0s autopkgtest [03:14:20]: starting date: 2024-03-11 0s autopkgtest [03:14:20]: git checkout: d9c0295 adt_testbed.py: supress warnings from apt using a shell pipeline 0s autopkgtest [03:14:20]: host juju-7f2275-prod-proposed-migration-environment-2; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.vxflv0jf/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:perl,src:db5.3,src:gdbm,src:mmdebstrap --apt-upgrade ncbi-blast+ --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=perl/5.38.2-3.2 db5.3/5.3.28+dfsg2-5 gdbm/1.23-5.1 mmdebstrap/1.4.3-6' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-2@bos02-arm64-6.secgroup --name adt-noble-arm64-ncbi-blast+-20240311-031419-juju-7f2275-prod-proposed-migration-environment-2 --image adt/ubuntu-noble-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-2 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 158s autopkgtest [03:16:58]: @@@@@@@@@@@@@@@@@@@@ test bed setup 158s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 159s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [433 kB] 160s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [37.3 kB] 160s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [2615 kB] 161s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [3976 B] 161s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 Packages [582 kB] 162s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 c-n-f Metadata [3144 B] 162s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 Packages [20.3 kB] 162s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 c-n-f Metadata [116 B] 162s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 Packages [2966 kB] 162s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 c-n-f Metadata [8528 B] 162s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 Packages [39.6 kB] 162s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 c-n-f Metadata [116 B] 170s Fetched 6826 kB in 5s (1373 kB/s) 171s Reading package lists... 184s Reading package lists... 185s Building dependency tree... 185s Reading state information... 186s Calculating upgrade... 188s The following packages were automatically installed and are no longer required: 188s libgdbm-compat4t64 libperl5.38 lto-disabled-list make perl-modules-5.38 188s Use 'sudo apt autoremove' to remove them. 188s The following packages will be REMOVED: 188s dpkg-dev libdpkg-perl libgdbm-compat4 libgdbm6 perl 188s The following NEW packages will be installed: 188s libgdbm-compat4t64 libgdbm6t64 188s The following packages have been kept back: 188s libperl5.38 188s The following packages will be upgraded: 188s perl-base perl-modules-5.38 188s 2 upgraded, 2 newly installed, 5 to remove and 1 not upgraded. 188s Need to get 4928 kB of archives. 188s After this operation, 4158 kB disk space will be freed. 188s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl-base arm64 5.38.2-3.2 [1777 kB] 189s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libgdbm6t64 arm64 1.23-5.1 [34.3 kB] 189s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libgdbm-compat4t64 arm64 1.23-5.1 [6576 B] 189s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl-modules-5.38 all 5.38.2-3.2 [3110 kB] 190s Fetched 4928 kB in 1s (5475 kB/s) 191s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75856 files and directories currently installed.) 191s Removing dpkg-dev (1.22.4ubuntu5) ... 191s Removing libdpkg-perl (1.22.4ubuntu5) ... 191s Removing perl (5.38.2-3) ... 192s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75275 files and directories currently installed.) 192s Preparing to unpack .../perl-base_5.38.2-3.2_arm64.deb ... 192s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ... 193s Setting up perl-base (5.38.2-3.2) ... 