0s autopkgtest [03:12:04]: starting date: 2024-03-11
  0s autopkgtest [03:12:04]: git checkout: d9c0295 adt_testbed.py: supress warnings from apt using a shell pipeline
  0s autopkgtest [03:12:04]: host juju-7f2275-prod-proposed-migration-environment-3; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.tzuwsbbq/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:perl,src:db5.3,src:gdbm,src:mmdebstrap --apt-upgrade mummer --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=perl/5.38.2-3.2 db5.3/5.3.28+dfsg2-5 gdbm/1.23-5.1 mmdebstrap/1.4.3-6' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-3@bos03-arm64-14.secgroup --name adt-noble-arm64-mummer-20240311-031204-juju-7f2275-prod-proposed-migration-environment-3 --image adt/ubuntu-noble-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-3 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/
 99s autopkgtest [03:13:43]: @@@@@@@@@@@@@@@@@@@@ test bed setup
100s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB]
101s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [2615 kB]
101s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [433 kB]
101s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [3976 B]
101s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [37.3 kB]
101s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 Packages [582 kB]
101s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 c-n-f Metadata [3144 B]
101s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 Packages [20.3 kB]
101s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 c-n-f Metadata [116 B]
101s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 Packages [2966 kB]
101s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 c-n-f Metadata [8528 B]
101s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 Packages [39.6 kB]
101s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 c-n-f Metadata [116 B]
103s Fetched 6826 kB in 2s (3681 kB/s)
103s Reading package lists...
106s Reading package lists...
106s Building dependency tree...
106s Reading state information...
106s Calculating upgrade...
107s The following packages were automatically installed and are no longer required:
107s   libgdbm-compat4t64 libperl5.38 lto-disabled-list make perl-modules-5.38
107s Use 'sudo apt autoremove' to remove them.
107s The following packages will be REMOVED:
107s   dpkg-dev libdpkg-perl libgdbm-compat4 libgdbm6 perl
107s The following NEW packages will be installed:
107s   libgdbm-compat4t64 libgdbm6t64
107s The following packages have been kept back:
107s   libperl5.38
107s The following packages will be upgraded:
107s   perl-base perl-modules-5.38
107s 2 upgraded, 2 newly installed, 5 to remove and 1 not upgraded.
107s Need to get 4928 kB of archives.
107s After this operation, 4158 kB disk space will be freed.
107s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl-base arm64 5.38.2-3.2 [1777 kB]
108s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libgdbm6t64 arm64 1.23-5.1 [34.3 kB]
108s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libgdbm-compat4t64 arm64 1.23-5.1 [6576 B]
108s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl-modules-5.38 all 5.38.2-3.2 [3110 kB]
109s Fetched 4928 kB in 1s (5098 kB/s)
109s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74748 files and directories currently installed.)
109s Removing dpkg-dev (1.22.4ubuntu5) ...
109s Removing libdpkg-perl (1.22.4ubuntu5) ...
109s Removing perl (5.38.2-3) ...
109s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74167 files and directories currently installed.)
109s Preparing to unpack .../perl-base_5.38.2-3.2_arm64.deb ...
109s Unpacking perl-base (5.38.2-3.2) over (5.38.2-3) ...
110s Setting up perl-base (5.38.2-3.2) ...
110s dpkg: libgdbm6:arm64: dependency problems, but removing anyway as you requested:
110s  python3-gdbm:arm64 depends on libgdbm6 (>= 1.16).
110s  man-db depends on libgdbm6 (>= 1.16).
110s  libperl5.38:arm64 depends on libgdbm6 (>= 1.21).
110s  libgdbm-compat4:arm64 depends on libgdbm6 (>= 1.16).
110s 
110s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74167 files and directories currently installed.)
110s Removing libgdbm6:arm64 (1.23-5) ...
110s Selecting previously unselected package libgdbm6t64:arm64.
110s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74162 files and directories currently installed.)
110s Preparing to unpack .../libgdbm6t64_1.23-5.1_arm64.deb ...
110s Unpacking libgdbm6t64:arm64 (1.23-5.1) ...
110s dpkg: libgdbm-compat4:arm64: dependency problems, but removing anyway as you requested:
110s  libperl5.38:arm64 depends on libgdbm-compat4 (>= 1.18-3).
110s 
110s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74168 files and directories currently installed.)
110s Removing libgdbm-compat4:arm64 (1.23-5) ...
