-random (1.1.2+~1.1.3-1) ... 284s Selecting previously unselected package node-d3-time. 284s Preparing to unpack .../41-node-d3-time_1.1.0+~1.1.1-1_all.deb ... 284s Unpacking node-d3-time (1.1.0+~1.1.1-1) ... 284s Selecting previously unselected package node-d3-time-format. 284s Preparing to unpack .../42-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... 284s Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... 284s Selecting previously unselected package node-d3-scale. 284s Preparing to unpack .../43-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... 284s Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... 284s Selecting previously unselected package node-d3-scale-chromatic. 284s Preparing to unpack .../44-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... 284s Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 284s Selecting previously unselected package node-d3-shape. 284s Preparing to unpack .../45-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... 284s Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... 284s Selecting previously unselected package node-d3-voronoi. 284s Preparing to unpack .../46-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... 284s Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... 284s Selecting previously unselected package node-d3-zoom. 284s Preparing to unpack .../47-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... 284s Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... 284s Selecting previously unselected package node-d3. 284s Preparing to unpack .../48-node-d3_5.16.0+~cs5.28.10-1_all.deb ... 284s Unpacking node-d3 (5.16.0+~cs5.28.10-1) ... 284s Selecting previously unselected package ataqv. 284s Preparing to unpack .../49-ataqv_1.3.1+ds-2build2_armhf.deb ... 284s Unpacking ataqv (1.3.1+ds-2build2) ... 284s Selecting previously unselected package autopkgtest-satdep. 284s Preparing to unpack .../50-1-autopkgtest-satdep.deb ... 284s Unpacking autopkgtest-satdep (0) ... 284s Setting up libhtscodecs2:armhf (1.6.0-1) ... 284s Setting up node-d3-timer (1.0.10+~1.0.10-1) ... 284s Setting up node-d3-color (1.4.1+~1.4.2-1) ... 284s Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... 284s Setting up node-d3-queue (3.0.7-13) ... 284s Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... 284s Setting up node-d3-ease (1.0.7+~1.0.11-1) ... 284s Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 284s Setting up libdeflate0:armhf (1.19-1) ... 284s Setting up node-d3-selection (1.4.1+~1.4.3-1) ... 284s Setting up node-d3-axis (1.0.12+~1.0.16-1) ... 284s Setting up libboost-filesystem1.83.0:armhf (1.83.0-2.1ubuntu2) ... 284s Setting up node-d3-path (1.0.9+~1.0.9-1) ... 284s Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... 284s Setting up node-rw (1.3.3-5) ... 284s Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... 284s Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... 284s Setting up libboost-chrono1.83.0t64:armhf (1.83.0-2.1ubuntu2) ... 284s Setting up libboost-iostreams1.83.0:armhf (1.83.0-2.1ubuntu2) ... 284s Setting up node-d3-collection (1.0.7+~1.0.10-1) ... 284s Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... 284s Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... 284s Setting up node-d3-time (1.1.0+~1.1.1-1) ... 284s Setting up node-commander (9.4.1-1) ... 284s Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... 284s Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... 284s Setting up libhts3t64:armhf (1.19+ds-1.1build2) ... 284s Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 284s Setting up node-d3-geo (1.12.1+~1.12.4-1) ... 284s Setting up node-normalize.css (8.0.1-5) ... 284s Setting up node-d3-transition (1.3.2+~1.3.2-1) ... 284s Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 284s Setting up node-d3-random (1.1.2+~1.1.3-1) ... 284s Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 284s Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... 284s Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... 284s Setting up node-d3-chord (1.0.6+~1.0.11-1) ... 284s Setting up node-d3-shape (1.3.7+~1.3.8-1) ... 284s Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... 284s Setting up node-d3-drag (1.2.5+~1.2.5-1) ... 284s Setting up node-iconv-lite (0.6.3-3) ... 284s Setting up node-d3-scale (2.2.2+~2.2.6-1) ... 284s Setting up node-d3-force (2.1.1+~2.1.4-1) ... 284s Setting up node-d3-contour (1.3.2+~1.3.3-1) ... 284s Setting up node-d3-brush (1.1.6+~1.1.5-1) ... 284s Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... 284s Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... 284s Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... 284s Setting up node-d3 (5.16.0+~cs5.28.10-1) ... 284s Setting up ataqv (1.3.1+ds-2build2) ... 284s Setting up autopkgtest-satdep (0) ... 284s Processing triggers for man-db (2.12.0-3build4) ... 285s Processing triggers for libc-bin (2.39-0ubuntu6) ... 302s (Reading database ... 60100 files and directories currently installed.) 302s Removing autopkgtest-satdep (0) ... 307s autopkgtest [19:15:57]: test run-unit-test: [----------------------- 309s [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 309s Reading human autosomal references from autosomal_references.gz. 309s Autosomal references for human: 309s I 309s II 309s III 309s Reading human autosomal references from autosomal_references.gz. 309s Autosomal references for human: 309s I 309s II 309s III 309s Reading human autosomal references from autosomal_references.gz. 309s Autosomal references for human: 309s I 309s II 309s III 311s Read 411 excluded regions from exclude.dac.bed.gz. 311s Read 1649 excluded regions from exclude.duke.bed.gz. 311s Loading TSS file 'hg19.tss.refseq.bed.gz'. 312s Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] 312s Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 312s Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] 312s Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 312s Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] 312s Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] 313s Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] 313s Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] 313s Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] 313s Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] 313s Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] 313s Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] 313s Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] 313s Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] 313s chr1 feature count: 2687 313s chr2 feature count: 1715 313s chr3 feature count: 1490 313s chr4 feature count: 1004 313s chr5 feature count: 1132 313s chr6 feature count: 1368 313s chr7 feature count: 1169 313s chr8 feature count: 913 313s chr9 feature count: 1025 313s chr10 feature count: 1039 313s chr11 feature count: 1642 313s chr12 feature count: 1350 313s chr13 feature count: 433 313s chr14 feature count: 785 313s chr15 feature count: 812 313s chr16 feature count: 1106 313s chr17 feature count: 1528 313s chr18 feature count: 398 313s chr19 feature count: 1785 313s chr20 feature count: 694 313s chr21 feature count: 321 313s chr22 feature count: 593 313s Loaded 24989 TSS in 1.35964 seconds. (18379.1 TSS/second). 313s 313s Collecting metrics from test.bam. 313s 313s Logging problematic reads to SRR891275.problems. 313s 313s Loading peaks for read group SRR891275 from test.peaks.gz. 313s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 313s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 313s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 314s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 314s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 314s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 314s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 314s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 316s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 316s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 316s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 316s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 316s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 316s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 316s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 316s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 316s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 316s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 316s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 316s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 316s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 316s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 317s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 317s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 317s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 317s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 317s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 317s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 318s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 318s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 318s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 