193s dpkg: libgdbm6:arm64: dependency problems, but removing anyway as you requested: 193s python3-gdbm:arm64 depends on libgdbm6 (>= 1.16). 193s man-db depends on libgdbm6 (>= 1.16). 193s libperl5.38:arm64 depends on libgdbm6 (>= 1.21). 193s libgdbm-compat4:arm64 depends on libgdbm6 (>= 1.16). 193s 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75275 files and directories currently installed.) 193s Removing libgdbm6:arm64 (1.23-5) ... 193s Selecting previously unselected package libgdbm6t64:arm64. 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75270 files and directories currently installed.) 193s Preparing to unpack .../libgdbm6t64_1.23-5.1_arm64.deb ... 193s Unpacking libgdbm6t64:arm64 (1.23-5.1) ... 193s dpkg: libgdbm-compat4:arm64: dependency problems, but removing anyway as you requested: 193s libperl5.38:arm64 depends on libgdbm-compat4 (>= 1.18-3). 193s 193s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75276 files and directories currently installed.) 193s Removing libgdbm-compat4:arm64 (1.23-5) ... 194s Selecting previously unselected package libgdbm-compat4t64:arm64. 194s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75271 files and directories currently installed.) 194s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_arm64.deb ... 194s Unpacking libgdbm-compat4t64:arm64 (1.23-5.1) ... 194s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ... 194s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ... 196s Setting up libgdbm6t64:arm64 (1.23-5.1) ... 196s Setting up libgdbm-compat4t64:arm64 (1.23-5.1) ... 196s Setting up perl-modules-5.38 (5.38.2-3.2) ... 196s Processing triggers for man-db (2.12.0-3) ... 198s Processing triggers for libc-bin (2.39-0ubuntu2) ... 199s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 199s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 199s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 200s Reading package lists... 201s Building dependency tree... 201s Reading state information... 203s The following packages will be REMOVED: 203s libgdbm-compat4t64* libperl5.38* lto-disabled-list* make* perl-modules-5.38* 204s 0 upgraded, 0 newly installed, 5 to remove and 0 not upgraded. 204s After this operation, 52.0 MB disk space will be freed. 204s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75277 files and directories currently installed.) 204s Removing libperl5.38:arm64 (5.38.2-3) ... 204s Removing libgdbm-compat4t64:arm64 (1.23-5.1) ... 204s Removing lto-disabled-list (47) ... 204s Removing make (4.3-4.1build1) ... 204s Removing perl-modules-5.38 (5.38.2-3.2) ... 205s Processing triggers for man-db (2.12.0-3) ... 205s Processing triggers for libc-bin (2.39-0ubuntu2) ... 208s sh: Attempting to set up Debian/Ubuntu apt sources automatically 208s sh: Distribution appears to be Ubuntu 218s Reading package lists... 219s Building dependency tree... 219s Reading state information... 221s eatmydata is already the newest version (131-1). 221s dbus is already the newest version (1.14.10-4ubuntu1). 221s dbus set to manually installed. 221s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 221s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 221s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 221s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 222s Reading package lists... 222s Building dependency tree... 222s Reading state information... 224s rng-tools-debian is already the newest version (2.4). 224s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 225s Reading package lists... 225s Building dependency tree... 225s Reading state information... 227s haveged is already the newest version (1.9.14-1ubuntu1). 227s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 228s Reading package lists... 