0s autopkgtest [15:55:41]: starting date and time: 2024-03-18 15:55:41+0000
  0s autopkgtest [15:55:41]: git checkout: b506e79c ssh-setup/nova: fix ARCH having two lines of data
  0s autopkgtest [15:55:41]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.g3v13ex_/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:openssl --apt-upgrade seqkit --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 --env=ADT_TEST_TRIGGERS=openssl/3.0.13-0ubuntu2 -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos03-arm64-4.secgroup --name adt-noble-arm64-seqkit-20240318-155541-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/
 82s autopkgtest [15:57:03]: testbed dpkg architecture: arm64
 82s autopkgtest [15:57:03]: testbed apt version: 2.7.12
 82s autopkgtest [15:57:03]: @@@@@@@@@@@@@@@@@@@@ test bed setup
 83s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB]
 84s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [52.0 kB]
 84s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [485 kB]
 84s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3728 kB]
 84s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B]
 84s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 Packages [654 kB]
 85s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 c-n-f Metadata [3144 B]
 85s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 Packages [33.6 kB]
 85s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 c-n-f Metadata [116 B]
 85s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 Packages [4102 kB]
 85s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 c-n-f Metadata [8528 B]
 85s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 Packages [55.5 kB]
 85s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 c-n-f Metadata [116 B]
 87s Fetched 9246 kB in 3s (3624 kB/s)
 87s Reading package lists...
 90s Reading package lists...
 91s Building dependency tree...
 91s Reading state information...
 91s Calculating upgrade...
 91s The following packages will be REMOVED:
 91s   libssl3
 91s The following NEW packages will be installed:
 91s   libssl3t64
 91s The following packages will be upgraded:
 91s   openssl
 92s 1 upgraded, 1 newly installed, 1 to remove and 0 not upgraded.
 92s Need to get 2777 kB of archives.
 92s After this operation, 139 kB of additional disk space will be used.
 92s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 openssl arm64 3.0.13-0ubuntu2 [985 kB]
 92s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libssl3t64 arm64 3.0.13-0ubuntu2 [1793 kB]
 93s Fetched 2777 kB in 1s (3950 kB/s)
 93s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74758 files and directories currently installed.)
 93s Preparing to unpack .../openssl_3.0.13-0ubuntu2_arm64.deb ...
 93s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ...
 93s dpkg: libssl3:arm64: dependency problems, but removing anyway as you requested:
 93s  wget depends on libssl3 (>= 3.0.0).
 93s  u-boot-tools depends on libssl3 (>= 3.0.0).
 93s  tnftp depends on libssl3 (>= 3.0.0).
 93s  tcpdump depends on libssl3 (>= 3.0.0).
 93s  systemd-resolved depends on libssl3 (>= 3.0.0).
 93s  systemd depends on libssl3 (>= 3.0.0).
 93s  sudo depends on libssl3 (>= 3.0.0).
 93s  sbsigntool depends on libssl3 (>= 3.0.0).
 93s  rsync depends on libssl3 (>= 3.0.0).
 93s  python3-cryptography depends on libssl3 (>= 3.0.0).
 93s  openssh-server depends on libssl3 (>= 3.0.10).
 93s  openssh-client depends on libssl3 (>= 3.0.10).
 93s  mtd-utils depends on libssl3 (>= 3.0.0).
 93s  mokutil depends on libssl3 (>= 3.0.0).
 93s  linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0).
 93s  libsystemd-shared:arm64 depends on libssl3 (>= 3.0.0).
 93s  libssh-4:arm64 depends on libssl3 (>= 3.0.0).
 93s  libsasl2-modules:arm64 depends on libssl3 (>= 3.0.0).
 93s  libsasl2-2:arm64 depends on libssl3 (>= 3.0.0).
 93s  libpython3.12-minimal:arm64 depends on libssl3 (>= 3.0.0).
 93s  libnvme1 depends on libssl3 (>= 3.0.0).
 93s  libkrb5-3:arm64 depends on libssl3 (>= 3.0.0).
 93s  libkmod2:arm64 depends on libssl3 (>= 3.0.0).
 93s  libfido2-1:arm64 depends on libssl3 (>= 3.0.0).
 93s  libcurl4:arm64 depends on libssl3 (>= 3.0.0).
 93s  libcryptsetup12:arm64 depends on libssl3 (>= 3.0.0).
 93s  kmod depends on libssl3 (>= 3.0.0).
 93s  dhcpcd-base depends on libssl3 (>= 3.0.0).
