1s autopkgtest [17:24:24]: starting date and time: 2024-03-24 17:24:24+0000 1s autopkgtest [17:24:24]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 1s autopkgtest [17:24:24]: host juju-7f2275-prod-proposed-migration-environment-3; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.kijsu7sq/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --setup-commands /home/ubuntu/autopkgtest/setup-commands/setup-testbed --apt-pocket=proposed=src:samtools,src:curl,src:gnutls28,src:htslib,src:libpsl,src:nettle,src:openssl --apt-upgrade fastaq --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=samtools/1.19.2-1build1 curl/8.5.0-2ubuntu7 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-3@bos02-arm64-20.secgroup --name adt-noble-arm64-fastaq-20240324-172423-juju-7f2275-prod-proposed-migration-environment-3 --image adt/ubuntu-noble-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-3 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 105s autopkgtest [17:26:08]: testbed dpkg architecture: arm64 105s autopkgtest [17:26:08]: testbed apt version: 2.7.12 105s autopkgtest [17:26:08]: @@@@@@@@@@@@@@@@@@@@ test bed setup 106s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 107s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [6540 B] 107s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [496 kB] 107s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3986 kB] 107s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [57.3 kB] 107s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 Packages [708 kB] 108s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 c-n-f Metadata [3144 B] 108s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 Packages [33.7 kB] 108s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 c-n-f Metadata [116 B] 108s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 Packages [4364 kB] 108s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 c-n-f Metadata [8528 B] 108s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 Packages [70.1 kB] 108s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 c-n-f Metadata [116 B] 113s Fetched 9850 kB in 3s (3298 kB/s) 114s Reading package lists... 118s Reading package lists... 119s Building dependency tree... 119s Reading state information... 120s Calculating upgrade... 121s The following packages will be REMOVED: 121s libssl3 121s The following NEW packages will be installed: 121s libssl3t64 121s The following packages have been kept back: 121s curl 121s The following packages will be upgraded: 121s openssl 121s 1 upgraded, 1 newly installed, 1 to remove and 1 not upgraded. 121s Need to get 2777 kB of archives. 121s After this operation, 139 kB of additional disk space will be used. 121s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 openssl arm64 3.0.13-0ubuntu2 [985 kB] 121s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libssl3t64 arm64 3.0.13-0ubuntu2 [1793 kB] 122s Fetched 2777 kB in 1s (3860 kB/s) 122s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75911 files and directories currently installed.) 122s Preparing to unpack .../openssl_3.0.13-0ubuntu2_arm64.deb ... 122s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 123s dpkg: libssl3:arm64: dependency problems, but removing anyway as you requested: 123s wget depends on libssl3 (>= 3.0.0). 123s u-boot-tools depends on libssl3 (>= 3.0.0). 123s tnftp depends on libssl3 (>= 3.0.0). 123s tcpdump depends on libssl3 (>= 3.0.0). 123s systemd-resolved depends on libssl3 (>= 3.0.0). 123s systemd depends on libssl3 (>= 3.0.0). 123s sudo depends on libssl3 (>= 3.0.0). 123s sbsigntool depends on libssl3 (>= 3.0.0). 123s rsync depends on libssl3 (>= 3.0.0). 123s python3-cryptography depends on libssl3 (>= 3.0.0). 123s openssh-server depends on libssl3 (>= 3.0.10). 123s openssh-client depends on libssl3 (>= 3.0.10). 123s mtd-utils depends on libssl3 (>= 3.0.0). 123s mokutil depends on libssl3 (>= 3.0.0). 123s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 123s libsystemd-shared:arm64 depends on libssl3 (>= 3.0.0). 123s libssh-4:arm64 depends on libssl3 (>= 3.0.0). 123s libsasl2-modules:arm64 depends on libssl3 (>= 3.0.0). 123s libsasl2-2:arm64 depends on libssl3 (>= 3.0.0). 123s libpython3.12-minimal:arm64 depends on libssl3 (>= 3.0.0). 123s libpython3.11-minimal:arm64 depends on libssl3 (>= 3.0.0). 123s libnvme1 depends on libssl3 (>= 3.0.0). 123s libkrb5-3:arm64 depends on libssl3 (>= 3.0.0). 123s libkmod2:arm64 depends on libssl3 (>= 3.0.0). 123s libfido2-1:arm64 depends on libssl3 (>= 3.0.0). 123s libcurl4:arm64 depends on libssl3 (>= 3.0.0). 123s libcryptsetup12:arm64 depends on libssl3 (>= 3.0.0). 123s kmod depends on libssl3 (>= 3.0.0). 123s dhcpcd-base depends on libssl3 (>= 3.0.0). 