229s Building dependency tree... 229s Reading state information... 231s The following additional packages will be installed: 231s libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 lto-disabled-list 231s make perl perl-modules-5.38 231s Suggested packages: 231s debian-keyring gcc | c-compiler git bzr make-doc perl-doc 231s libterm-readline-gnu-perl | libterm-readline-perl-perl 231s libtap-harness-archive-perl 231s Recommended packages: 231s build-essential gcc | c-compiler fakeroot libalgorithm-merge-perl 231s libfile-fcntllock-perl 231s The following packages will be REMOVED: 231s libdb5.3 231s The following NEW packages will be installed: 231s dpkg-dev libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 231s lto-disabled-list make perl perl-modules-5.38 231s 0 upgraded, 9 newly installed, 1 to remove and 0 not upgraded. 231s Need to get 7257 kB/10.4 MB of archives. 231s After this operation, 56.1 MB of additional disk space will be used. 231s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libdb5.3t64 arm64 5.3.28+dfsg2-5 [719 kB] 232s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libperl5.38t64 arm64 5.38.2-3.2 [4771 kB] 234s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl arm64 5.38.2-3.2 [231 kB] 234s Get:4 http://ftpmaster.internal/ubuntu noble/main arm64 libdpkg-perl all 1.22.4ubuntu5 [268 kB] 234s Get:5 http://ftpmaster.internal/ubuntu noble/main arm64 make arm64 4.3-4.1build1 [177 kB] 234s Get:6 http://ftpmaster.internal/ubuntu noble/main arm64 lto-disabled-list all 47 [12.4 kB] 234s Get:7 http://ftpmaster.internal/ubuntu noble/main arm64 dpkg-dev all 1.22.4ubuntu5 [1078 kB] 236s Fetched 7257 kB in 3s (2192 kB/s) 236s dpkg: libdb5.3:arm64: dependency problems, but removing anyway as you requested: 236s libsasl2-modules-db:arm64 depends on libdb5.3. 236s libpython3.12-stdlib:arm64 depends on libdb5.3. 236s libpython3.11-stdlib:arm64 depends on libdb5.3. 236s libpam-modules:arm64 depends on libdb5.3. 236s iproute2 depends on libdb5.3. 236s apt-utils depends on libdb5.3. 236s 236s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73306 files and directories currently installed.) 236s Removing libdb5.3:arm64 (5.3.28+dfsg2-4) ... 236s Selecting previously unselected package libdb5.3t64:arm64. 236s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73300 files and directories currently installed.) 236s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-5_arm64.deb ... 236s Unpacking libdb5.3t64:arm64 (5.3.28+dfsg2-5) ... 236s Setting up libdb5.3t64:arm64 (5.3.28+dfsg2-5) ... 236s Selecting previously unselected package perl-modules-5.38. 237s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 73306 files and directories currently installed.) 237s Preparing to unpack .../0-perl-modules-5.38_5.38.2-3.2_all.deb ... 237s Unpacking perl-modules-5.38 (5.38.2-3.2) ... 238s Selecting previously unselected package libgdbm-compat4t64:arm64. 238s Preparing to unpack .../1-libgdbm-compat4t64_1.23-5.1_arm64.deb ... 238s Unpacking libgdbm-compat4t64:arm64 (1.23-5.1) ... 238s Selecting previously unselected package libperl5.38t64:arm64. 238s Preparing to unpack .../2-libperl5.38t64_5.38.2-3.2_arm64.deb ... 238s Unpacking libperl5.38t64:arm64 (5.38.2-3.2) ... 240s Selecting previously unselected package perl. 240s Preparing to unpack .../3-perl_5.38.2-3.2_arm64.deb ... 240s Unpacking perl (5.38.2-3.2) ... 240s Selecting previously unselected package libdpkg-perl. 240s Preparing to unpack .../4-libdpkg-perl_1.22.4ubuntu5_all.deb ... 240s Unpacking libdpkg-perl (1.22.4ubuntu5) ... 240s Selecting previously unselected package make. 240s Preparing to unpack .../5-make_4.3-4.1build1_arm64.deb ... 