318s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 318s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 318s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 318s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 318s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 318s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 318s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 318s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 318s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 319s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 319s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 319s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 319s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 319s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 319s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 319s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 319s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 319s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 319s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 319s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 319s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 319s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 319s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 319s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 319s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 319s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 319s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 319s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 319s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 320s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 320s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 320s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 320s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 320s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 320s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 320s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 320s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 320s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 320s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 320s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 320s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 322s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 322s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 322s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 322s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 322s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 322s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 322s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 322s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 322s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 322s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 322s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 322s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 322s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 322s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 322s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 322s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 322s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 322s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 322s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 322s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 323s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 323s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 323s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 323s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 323s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 323s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 323s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 323s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 323s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 324s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 324s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 324s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 324s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 324s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 324s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 325s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 326s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 326s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 326s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 326s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 326s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 326s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 326s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 326s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 326s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 326s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 326s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 326s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 326s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 326s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 326s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 326s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 327s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 327s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 327s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 327s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 327s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 327s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 327s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 327s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 327s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 327s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 327s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 327s chr1 peak count: 3667 327s chr2 peak count: 3154 327s chr3 peak count: 2528 327s chr4 peak count: 1814 327s chr5 peak count: 2042 327s chr6 peak count: 2483 327s chr7 peak count: 1999 327s chr8 peak count: 1647 327s chr9 peak count: 1475 327s chr10 peak count: 1815 327s chr11 peak count: 1878 327s chr12 peak count: 2078 327s chr13 peak count: 1026 327s chr14 peak count: 1275 327s chr15 peak count: 1140 327s chr16 peak count: 1211 327s chr17 peak count: 1664 327s chr18 peak count: 772 327s chr19 peak count: 1595 327s chr20 peak count: 864 327s chr21 peak count: 487 327s chr22 peak count: 662 327s Loaded 37276 peaks in 14.5246 seconds. (2566.4 peaks/second). 327s 327s Logging problematic reads to SRR891278.problems. 327s 327s Loading peaks for read group SRR891278 from test.peaks.gz. 327s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 327s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 327s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 328s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 328s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 328s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 328s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 328s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 330s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 330s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 330s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 330s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 330s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 330s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 330s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 331s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 331s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 331s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 331s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 331s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 331s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 331s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 331s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 331s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 331s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 331s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 331s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 332s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 332s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 332s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 333s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 333s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 333s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 333s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 333s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 333s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 333s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 333s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 333s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 333s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 333s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 333s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 