110s Selecting previously unselected package libgdbm-compat4t64:arm64.
110s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74163 files and directories currently installed.)
110s Preparing to unpack .../libgdbm-compat4t64_1.23-5.1_arm64.deb ...
110s Unpacking libgdbm-compat4t64:arm64 (1.23-5.1) ...
110s Preparing to unpack .../perl-modules-5.38_5.38.2-3.2_all.deb ...
110s Unpacking perl-modules-5.38 (5.38.2-3.2) over (5.38.2-3) ...
110s Setting up libgdbm6t64:arm64 (1.23-5.1) ...
110s Setting up libgdbm-compat4t64:arm64 (1.23-5.1) ...
110s Setting up perl-modules-5.38 (5.38.2-3.2) ...
110s Processing triggers for man-db (2.12.0-3) ...
111s Processing triggers for libc-bin (2.39-0ubuntu2) ...
112s Reading package lists...
112s Building dependency tree...
112s Reading state information...
113s The following packages will be REMOVED:
113s   libgdbm-compat4t64* libperl5.38* lto-disabled-list* make* perl-modules-5.38*
113s 0 upgraded, 0 newly installed, 5 to remove and 0 not upgraded.
113s After this operation, 52.0 MB disk space will be freed.
113s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74169 files and directories currently installed.)
113s Removing libperl5.38:arm64 (5.38.2-3) ...
113s Removing libgdbm-compat4t64:arm64 (1.23-5.1) ...
113s Removing lto-disabled-list (47) ...
113s Removing make (4.3-4.1build1) ...
113s Removing perl-modules-5.38 (5.38.2-3.2) ...
113s Processing triggers for man-db (2.12.0-3) ...
114s Processing triggers for libc-bin (2.39-0ubuntu2) ...
114s sh: Attempting to set up Debian/Ubuntu apt sources automatically
114s sh: Distribution appears to be Ubuntu
115s Reading package lists...
116s Building dependency tree...
116s Reading state information...
116s eatmydata is already the newest version (131-1).
116s dbus is already the newest version (1.14.10-4ubuntu1).
116s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
116s Reading package lists...
117s Building dependency tree...
117s Reading state information...
117s rng-tools-debian is already the newest version (2.4).
117s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
117s Reading package lists...
117s Building dependency tree...
117s Reading state information...
118s haveged is already the newest version (1.9.14-1ubuntu1).
118s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
118s Reading package lists...
118s Building dependency tree...
118s Reading state information...
119s The following additional packages will be installed:
119s   libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64 lto-disabled-list
119s   make perl perl-modules-5.38
119s Suggested packages:
119s   debian-keyring gcc | c-compiler git bzr make-doc perl-doc
119s   libterm-readline-gnu-perl | libterm-readline-perl-perl
119s   libtap-harness-archive-perl
119s Recommended packages:
119s   build-essential gcc | c-compiler fakeroot libalgorithm-merge-perl
119s   libfile-fcntllock-perl
119s The following packages will be REMOVED:
119s   libdb5.3
119s The following NEW packages will be installed:
119s   dpkg-dev libdb5.3t64 libdpkg-perl libgdbm-compat4t64 libperl5.38t64
119s   lto-disabled-list make perl perl-modules-5.38
119s 0 upgraded, 9 newly installed, 1 to remove and 0 not upgraded.
119s Need to get 7257 kB/10.4 MB of archives.
119s After this operation, 56.1 MB of additional disk space will be used.
119s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libdb5.3t64 arm64 5.3.28+dfsg2-5 [719 kB]
119s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libperl5.38t64 arm64 5.38.2-3.2 [4771 kB]
120s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 perl arm64 5.38.2-3.2 [231 kB]
120s Get:4 http://ftpmaster.internal/ubuntu noble/main arm64 libdpkg-perl all 1.22.4ubuntu5 [268 kB]
120s Get:5 http://ftpmaster.internal/ubuntu noble/main arm64 make arm64 4.3-4.1build1 [177 kB]
120s Get:6 http://ftpmaster.internal/ubuntu noble/main arm64 lto-disabled-list all 47 [12.4 kB]
120s Get:7 http://ftpmaster.internal/ubuntu noble/main arm64 dpkg-dev all 1.22.4ubuntu5 [1078 kB]
120s Fetched 7257 kB in 1s (5976 kB/s)
121s dpkg: libdb5.3:arm64: dependency problems, but removing anyway as you requested:
121s  libsasl2-modules-db:arm64 depends on libdb5.3.