240s Unpacking make (4.3-4.1build1) ... 240s Selecting previously unselected package lto-disabled-list. 240s Preparing to unpack .../6-lto-disabled-list_47_all.deb ... 240s Unpacking lto-disabled-list (47) ... 240s Selecting previously unselected package dpkg-dev. 240s Preparing to unpack .../7-dpkg-dev_1.22.4ubuntu5_all.deb ... 240s Unpacking dpkg-dev (1.22.4ubuntu5) ... 241s Setting up lto-disabled-list (47) ... 241s Setting up libgdbm-compat4t64:arm64 (1.23-5.1) ... 241s Setting up make (4.3-4.1build1) ... 241s Setting up perl-modules-5.38 (5.38.2-3.2) ... 241s Setting up libperl5.38t64:arm64 (5.38.2-3.2) ... 241s Setting up perl (5.38.2-3.2) ... 241s Setting up libdpkg-perl (1.22.4ubuntu5) ... 241s Setting up dpkg-dev (1.22.4ubuntu5) ... 241s Processing triggers for man-db (2.12.0-3) ... 243s Processing triggers for libc-bin (2.39-0ubuntu2) ... 244s Reading package lists... 244s Building dependency tree... 244s Reading state information... 246s The following packages will be REMOVED: 246s cloud-init* python3-configobj* python3-debconf* 247s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 247s After this operation, 3248 kB disk space will be freed. 247s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75858 files and directories currently installed.) 247s Removing cloud-init (24.1-0ubuntu1) ... 250s Removing python3-configobj (5.0.8-3) ... 250s Removing python3-debconf (1.5.86) ... 250s Processing triggers for man-db (2.12.0-3) ... 251s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75469 files and directories currently installed.) 251s Purging configuration files for cloud-init (24.1-0ubuntu1) ... 254s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 254s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 255s Reading package lists... 256s Building dependency tree... 256s Reading state information... 258s linux-generic is already the newest version (6.8.0-11.11+1). 258s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 259s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 259s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 259s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 259s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease 259s Hit:5 http://ftpmaster.internal/ubuntu noble-backports InRelease 271s Reading package lists... 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 271s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 271s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 272s Reading package lists... 272s Building dependency tree... 272s Reading state information... 274s Calculating upgrade... 275s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 275s Reading package lists... 276s Building dependency tree... 276s Reading state information... 278s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 278s autopkgtest [03:18:58]: rebooting testbed after setup commands that affected boot 442s autopkgtest [03:21:42]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP PREEMPT_DYNAMIC Wed Feb 14 02:53:31 UTC 2024 442s autopkgtest [03:21:42]: testbed dpkg architecture: arm64 444s autopkgtest [03:21:44]: @@@@@@@@@@@@@@@@@@@@ apt-source ncbi-blast+ 446s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:1 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:2 and /etc/apt/sources.list.d/ubuntu.sources:1 446s W: Target Packages (main/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (main/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (main/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (main/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (universe/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (universe/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (universe/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (universe/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (restricted/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (restricted/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (restricted/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (restricted/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (multiverse/binary-arm64/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target Packages (multiverse/binary-all/Packages) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (multiverse/cnf/Commands-arm64) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 446s W: Target CNF (multiverse/cnf/Commands-all) is configured multiple times in /etc/apt/sources.list:3 and /etc/apt/sources.list.d/ubuntu.sources:2 458s Get:1 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (dsc) [2311 B] 458s Get:2 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (tar) [47.5 MB] 458s Get:3 http://ftpmaster.internal/ubuntu noble/universe ncbi-blast+ 2.12.0+ds-4 (diff) [33.5 kB] 458s gpgv: Signature made Tue Sep 5 02:41:47 2023 UTC 458s gpgv: using RSA key 7C3AB9CFD230BD30DD009C591E7091B1F14A64A2 458s gpgv: Can't check signature: No public key 458s dpkg-source: warning: cannot verify inline signature for ./ncbi-blast+_2.12.0+ds-4.dsc: no acceptable signature found 470s autopkgtest [03:22:10]: testing package ncbi-blast+ version 2.12.0+ds-4 470s autopkgtest [03:22:10]: build not needed 479s autopkgtest [03:22:19]: test run-unit-test: preparing testbed 483s Reading package lists... 484s Building dependency tree... 484s Reading state information... 485s Correcting dependencies...Starting pkgProblemResolver with broken count: 0 485s Starting 2 pkgProblemResolver with broken count: 0 485s Done 485s Done 486s Starting pkgProblemResolver with broken count: 0 487s Starting 2 pkgProblemResolver with broken count: 0 487s Done 488s The following additional packages will be installed: 488s libgomp1 libmbedcrypto7 libmbedtls14 libmbedx509-1 ncbi-blast+ 488s ncbi-blast+-legacy ncbi-data 488s The following NEW packages will be installed: 488s libgomp1 libmbedcrypto7 libmbedtls14 libmbedx509-1 ncbi-blast+ 488s ncbi-blast+-legacy ncbi-data 488s 0 upgraded, 7 newly installed, 0 to remove and 0 not upgraded. 488s 1 not fully installed or removed. 488s Need to get 17.0 MB of archives. 488s After this operation, 76.6 MB of additional disk space will be used. 488s Get:1 http://ftpmaster.internal/ubuntu noble/universe arm64 ncbi-data all 6.1.20170106+dfsg1-10 [4395 kB] 490s Get:2 http://ftpmaster.internal/ubuntu noble/main arm64 libgomp1 arm64 14-20240303-1ubuntu1 [144 kB] 490s Get:3 http://ftpmaster.internal/ubuntu noble/universe arm64 libmbedcrypto7 arm64 2.28.7-1ubuntu1 [206 kB] 490s Get:4 http://ftpmaster.internal/ubuntu noble/universe arm64 libmbedx509-1 arm64 2.28.7-1ubuntu1 [46.8 kB] 490s Get:5 http://ftpmaster.internal/ubuntu noble/universe arm64 libmbedtls14 arm64 2.28.7-1ubuntu1 [82.0 kB] 490s Get:6 http://ftpmaster.internal/ubuntu noble/universe arm64 ncbi-blast+ arm64 2.12.0+ds-4 [12.1 MB] 492s Get:7 http://ftpmaster.internal/ubuntu noble/universe arm64 ncbi-blast+-legacy all 2.12.0+ds-4 [4984 B] 493s Fetched 17.0 MB in 3s (5049 kB/s) 493s Selecting previously unselected package ncbi-data. 493s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75414 files and directories currently installed.) 493s Preparing to unpack .../0-ncbi-data_6.1.20170106+dfsg1-10_all.deb ... 493s Unpacking ncbi-data (6.1.20170106+dfsg1-10) ... 494s Selecting previously unselected package libgomp1:arm64. 494s Preparing to unpack .../1-libgomp1_14-20240303-1ubuntu1_arm64.deb ... 494s Unpacking libgomp1:arm64 (14-20240303-1ubuntu1) ... 