 93s  bind9-libs:arm64 depends on libssl3 (>= 3.0.0).
 93s 
 93s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74758 files and directories currently installed.)
 93s Removing libssl3:arm64 (3.0.10-1ubuntu4) ...
 94s Selecting previously unselected package libssl3t64:arm64.
 94s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74747 files and directories currently installed.)
 94s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_arm64.deb ...
 94s Unpacking libssl3t64:arm64 (3.0.13-0ubuntu2) ...
 94s Setting up libssl3t64:arm64 (3.0.13-0ubuntu2) ...
 94s Setting up openssl (3.0.13-0ubuntu2) ...
 94s Processing triggers for man-db (2.12.0-3) ...
 95s Processing triggers for libc-bin (2.39-0ubuntu2) ...
 95s Reading package lists...
 95s Building dependency tree...
 95s Reading state information...
 96s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
104s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease
104s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease
104s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease
104s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease
106s Reading package lists...
106s Reading package lists...
106s Building dependency tree...
106s Reading state information...
107s Calculating upgrade...
107s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
107s Reading package lists...
108s Building dependency tree...
108s Reading state information...
108s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
111s autopkgtest [15:57:32]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP PREEMPT_DYNAMIC Wed Feb 14 02:53:31 UTC 2024
111s autopkgtest [15:57:32]: @@@@@@@@@@@@@@@@@@@@ apt-source seqkit
115s Get:1 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (dsc) [2502 B]
115s Get:2 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (tar) [16.4 MB]
115s Get:3 http://ftpmaster.internal/ubuntu noble/universe seqkit 2.3.1+ds-2 (diff) [10.8 MB]
115s gpgv: Signature made Mon Dec 25 17:00:09 2023 UTC
115s gpgv:                using EDDSA key A095B66EE09024BEE6A2F0722A27904BD7243EDA
115s gpgv: Can't check signature: No public key
115s dpkg-source: warning: cannot verify inline signature for ./seqkit_2.3.1+ds-2.dsc: no acceptable signature found
117s autopkgtest [15:57:38]: testing package seqkit version 2.3.1+ds-2
119s autopkgtest [15:57:40]: build not needed
122s autopkgtest [15:57:43]: test run-unit-test: preparing testbed
129s Reading package lists...
129s Building dependency tree...
129s Reading state information...
130s Starting pkgProblemResolver with broken count: 0
130s Starting 2 pkgProblemResolver with broken count: 0
130s Done
131s The following additional packages will be installed:
131s   seqkit seqkit-examples ssshtest
131s The following NEW packages will be installed:
131s   autopkgtest-satdep seqkit seqkit-examples ssshtest
131s 0 upgraded, 4 newly installed, 0 to remove and 0 not upgraded.
131s Need to get 47.3 MB/47.3 MB of archives.
131s After this operation, 55.7 MB of additional disk space will be used.
131s Get:1 /tmp/autopkgtest.i6hedx/1-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [724 B]
131s Get:2 http://ftpmaster.internal/ubuntu noble/universe arm64 seqkit arm64 2.3.1+ds-2 [7617 kB]
132s Get:3 http://ftpmaster.internal/ubuntu noble/universe arm64 seqkit-examples all 2.3.1+ds-2 [39.7 MB]
134s Get:4 http://ftpmaster.internal/ubuntu noble/universe arm64 ssshtest all 0.0+git20220105.0d6df3d-1 [6716 B]
135s Fetched 47.3 MB in 4s (13.3 MB/s)
135s Selecting previously unselected package seqkit.
135s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74760 files and directories currently installed.)
135s Preparing to unpack .../seqkit_2.3.1+ds-2_arm64.deb ...
135s Unpacking seqkit (2.3.1+ds-2) ...
135s Selecting previously unselected package seqkit-examples.
135s Preparing to unpack .../seqkit-examples_2.3.1+ds-2_all.deb ...
135s Unpacking seqkit-examples (2.3.1+ds-2) ...
135s Selecting previously unselected package ssshtest.
135s Preparing to unpack .../ssshtest_0.0+git20220105.0d6df3d-1_all.deb ...
135s Unpacking ssshtest (0.0+git20220105.0d6df3d-1) ...
135s Selecting previously unselected package autopkgtest-satdep.
135s Preparing to unpack .../1-autopkgtest-satdep.deb ...
135s Unpacking autopkgtest-satdep (0) ...
135s Setting up seqkit (2.3.1+ds-2) ...