121s  libpython3.12-stdlib:arm64 depends on libdb5.3.
121s  libpam-modules:arm64 depends on libdb5.3.
121s  iproute2 depends on libdb5.3.
121s  apt-utils depends on libdb5.3.
121s 
121s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 72198 files and directories currently installed.)
121s Removing libdb5.3:arm64 (5.3.28+dfsg2-4) ...
121s Selecting previously unselected package libdb5.3t64:arm64.
121s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 72192 files and directories currently installed.)
121s Preparing to unpack .../libdb5.3t64_5.3.28+dfsg2-5_arm64.deb ...
121s Unpacking libdb5.3t64:arm64 (5.3.28+dfsg2-5) ...
121s Setting up libdb5.3t64:arm64 (5.3.28+dfsg2-5) ...
121s Selecting previously unselected package perl-modules-5.38.
121s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 72198 files and directories currently installed.)
121s Preparing to unpack .../0-perl-modules-5.38_5.38.2-3.2_all.deb ...
121s Unpacking perl-modules-5.38 (5.38.2-3.2) ...
121s Selecting previously unselected package libgdbm-compat4t64:arm64.
121s Preparing to unpack .../1-libgdbm-compat4t64_1.23-5.1_arm64.deb ...
121s Unpacking libgdbm-compat4t64:arm64 (1.23-5.1) ...
121s Selecting previously unselected package libperl5.38t64:arm64.
121s Preparing to unpack .../2-libperl5.38t64_5.38.2-3.2_arm64.deb ...
121s Unpacking libperl5.38t64:arm64 (5.38.2-3.2) ...
121s Selecting previously unselected package perl.
122s Preparing to unpack .../3-perl_5.38.2-3.2_arm64.deb ...
122s Unpacking perl (5.38.2-3.2) ...
122s Selecting previously unselected package libdpkg-perl.
122s Preparing to unpack .../4-libdpkg-perl_1.22.4ubuntu5_all.deb ...
122s Unpacking libdpkg-perl (1.22.4ubuntu5) ...
122s Selecting previously unselected package make.
122s Preparing to unpack .../5-make_4.3-4.1build1_arm64.deb ...
122s Unpacking make (4.3-4.1build1) ...
122s Selecting previously unselected package lto-disabled-list.
122s Preparing to unpack .../6-lto-disabled-list_47_all.deb ...
122s Unpacking lto-disabled-list (47) ...
122s Selecting previously unselected package dpkg-dev.
122s Preparing to unpack .../7-dpkg-dev_1.22.4ubuntu5_all.deb ...
122s Unpacking dpkg-dev (1.22.4ubuntu5) ...
122s Setting up lto-disabled-list (47) ...
122s Setting up libgdbm-compat4t64:arm64 (1.23-5.1) ...
122s Setting up make (4.3-4.1build1) ...
122s Setting up perl-modules-5.38 (5.38.2-3.2) ...
122s Setting up libperl5.38t64:arm64 (5.38.2-3.2) ...
122s Setting up perl (5.38.2-3.2) ...
122s Setting up libdpkg-perl (1.22.4ubuntu5) ...
122s Setting up dpkg-dev (1.22.4ubuntu5) ...
122s Processing triggers for man-db (2.12.0-3) ...
123s Processing triggers for libc-bin (2.39-0ubuntu2) ...
123s Reading package lists...
123s Building dependency tree...
123s Reading state information...
124s The following packages will be REMOVED:
124s   cloud-init* python3-configobj* python3-debconf*
124s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded.
124s After this operation, 3248 kB disk space will be freed.
125s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74750 files and directories currently installed.)
125s Removing cloud-init (24.1-0ubuntu1) ...
125s Removing python3-configobj (5.0.8-3) ...
125s Removing python3-debconf (1.5.86) ...
125s Processing triggers for man-db (2.12.0-3) ...
126s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74361 files and directories currently installed.)
126s Purging configuration files for cloud-init (24.1-0ubuntu1) ...
127s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed
127s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ...
127s Reading package lists...
128s Building dependency tree...
128s Reading state information...
128s linux-generic is already the newest version (6.8.0-11.11+1).
128s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
129s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease
129s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease
129s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease
129s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease
130s Reading package lists...
130s Reading package lists...
130s Building dependency tree...
130s Reading state information...
131s Calculating upgrade...
131s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
131s Reading package lists...
132s Building dependency tree...