494s Selecting previously unselected package libmbedcrypto7:arm64. 494s Preparing to unpack .../2-libmbedcrypto7_2.28.7-1ubuntu1_arm64.deb ... 494s Unpacking libmbedcrypto7:arm64 (2.28.7-1ubuntu1) ... 494s Selecting previously unselected package libmbedx509-1:arm64. 494s Preparing to unpack .../3-libmbedx509-1_2.28.7-1ubuntu1_arm64.deb ... 494s Unpacking libmbedx509-1:arm64 (2.28.7-1ubuntu1) ... 494s Selecting previously unselected package libmbedtls14:arm64. 494s Preparing to unpack .../4-libmbedtls14_2.28.7-1ubuntu1_arm64.deb ... 494s Unpacking libmbedtls14:arm64 (2.28.7-1ubuntu1) ... 494s Selecting previously unselected package ncbi-blast+. 494s Preparing to unpack .../5-ncbi-blast+_2.12.0+ds-4_arm64.deb ... 494s Unpacking ncbi-blast+ (2.12.0+ds-4) ... 496s Selecting previously unselected package ncbi-blast+-legacy. 496s Preparing to unpack .../6-ncbi-blast+-legacy_2.12.0+ds-4_all.deb ... 496s Unpacking ncbi-blast+-legacy (2.12.0+ds-4) ... 496s Setting up ncbi-data (6.1.20170106+dfsg1-10) ... 496s Setting up libgomp1:arm64 (14-20240303-1ubuntu1) ... 496s Setting up libmbedcrypto7:arm64 (2.28.7-1ubuntu1) ... 496s Setting up libmbedx509-1:arm64 (2.28.7-1ubuntu1) ... 496s Setting up libmbedtls14:arm64 (2.28.7-1ubuntu1) ... 496s Setting up ncbi-blast+ (2.12.0+ds-4) ... 496s Setting up ncbi-blast+-legacy (2.12.0+ds-4) ... 496s Setting up autopkgtest-satdep (0) ... 496s Processing triggers for man-db (2.12.0-3) ... 497s Processing triggers for libc-bin (2.39-0ubuntu2) ... 506s (Reading database ... 75682 files and directories currently installed.) 506s Removing autopkgtest-satdep (0) ... 507s autopkgtest [03:22:47]: test run-unit-test: [----------------------- 508s ---Creating Database-- 508s 508s 508s Building a new DB, current time: 03/11/2024 03:22:48 508s New DB name: /tmp/autopkgtest.cE3b6p/autopkgtest_tmp/testdb 508s New DB title: testdatabase.fa 508s Sequence type: Nucleotide 508s Keep MBits: T 508s Maximum file size: 1000000000B 508s Adding sequences from FASTA; added 3 sequences in 0.198376 seconds. 508s 508s 508s ---Searching Database for Hits--- 508s Warning: [blastn] Examining 5 or more matches is recommended 508s # BLASTN 2.12.0+ 508s # Query: gnl|MYDB|1 this is sequence 1 508s # Database: testdb 508s # Fields: query id, subject id, evalue, bit score 508s # 2 hits found 508s gnl|MYDB|1 gnl2 0.0 1299 508s gnl|MYDB|1 gnl1 0.0 1299 508s # BLAST processed 1 queries 508s ---Search and Fetch An Entry From Database--- 508s >gnl1 508s GAATTCCCGCTACAGGGGGGGCCTGAGGCACTGCAGAAAGTGGGCCTGAGCCTCGAGGATGACGGTGCTGCAGGAACCCG 508s TCCAGGCTGCTATATGGCAAGCACTAAACCACTATGCTTACCGAGATGCGGTTTTCCTCGCAGAACGCCTTTATGCAGAA 508s GTACACTCAGAAGAAGCCTTGTTTTTACTGGCAACCTGTTATTACCGCTCAGGAAAGGCATATAAAGCATATAGACTCTT 508s GAAAGGACACAGTTGTACTACACCGCAATGCAAATACCTGCTTGCAAAATGTTGTGTTGATCTCAGCAAGCTTGCAGAAG 508s GGGAACAAATCTTATCTGGTGGAGTGTTTAATAAGCAGAAAAGCCATGATGATATTGTTACTGAGTTTGGTGATTCAGCT 508s TGCTTTACTCTTTCATTGTTGGGACATGTATATTGCAAGACAGATCGGCTTGCCAAAGGATCAGAATGTTACCAAAAGAG 508s CCTTAGTTTAAATCCTTTCCTCTGGTCTCCCTTTGAATCATTATGTGAAATAGGTGAAAAGCCAGATCCTGACCAAACAT 508s TTAAATTCACATCTTTACAGAACTTTAGCAACTGTCTGCCCAACTCTTGCACAACACAAGTACCTAATCATAGTTTATCT 508s CACAGACAGCCTGAGACAGTTCTTACGGAAACACCCCAGGACACAATTGAATTAAACAGATTGAATTTAGAATCTTCCAA 508s PASS 509s autopkgtest [03:22:49]: test run-unit-test: -----------------------] 509s run-unit-test PASS 509s autopkgtest [03:22:49]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 510s autopkgtest [03:22:50]: @@@@@@@@@@@@@@@@@@@@ summary 510s run-unit-test PASS 547s Creating nova instance adt-noble-arm64-ncbi-blast+-20240311-031419-juju-7f2275-prod-proposed-migration-environment-2 from image adt/ubuntu-noble-arm64-server-20240310.img (UUID c166432c-3f89-460f-aeaa-f7e9d80d14b5)...