135s Setting up ssshtest (0.0+git20220105.0d6df3d-1) ...
135s Setting up seqkit-examples (2.3.1+ds-2) ...
135s Setting up autopkgtest-satdep (0) ...
135s Processing triggers for man-db (2.12.0-3) ...
140s (Reading database ... 74844 files and directories currently installed.)
140s Removing autopkgtest-satdep (0) ...
140s autopkgtest [15:58:01]: test run-unit-test: [-----------------------
141s dpkg-architecture: warning: cannot determine CC system type, falling back to default (native compilation)
142s 
142s seq_content ran in 0 sec with 0/92461 lines to STDERR/OUT
142s  PASS "28645" == "28645" (LINE 28)
142s  PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 30)
143s 
143s seq_type ran in 0 sec with 2/0 lines to STDERR/OUT
143s  PASS STDERR CONTAINS "invalid DNAredundant letter" (LINE 36)
143s 
143s seq_type ran in 1 sec with 0/2 lines to STDERR/OUT
143s  PASS STDOUT CONTAINS "Protein" (LINE 42)
143s 
143s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT
143s  PASS STDOUT CONTAINS "RNA" (LINE 48)
143s 
143s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT
143s  PASS STDOUT CONTAINS "DNA" (LINE 54)
143s 
143s seq_type ran in 0 sec with 0/2 lines to STDERR/OUT
143s  PASS STDOUT CONTAINS "DNA" (LINE 60)
143s  PASS STDOUT CONTAINS "FASTQ" (LINE 61)
143s 
143s seq_head ran in 0 sec with 0/28645 lines to STDERR/OUT
143s  PASS "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" == "9a68be1d7fe7624e3e458c0668510e87866cc7d43adf7ac4b45b16cdd99c06a4" (LINE 68)
143s 
143s seq_id ran in 0 sec with 0/28645 lines to STDERR/OUT
143s  PASS "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" == "d26123067a04a50524694f3a2f8ecd92029b7cf9844c0e7d59f6e3b520a54604" (LINE 72)
143s 
143s seq_seq ran in 0 sec with 0/28645 lines to STDERR/OUT
144s  PASS "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" == "8b7575e91b71d38b53344e8663c28d2a0ac8860d2852d3a360a9b586bb187b47" (LINE 76)
144s 
144s seq_revcom ran in 0 sec with 1/3 lines to STDERR/OUT
144s [WARN] flag -t (--seq-type) (DNA/RNA) is recommended for computing complement sequences
144s  PASS "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" == "13e319c5055cf33c4d6b0b4aa50c6b16315d7e5605264ca814f76bb3d9759f5e" (LINE 88)
144s 
144s seq_rmgap_lowercapse ran in 0 sec with 0/2 lines to STDERR/OUT
144s  PASS STDOUT CONTAINS "acgtactgcacc" (LINE 95)
144s 
144s seq_rna2dna ran in 0 sec with 0/2 lines to STDERR/OUT
144s  PASS STDOUT CONTAINS "TCATATGCTTGTCTCAAAGATTA" (LINE 102)
144s 
144s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT
144s  PASS "a" == "a" (LINE 117)
144s 
144s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT
144s  PASS "acgtnACGTN" == "acgtnACGTN" (LINE 123)
144s 
144s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT
144s  PASS "gtn" == "gtn" (LINE 129)
144s 
144s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT
144s  PASS "ACG" == "ACG" (LINE 135)
144s 
144s subseq_region ran in 0 sec with 0/1 lines to STDERR/OUT
144s  PASS "N" == "N" (LINE 141)
144s 
144s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT
144s  PASS "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" == "00aab2c62c2ee50620205249eeba0065ebb2b1c8cfb7f37772ec6915cc6f2a75" (LINE 152)
145s 
145s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT
145s  PASS "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" == "28109da5ca7cbd0bcb0ad1932bfcfc63de1bb4199d123daadc1d3173385c931a" (LINE 158)
145s 
145s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT
145s  PASS "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" == "20b242aebba1aa5872f36f56dca7ce0785be42ff9c307399ed46abf240195256" (LINE 164)
146s 
146s subseq_gtf ran in 0 sec with 2/2 lines to STDERR/OUT