132s Reading state information...
132s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded.
132s autopkgtest [03:14:16]: rebooting testbed after setup commands that affected boot
163s autopkgtest [03:14:47]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP PREEMPT_DYNAMIC Wed Feb 14 02:53:31 UTC 2024
163s autopkgtest [03:14:47]: testbed dpkg architecture: arm64
164s autopkgtest [03:14:48]: @@@@@@@@@@@@@@@@@@@@ apt-source mummer
167s Get:1 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (dsc) [2173 B]
167s Get:2 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (tar) [1113 kB]
167s Get:3 http://ftpmaster.internal/ubuntu noble/universe mummer 3.23+dfsg-8 (diff) [416 kB]
168s gpgv: Signature made Sun Dec  4 11:37:19 2022 UTC
168s gpgv:                using RSA key F1F007320A035541F0A663CA578A0494D1C646D1
168s gpgv:                issuer "tille@debian.org"
168s gpgv: Can't check signature: No public key
168s dpkg-source: warning: cannot verify inline signature for ./mummer_3.23+dfsg-8.dsc: no acceptable signature found
169s autopkgtest [03:14:53]: testing package mummer version 3.23+dfsg-8
169s autopkgtest [03:14:53]: build not needed
170s autopkgtest [03:14:54]: test run-unit-test: preparing testbed
173s Reading package lists...
173s Building dependency tree...
173s Reading state information...
174s Correcting dependencies...Starting pkgProblemResolver with broken count: 0
174s Starting 2 pkgProblemResolver with broken count: 0
174s Done
174s  Done
174s Starting pkgProblemResolver with broken count: 0
174s Starting 2 pkgProblemResolver with broken count: 0
174s Done
175s The following additional packages will be installed:
175s   mummer mummer-doc
175s The following NEW packages will be installed:
175s   mummer mummer-doc
175s 0 upgraded, 2 newly installed, 0 to remove and 0 not upgraded.
175s 1 not fully installed or removed.
175s Need to get 1987 kB of archives.
175s After this operation, 5202 kB of additional disk space will be used.
175s Get:1 http://ftpmaster.internal/ubuntu noble/universe arm64 mummer arm64 3.23+dfsg-8 [673 kB]
175s Get:2 http://ftpmaster.internal/ubuntu noble/universe arm64 mummer-doc all 3.23+dfsg-8 [1314 kB]
176s Fetched 1987 kB in 1s (2805 kB/s)
176s Selecting previously unselected package mummer.
176s (Reading database ... 
(Reading database ... 5%
(Reading database ... 10%
(Reading database ... 15%
(Reading database ... 20%
(Reading database ... 25%
(Reading database ... 30%
(Reading database ... 35%
(Reading database ... 40%
(Reading database ... 45%
(Reading database ... 50%
(Reading database ... 55%
(Reading database ... 60%
(Reading database ... 65%
(Reading database ... 70%
(Reading database ... 75%
(Reading database ... 80%
(Reading database ... 85%
(Reading database ... 90%
(Reading database ... 95%
(Reading database ... 100%
(Reading database ... 74306 files and directories currently installed.)
176s Preparing to unpack .../mummer_3.23+dfsg-8_arm64.deb ...
176s Unpacking mummer (3.23+dfsg-8) ...
176s Selecting previously unselected package mummer-doc.
176s Preparing to unpack .../mummer-doc_3.23+dfsg-8_all.deb ...
176s Unpacking mummer-doc (3.23+dfsg-8) ...
176s Setting up mummer-doc (3.23+dfsg-8) ...
176s Setting up mummer (3.23+dfsg-8) ...
176s Setting up autopkgtest-satdep (0) ...
176s Processing triggers for man-db (2.12.0-3) ...
180s (Reading database ... 74475 files and directories currently installed.)
180s Removing autopkgtest-satdep (0) ...
181s autopkgtest [03:15:05]: test run-unit-test: [-----------------------
181s --------promer----
181s 1: PREPARING DATA
182s 2,3: RUNNING mummer AND CREATING CLUSTERS
182s # reading input file "promer.aaref" of length 71202
182s # construct suffix tree for sequence of length 71202
182s # (maximum reference length is 536870908)
182s # (maximum query length is 4294967295)
182s # CONSTRUCTIONTIME /usr/bin/mummer promer.aaref 0.01
182s # reading input file "promer.aaqry" of length 84243
182s # matching query-file "promer.aaqry"
182s # against subject-file "promer.aaref"
182s # COMPLETETIME /usr/bin/mummer promer.aaref 0.03
182s # SPACE /usr/bin/mummer promer.aaref 0.15
182s 4: FINISHING DATA
182s --------mapview----
182s --------mummer----
182s # reading input file "../input/H_pylori26695_Eslice.fasta" of length 275287
182s # construct suffix tree for sequence of length 275287
182s # (maximum reference length is 536870908)
182s # (maximum query length is 4294967295)
182s # process 2752 characters per dot
182s #....................................................................................................