123s bind9-libs:arm64 depends on libssl3 (>= 3.0.0). 123s 123s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75911 files and directories currently installed.) 123s Removing libssl3:arm64 (3.0.10-1ubuntu4) ... 123s Selecting previously unselected package libssl3t64:arm64. 123s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75900 files and directories currently installed.) 123s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_arm64.deb ... 123s Unpacking libssl3t64:arm64 (3.0.13-0ubuntu2) ... 123s Setting up libssl3t64:arm64 (3.0.13-0ubuntu2) ... 123s Setting up openssl (3.0.13-0ubuntu2) ... 123s Processing triggers for man-db (2.12.0-3) ... 124s Processing triggers for libc-bin (2.39-0ubuntu6) ... 125s Reading package lists... 125s Building dependency tree... 125s Reading state information... 127s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 128s sh: Attempting to set up Debian/Ubuntu apt sources automatically 128s sh: Distribution appears to be Ubuntu 130s Reading package lists... 130s Building dependency tree... 130s Reading state information... 131s eatmydata is already the newest version (131-1). 131s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 131s Reading package lists... 132s Building dependency tree... 132s Reading state information... 133s dbus is already the newest version (1.14.10-4ubuntu1). 133s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 133s Reading package lists... 133s Building dependency tree... 133s Reading state information... 135s rng-tools-debian is already the newest version (2.4). 135s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 135s Reading package lists... 135s Building dependency tree... 135s Reading state information... 136s The following packages will be REMOVED: 136s cloud-init* python3-configobj* python3-debconf* 137s 0 upgraded, 0 newly installed, 3 to remove and 0 not upgraded. 137s After this operation, 3256 kB disk space will be freed. 137s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75913 files and directories currently installed.) 137s Removing cloud-init (24.1.2-0ubuntu1) ... 138s Removing python3-configobj (5.0.8-3) ... 139s Removing python3-debconf (1.5.86) ... 139s Processing triggers for man-db (2.12.0-3) ... 139s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75524 files and directories currently installed.) 139s Purging configuration files for cloud-init (24.1.2-0ubuntu1) ... 141s dpkg: warning: while removing cloud-init, directory '/etc/cloud/cloud.cfg.d' not empty so not removed 141s Processing triggers for rsyslog (8.2312.0-3ubuntu3) ... 141s invoke-rc.d: policy-rc.d denied execution of try-restart. 141s Reading package lists... 142s Building dependency tree... 142s Reading state information... 143s linux-generic is already the newest version (6.8.0-11.11+1). 143s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 144s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 144s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 144s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 149s Reading package lists... 149s Reading package lists... 150s Building dependency tree... 150s Reading state information... 151s Calculating upgrade... 152s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 152s Reading package lists... 152s Building dependency tree... 152s Reading state information... 153s 0 upgraded, 0 newly installed, 0 to remove and 0 not upgraded. 154s autopkgtest [17:26:57]: rebooting testbed after setup commands that affected boot 309s autopkgtest [17:29:32]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP PREEMPT_DYNAMIC Wed Feb 14 02:53:31 UTC 2024 312s autopkgtest [17:29:35]: @@@@@@@@@@@@@@@@@@@@ apt-source fastaq 315s Get:1 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (dsc) [2135 B] 315s Get:2 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (tar) [71.3 kB] 315s Get:3 http://ftpmaster.internal/ubuntu noble/universe fastaq 3.17.0-6 (diff) [4884 B] 315s gpgv: Signature made Mon Dec 18 16:27:46 2023 UTC 315s gpgv: using RSA key 5B34BA5AAB5507E903426E85E8D37AE2F09F4872 315s gpgv: Can't check signature: No public key 315s dpkg-source: warning: cannot verify inline signature for ./fastaq_3.17.0-6.dsc: no acceptable signature found 315s autopkgtest [17:29:38]: testing package fastaq version 3.17.0-6 315s autopkgtest [17:29:38]: build not needed 316s autopkgtest [17:29:39]: test run: preparing testbed 319s Reading package lists... 320s Building dependency tree... 320s Reading state information... 320s Starting pkgProblemResolver with broken count: 0 321s Starting 2 pkgProblemResolver with broken count: 0 321s Done 322s The following additional packages will be installed: 322s fastaq libdeflate0 libhts3 libhtscodecs2 samtools 322s Suggested packages: 322s cwltool 322s The following NEW packages will be installed: 322s autopkgtest-satdep fastaq libdeflate0 libhts3 libhtscodecs2 samtools 322s 0 upgraded, 6 newly installed, 0 to remove and 0 not upgraded. 