333s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 333s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 333s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 333s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 333s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 333s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 334s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 334s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 334s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 334s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 334s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 334s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 334s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 334s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 334s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 334s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 334s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 334s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 334s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 335s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 335s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 335s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 335s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 335s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 335s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 335s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 335s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 335s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 335s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 335s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 336s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 336s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 336s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 336s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 336s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 336s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 336s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 336s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 336s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 336s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 336s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 336s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 336s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 336s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 336s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 336s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 336s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 336s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 337s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 337s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 338s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 338s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 338s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 338s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 338s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 338s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 338s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 338s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 338s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 338s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 338s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 338s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 338s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 339s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 339s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 339s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 340s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 340s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 340s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 340s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 340s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 340s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 340s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 340s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 340s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 341s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 341s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 341s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 341s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 341s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 341s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 341s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 341s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 341s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 341s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 341s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 341s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 341s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 341s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 341s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 341s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 341s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 341s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 342s chr1 peak count: 3667 342s chr2 peak count: 3154 342s chr3 peak count: 2528 342s chr4 peak count: 1814 342s chr5 peak count: 2042 342s chr6 peak count: 2483 342s chr7 peak count: 1999 342s chr8 peak count: 1647 342s chr9 peak count: 1475 342s chr10 peak count: 1815 342s chr11 peak count: 1878 342s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 342s New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 342s New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 342s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 342s 5: 439 (84.423%) 342s 10: 439 (84.423%) 342s 15: 438 (84.231%) 342s 20: 436 (83.846%) 342s 25: 435 (83.654%) 342s 30: 420 (80.769%) 342s 342s Peak Metrics 342s ------------ 342s Peak count: 37276 342s 342s High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) 342s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 342s Top peak: 2 (1.000% of all high quality autosomal alignments) 342s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 342s Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) 342s Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) 342s Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) 342s 342s Read Group 342s ========== 342s ID: SRR891278 342s Library: SRR891278 342s Sample: GSM1155967 342s Description: a library of brutal tests? 342s 342s Sequencing center: 342s Sequencing date: 342s Sequencing platform: ILLUMINA 342s Platform model: 342s Platform unit: 342s Flow order: 342s Key sequence: 342s Predicted median insert size: 342s Programs: 342s 342s Metrics 342s ------- 342s 342s Read Mapping Metrics 342s -------------------- 342s Total reads: 520 342s Total problems: 90 (17.308%) 342s Properly paired and mapped reads: 430 (82.692%) 342s Secondary reads: 10 (1.923%) 342s Supplementary reads: 0 (0.000%) 342s Duplicate reads: 158 (30.385% of all reads) 342s 342s Quality Indicators 342s ------------------ 342s Short to mononucleosomal ratio: 2.357 342s High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 342s as a percentage of autosomal reads: 91.743% 342s as a percentage of all reads: 38.462% 342s TSS enrichment: 3.687 342s 342s Paired Read Metrics 342s ------------------- 342s Paired reads: 520 (100.000%) 342s Paired and mapped reads: 440 (84.615%) 342s FR reads: 430 (82.692308%) 342s First of pair: 259 (49.808%) 342s Second of pair: 261 (50.192%) 342s Forward reads: 261 (50.192%) 342s Reverse reads: 259 (49.808%) 342s Forward mate reads: 260 (50.000%) 342s Reverse mate reads: 260 (50.000%) 342s 342s Unmapped Read Metrics 342s --------------------- 342s Unmapped reads: 8 (1.538%) 342s Unmapped mate reads: 4 (0.769%) 342s Reads not passing quality controls: 0 (0.000%) 342s Unpaired reads: 0 (0.000%) 342s Reads with zero mapping quality: 49 (9.423%) 342s 342s Aberrant Mapping Metrics 342s ------------------------ 342s RF reads: 6 (1.153846%) 342s FF reads: 4 (0.769231%) 342s RR reads: 9 (1.730769%) 342s Reads that paired and mapped but... 342s on different chromosomes: 8 (1.538%) 342s probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) 342s just not properly: 0 (0.000%) 342s 342s Autosomal/Mitochondrial Metrics 342s ------------------------------- 342s Total autosomal reads: 218 (41.923% of all reads) 342s Total mitochondrial reads: 192 (36.923% of all reads) 342s Duplicate autosomal reads: 17 (7.798% of all autosomal reads) 342s Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) 342s 342s 342s Mapping Quality 342s --------------- 342s Mean MAPQ: 48.044 342s Median MAPQ: 60.000 342s Reads with MAPQ >=... 