182s # CONSTRUCTIONTIME /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.06
182s # reading input file "../input/H_pyloriJ99_Eslice.fasta" of length 265111
182s # matching query-file "../input/H_pyloriJ99_Eslice.fasta"
182s # against subject-file "../input/H_pylori26695_Eslice.fasta"
182s # COMPLETETIME /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.24
182s # SPACE /usr/bin/mummer ../input/H_pylori26695_Eslice.fasta 0.52
182s echo
182s --------nucmer----
182s 1: PREPARING DATA
182s 2,3: RUNNING mummer AND CREATING CLUSTERS
182s # reading input file "nucmer.ntref" of length 312601
182s # construct suffix tree for sequence of length 312601
182s # (maximum reference length is 536870908)
182s # (maximum query length is 4294967295)
182s # process 3126 characters per dot
183s #....................................................................................................
183s # CONSTRUCTIONTIME /usr/bin/mummer nucmer.ntref 0.06
183s # reading input file "/tmp/autopkgtest.U44c2c/autopkgtest_tmp/output/../input/B_anthracis_contigs.fasta" of length 308869
183s # matching query-file "/tmp/autopkgtest.U44c2c/autopkgtest_tmp/output/../input/B_anthracis_contigs.fasta"
183s # against subject-file "nucmer.ntref"
183s # COMPLETETIME /usr/bin/mummer nucmer.ntref 0.19
183s # SPACE /usr/bin/mummer nucmer.ntref 0.60
183s 4: FINISHING DATA
183s --------run-mummer3----
183s Find MUMs
183s # reading input file "../input/H_pylori26695_Bslice.fasta" of length 69860
183s # construct suffix tree for sequence of length 69860
183s # (maximum reference length is 536870908)
183s # (maximum query length is 4294967295)
183s # CONSTRUCTIONTIME /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.01
183s # reading input file "../input/H_pyloriJ99_Bslice.fasta" of length 69860
183s # matching query-file "../input/H_pyloriJ99_Bslice.fasta"
183s # against subject-file "../input/H_pylori26695_Bslice.fasta"
183s Determine gaps
183s # COMPLETETIME /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.02
183s # SPACE /usr/bin/mummer ../input/H_pylori26695_Bslice.fasta 0.14
183s Align gaps
183s            Ref len = 69860
183s             acgt's = 69860
183s         Non acgt's = 0
183s  Number of matches = 14
183s Sum of match bases = 60449
183s    Avg match bases = 4318
183s 400,404c400,404
183s <      Errors = 3
183s < A: ttttttttaacgcttgtcaagaataattgagaaatattgcggttttttaaaaaatg
183s < B: ttttttttaatgcttgtcaagaataactgaaaaatattgcggttttttaaaaaatg
183s <    ==========^               ^   ^               ==========
183s < Region:        167 .. 4847               1 .. 4684           229 / 4684        4.89%
183s ---
183s >      Errors = 1
183s > A: ttttttttaacgcttgtcaagaataattaaaaaatg
183s > B: ttttttttaatgcttgtcaagaataattaaaaaatg
183s >    ==========^               ==========
183s > Region:        167 .. 4827               1 .. 4664           227 / 4664        4.87%
183s autopkgtest [03:15:07]: test run-unit-test: -----------------------]
184s run-unit-test        FAIL non-zero exit status 1
184s autopkgtest [03:15:08]: test run-unit-test:  - - - - - - - - - - results - - - - - - - - - -
184s autopkgtest [03:15:08]: @@@@@@@@@@@@@@@@@@@@ summary
184s run-unit-test        FAIL non-zero exit status 1
195s Creating nova instance adt-noble-arm64-mummer-20240311-031204-juju-7f2275-prod-proposed-migration-environment-3 from image adt/ubuntu-noble-arm64-server-20240311.img (UUID 900cfff9-7f1a-42c7-81a7-22635cd2a5f9)...