322s Need to get 1176 kB/1177 kB of archives. 322s After this operation, 3303 kB of additional disk space will be used. 322s Get:1 /tmp/autopkgtest.bckr9P/1-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [716 B] 322s Get:2 http://ftpmaster.internal/ubuntu noble/main arm64 libdeflate0 arm64 1.19-1 [43.4 kB] 322s Get:3 http://ftpmaster.internal/ubuntu noble/universe arm64 libhtscodecs2 arm64 1.6.0-1 [78.1 kB] 322s Get:4 http://ftpmaster.internal/ubuntu noble/universe arm64 libhts3 arm64 1.18+ds-1 [422 kB] 323s Get:5 http://ftpmaster.internal/ubuntu noble/universe arm64 samtools arm64 1.19.2-1 [584 kB] 323s Get:6 http://ftpmaster.internal/ubuntu noble/universe arm64 fastaq all 3.17.0-6 [47.9 kB] 323s Fetched 1176 kB in 1s (1805 kB/s) 324s Selecting previously unselected package libdeflate0:arm64. 324s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75469 files and directories currently installed.) 324s Preparing to unpack .../0-libdeflate0_1.19-1_arm64.deb ... 324s Unpacking libdeflate0:arm64 (1.19-1) ... 324s Selecting previously unselected package libhtscodecs2:arm64. 324s Preparing to unpack .../1-libhtscodecs2_1.6.0-1_arm64.deb ... 324s Unpacking libhtscodecs2:arm64 (1.6.0-1) ... 324s Selecting previously unselected package libhts3:arm64. 324s Preparing to unpack .../2-libhts3_1.18+ds-1_arm64.deb ... 324s Unpacking libhts3:arm64 (1.18+ds-1) ... 324s Selecting previously unselected package samtools. 324s Preparing to unpack .../3-samtools_1.19.2-1_arm64.deb ... 324s Unpacking samtools (1.19.2-1) ... 324s Selecting previously unselected package fastaq. 324s Preparing to unpack .../4-fastaq_3.17.0-6_all.deb ... 324s Unpacking fastaq (3.17.0-6) ... 324s Selecting previously unselected package autopkgtest-satdep. 324s Preparing to unpack .../5-1-autopkgtest-satdep.deb ... 324s Unpacking autopkgtest-satdep (0) ... 324s Setting up libhtscodecs2:arm64 (1.6.0-1) ... 324s Setting up libdeflate0:arm64 (1.19-1) ... 324s Setting up libhts3:arm64 (1.18+ds-1) ... 324s Setting up samtools (1.19.2-1) ... 324s Setting up fastaq (3.17.0-6) ... 325s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:37: SyntaxWarning: invalid escape sequence '\s' 325s phylip_regex = re.compile('^\s*[0-9]+\s+[0-9]+$') 325s /usr/lib/python3/dist-packages/pyfastaq/sequences.py:38: SyntaxWarning: invalid escape sequence '\s' 325s gbk_regex = re.compile('^LOCUS\s+\S') 325s Setting up autopkgtest-satdep (0) ... 325s Processing triggers for man-db (2.12.0-3) ... 326s Processing triggers for libc-bin (2.39-0ubuntu6) ... 331s (Reading database ... 75675 files and directories currently installed.) 331s Removing autopkgtest-satdep (0) ... 332s autopkgtest [17:29:55]: test run: [----------------------- 333s >test 333s TCGTAGCCGGCTCGCATCGACTG 333s autopkgtest [17:29:56]: test run: -----------------------] 334s autopkgtest [17:29:57]: test run: - - - - - - - - - - results - - - - - - - - - - 334s run PASS 334s autopkgtest [17:29:57]: test python-test: preparing testbed 340s Reading package lists... 340s Building dependency tree... 340s Reading state information... 341s Starting pkgProblemResolver with broken count: 0 341s Starting 2 pkgProblemResolver with broken count: 0 341s Done 343s The following NEW packages will be installed: 343s autopkgtest-satdep 343s 0 upgraded, 1 newly installed, 0 to remove and 0 not upgraded. 343s Need to get 0 B/716 B of archives. 343s After this operation, 0 B of additional disk space will be used. 343s Get:1 /tmp/autopkgtest.bckr9P/2-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [716 B] 344s Selecting previously unselected package autopkgtest-satdep. 344s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 75675 files and directories currently installed.) 344s Preparing to unpack .../2-autopkgtest-satdep.deb ... 344s Unpacking autopkgtest-satdep (0) ... 344s Setting up autopkgtest-satdep (0) ... 349s (Reading database ... 75675 files and directories currently installed.) 349s Removing autopkgtest-satdep (0) ... 349s autopkgtest [17:30:12]: test python-test: [----------------------- 350s autopkgtest [17:30:13]: test python-test: -----------------------] 351s python-test PASS 351s autopkgtest [17:30:14]: test python-test: - - - - - - - - - - results - - - - - - - - - - 351s autopkgtest [17:30:14]: @@@@@@@@@@@@@@@@@@@@ summary 351s run PASS 351s python-test PASS 362s Creating nova instance adt-noble-arm64-fastaq-20240324-172423-juju-7f2275-prod-proposed-migration-environment-3 from image adt/ubuntu-noble-arm64-server-20240324.img (UUID 86f9118c-691d-4fd3-ac71-bf5396ee0d8a)...