146s  PASS "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" == "f3ab3ba453e52cecba76b42359e3f1a1b67b434bff0561c0347f3676f5455f2d" (LINE 170)
146s 
146s sliding ran in 0 sec with 0/2 lines to STDERR/OUT
146s  PASS "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" == "15090ebb16bfed4190463187a500259b4857e754b8ac7a426a66bb44fc44d009" (LINE 184)
146s 
146s fx2tab_tab2fx ran in 0 sec with 0/92461 lines to STDERR/OUT
146s  PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 197)
146s 
146s fq2fa ran in 0 sec with 1/0 lines to STDERR/OUT
146s [ERRO] stat tests/reads_1.fq.gz: no such file or directory
146s [ERRO] xopen: no content
146s  PASS "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" == "e3b0c44298fc1c149afbf4c8996fb92427ae41e4649b934ca495991b7852b855" (LINE 202)
147s 
147s fx2tab_qual_len ran in 0 sec with 0/0 lines to STDERR/OUT
147s Length correlation:
147s  PASS "1" == "1" (LINE 220)
147s Length correlation:
147s  PASS "1" == "1" (LINE 224)
147s Qual correlation:
147s  PASS "1" == "1" (LINE 228)
147s 
147s grep_by_regexp ran in 0 sec with 0/5540 lines to STDERR/OUT
147s  PASS "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" == "b263150c6d2017ed2cc98379098517a0077173752ff0c10415d73793610f8729" (LINE 238)
147s 
147s grep_by_list_all ran in 0 sec with 1/92461 lines to STDERR/OUT
147s  PASS "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" == "fc5d600a3a934c3fb355c5ee46481661632747c2fb535ca8928b65324f114931" (LINE 244)
148s 
148s grep_by_list_head100 ran in 0 sec with 1/299 lines to STDERR/OUT
148s  PASS "100" == "100" (LINE 249)
148s 
148s grep_by_regexp_list ran in 0 sec with 1/9075 lines to STDERR/OUT
148s  PASS "3074" == "3074" (LINE 254)
148s 
148s rmdup ran in 0 sec with 1/2 lines to STDERR/OUT
148s  PASS STDERR CONTAINS "9 duplicated records removed" (LINE 277)
148s  PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 278)
148s /usr/bin/ssshtest: line 207: export: `-s=1': not a valid identifier
148s 
148s rmdup -s ran in 0 sec with 1/2 lines to STDERR/OUT
148s  PASS STDERR CONTAINS "9 duplicated records removed" (LINE 284)
148s  PASS "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" == "857c73895e39669b16a973aac95c27700c2c712b02416af899f9b1a19543e8be" (LINE 285)
148s [INFO] 0 duplicated records removed
148s [INFO] sample by proportion
148s [INFO] 2814 sequences outputted
148s 
148s common ran in 0 sec with 5/0 lines to STDERR/OUT
148s  PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 299)
148s 
148s split ran in 0 sec with 104/0 lines to STDERR/OUT
148s [INFO] 0 duplicated records removed
149s  PASS "100" == "100" (LINE 316)
149s [INFO] 0 duplicated records removed
149s  PASS "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" == "5b3b70e837832edf3d3038dc4f4d2031e6874cebeef1849cb5dadf49b0bcfc76" (LINE 317)
149s [INFO] sample by proportion
149s [INFO] 2814 sequences outputted
149s [INFO] sample by proportion
149s [INFO] 2814 sequences outputted
149s  PASS "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" == "85d7d80a0c1a500dd55537ab699dd81d3bbbb782896ecbc004c8d17cfd4ec1ea" (LINE 324)
149s 
149s head ran in 0 sec with 0/30 lines to STDERR/OUT
149s  PASS "10" == "10" (LINE 332)
149s  PASS "snq" == "snq" (LINE 341)
149s  PASS "seq_2" == "seq_2" (LINE 350)
149s 
149s restart ran in 0 sec with 0/2 lines to STDERR/OUT
149s  PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 364)
149s 
149s restart2 ran in 0 sec with 0/2 lines to STDERR/OUT
149s  PASS "ACGTNacgtn" == "ACGTNacgtn" (LINE 370)
150s 
150s shuffle ran in 1 sec with 20/0 lines to STDERR/OUT
150s  PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 389)
150s  PASS "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" == "f446937518adb748c19b9c846f00e08bbddecffe7bd38ba36033c120658f1679" (LINE 390)
150s  PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 393)