342s 5: 449 (86.346%) 342s 10: 445 (85.577%) 342s 15: 443 (85.192%) 342s 20: 442 (85.000%) 342s 25: 442 (85.000%) 342s 30: 417 (80.192%) 342s 342s Peak Metrics 342s ------------ 342s Peak count: 37276 342s 342s High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) 342s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 342s Top peak: 2 (1.000% of all high quality autosomal alignments) 342s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 342s Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) 342s Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) 342s Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) 342s 342s 343s [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory 343s Read 411 excluded regions from exclude.dac.bed.gz. 343s Read 1649 excluded regions from exclude.duke.bed.gz. 343s Collecting metrics from test.bam. 343s 343s Logging problematic reads to Test collector.problems. 343s 343s Loading peaks for read group Test collector from test.peaks.gz. 343s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] 343s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] 343s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] 343s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 343s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 343s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 343s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] 343s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] 345s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 345s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 345s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] 345s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 345s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 345s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 345s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] 346s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] 346s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] 346s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 346s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 346s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 346s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] 346s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] 346s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] 347s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 347s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 347s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 347s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 347s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] 347s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] 348s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] 348s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] 348s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] 348s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 348s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 348s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 348s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 348s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 348s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 348s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 348s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 348s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] 348s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 348s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 348s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] 349s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] 349s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] 349s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] 349s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] 349s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] 349s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 349s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] 349s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] 349s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] 349s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] 350s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 350s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 350s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 350s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] 350s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] 350s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 350s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] 350s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] 350s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] 350s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] 350s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] 351s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] 351s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 351s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 352s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] 352s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] 352s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] 352s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] 352s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 352s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 352s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 352s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] 352s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] 352s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] 352s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] 353s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] 353s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 353s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] 353s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] 354s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] 354s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] 354s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 354s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 354s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 354s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 355s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] 356s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] 356s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] 356s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] 356s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] 356s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 356s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 356s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 356s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 356s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] 356s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] 356s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 356s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] 357s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] 357s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 357s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 357s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] 357s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 357s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 357s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] 357s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] 357s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] 357s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] 357s chr1 peak count: 3667 357s chr2 peak count: 3154 357s chr3 peak count: 2528 357s chr4 peak count: 1814 357s chr5 peak count: 2042 357s chr6 peak count: 2483 357s chr7 peak count: 1999 357s chr8 peak count: 1647 357s chr9 peak count: 1475 357s chr10 peak count: 1815 357s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 357s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 357s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 357s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 357s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 357s 5: 888 (85.385%) 357s 10: 884 (85.000%) 357s 15: 881 (84.712%) 357s 20: 878 (84.423%) 357s 25: 877 (84.327%) 357s 30: 837 (80.481%) 357s 357s Peak Metrics 357s ------------ 357s Peak count: 37276 357s 357s High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) 357s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 357s Top peak: 2 (0.500% of all high quality autosomal alignments) 357s Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) 357s Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) 357s Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) 357s Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) 357s 357s 358s Read 411 excluded regions from exclude.dac.bed.gz. 358s Read 1649 excluded regions from exclude.duke.bed.gz. 358s Collecting metrics from test.bam. 358s 358s Logging problematic reads to Test collector.problems. 358s 358s Loading peaks for read group Test collector from notthere.peaks.gz. 358s Read 411 excluded regions from exclude.dac.bed.gz. 358s Read 1649 excluded regions from exclude.duke.bed.gz. 358s Loading TSS file 'notthere.bed.gz'. 359s =============================================================================== 359s All tests passed (241 assertions in 54 test cases) 359s 359s autopkgtest [19:16:49]: test run-unit-test: -----------------------] 363s autopkgtest [19:16:53]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 363s run-unit-test PASS 366s autopkgtest [19:16:56]: @@@@@@@@@@@@@@@@@@@@ summary 366s run-unit-test PASS