151s  PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 394)
151s  PASS "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" == "06ff818a9abfc3e221cd5f1f98b094e1811109739543c53a817d41ca9dec4860" (LINE 395)
151s 
151s bam_acc ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 422)
151s 
151s bam_mean_qual ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 432)
151s 
151s bam_map_qual ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 442)
151s 
151s bam_read_len ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 452)
151s 
151s bam_read_aln ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 462)
151s 
151s bam_left_clip ran in 0 sec with 0/0 lines to STDERR/OUT
151s Correlation:
151s  PASS "1" == "1" (LINE 475)
152s 
152s bam_right_clip ran in 1 sec with 0/0 lines to STDERR/OUT
152s Correlation:
152s  PASS "1" == "1" (LINE 488)
152s 
152s bam_bundler ran in 0 sec with 13/9 lines to STDERR/OUT
152s  PASS "0" == "0" (LINE 498)
152s 
152s bam_fish_regression ran in 0 sec with 0/0 lines to STDERR/OUT
152s  PASS EXIT CODE (LINE 516)
152s 
152s sana_fasta_regression ran in 0 sec with 7/0 lines to STDERR/OUT
152s  PASS "0" == "0" (LINE 530)
152s 
152s sana_fastq_regression_empty_line ran in 0 sec with 17/0 lines to STDERR/OUT
152s  PASS "0" == "0" (LINE 541)
152s 
152s sana_fasta_regression_empty_line ran in 0 sec with 1/0 lines to STDERR/OUT
152s  PASS "0" == "0" (LINE 549)
153s 
153s sana_fastq_regression ran in 0 sec with 1/0 lines to STDERR/OUT
153s  PASS "0" == "0" (LINE 557)
156s 
156s scat_fasta ran in 4 sec with 261/0 lines to STDERR/OUT
156s  PASS "0" == "0" (LINE 606)
156s  PASS "0" == "0" (LINE 608)
160s 
160s scat_fastq ran in 3 sec with 531/0 lines to STDERR/OUT
160s  PASS "0" == "0" (LINE 652)
160s  PASS "0" == "0" (LINE 654)
160s [INFO] sample by number
160s [INFO] loading all sequences into memory...
160s [INFO] 9 sequences outputted
160s 
160s [INFO] read sequences ...
160s faidx_id ran in 0 sec with 0/0 lines to STDERR/OUT
160s  PASS "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" == "371eefa89a4543b704374ef7db14b455f2e23abc330b35e88e147c7bc4c842b2" (LINE 670)
160s [INFO] 9 patterns loaded from file
160s [INFO] 9 sequences loaded
160s [INFO] sorting ...
160s [INFO] output ...
160s [INFO] read sequences ...
160s [INFO] 9 sequences loaded
160s [INFO] sorting ...
160s [INFO] output ...
160s 
160s faidx_full_head ran in 0 sec with 0/0 lines to STDERR/OUT
160s [INFO] read sequences ...
160s [INFO] 9 patterns loaded from file
160s [INFO] 9 sequences loaded
160s [INFO] sorting ...
160s [INFO] output ...
160s [INFO] read sequences ...
160s [INFO] 9 sequences loaded
160s [INFO] sorting ...
160s [INFO] output ...
160s  PASS "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" == "67bc4bc7b1f464cccf9f47161b8c1b517c3711aec401441f5eaaee2ad981c489" (LINE 677)
160s 
160s faidx_region ran in 0 sec with 0/0 lines to STDERR/OUT
160s  PASS "GCAGCUGCAGCAUUAUCAAGAUUCACAUAGAAAUCAUGUGGGGCAGAAAACAUAGGUUCUAAAAAUCUAACCCCAAGUUCUUUGAACAUGAGAAUCUUGAUGAUGCUGCAUCAGCA" == "GCAGCUGCAGCAUUAUCAAGAUUCACAUAGAAAUCAUGUGGGGCAGAAAACAUAGGUUCUAAAAAUCUAACCCCAAGUUCUUUGAACAUGAGAAUCUUGAUGAUGCUGCAUCAGCA" (LINE 686)
160s 
160s sshtest v0.1.5
160s 
160s 71        Tests
160s 0         Failures
160s 71        Successes
161s autopkgtest [15:58:22]: test run-unit-test: -----------------------]
161s run-unit-test        PASS
161s autopkgtest [15:58:22]: test run-unit-test:  - - - - - - - - - - results - - - - - - - - - -
162s autopkgtest [15:58:23]: @@@@@@@@@@@@@@@@@@@@ summary
162s run-unit-test        PASS
181s Creating nova instance adt-noble-arm64-seqkit-20240318-155541-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-arm64-server-20240318.img (UUID 6b9ea2ac-1792-4f95-a56d-e128e96ab6e9)...