0s autopkgtest [02:34:09]: starting date and time: 2024-03-27 02:34:09+0000 0s autopkgtest [02:34:09]: git checkout: 4a1cd702 l/adt_testbed: don't blame the testbed for unsolvable build deps 0s autopkgtest [02:34:09]: host juju-7f2275-prod-proposed-migration-environment-3; command line: /home/ubuntu/autopkgtest/runner/autopkgtest --output-dir /tmp/autopkgtest-work.3zvf72v2/out --timeout-copy=6000 --setup-commands /home/ubuntu/autopkgtest-cloud/worker-config-production/setup-canonical.sh --apt-pocket=proposed=src:ataqv,src:boost1.83,src:curl,src:gnutls28,src:htslib,src:libpsl,src:nettle,src:openssl --apt-upgrade ataqv --timeout-short=300 --timeout-copy=20000 --timeout-build=20000 '--env=ADT_TEST_TRIGGERS=ataqv/1.3.1+ds-2build2 boost1.83/1.83.0-2.1ubuntu2 curl/8.5.0-2ubuntu8 gnutls28/3.8.3-1.1ubuntu2 htslib/1.19+ds-1.1build2 libpsl/0.21.2-1.1 nettle/3.9.1-2.2 openssl/3.0.13-0ubuntu2' -- ssh -s /home/ubuntu/autopkgtest/ssh-setup/nova -- --flavor autopkgtest --security-groups autopkgtest-juju-7f2275-prod-proposed-migration-environment-3@bos03-arm64-15.secgroup --name adt-noble-arm64-ataqv-20240327-023409-juju-7f2275-prod-proposed-migration-environment-3-d16ec69c-7dc4-4687-b63e-98e0528e1c35 --image adt/ubuntu-noble-arm64-server --keyname testbed-juju-7f2275-prod-proposed-migration-environment-3 --net-id=net_prod-proposed-migration -e TERM=linux -e ''"'"'http_proxy=http://squid.internal:3128'"'"'' -e ''"'"'https_proxy=http://squid.internal:3128'"'"'' -e ''"'"'no_proxy=127.0.0.1,127.0.1.1,login.ubuntu.com,localhost,localdomain,novalocal,internal,archive.ubuntu.com,ports.ubuntu.com,security.ubuntu.com,ddebs.ubuntu.com,changelogs.ubuntu.com,launchpadlibrarian.net,launchpadcontent.net,launchpad.net,10.24.0.0/24,keystone.ps5.canonical.com,objectstorage.prodstack5.canonical.com'"'"'' --mirror=http://ftpmaster.internal/ubuntu/ 71s autopkgtest [02:35:20]: testbed dpkg architecture: arm64 71s autopkgtest [02:35:20]: testbed apt version: 2.7.12 71s autopkgtest [02:35:20]: @@@@@@@@@@@@@@@@@@@@ test bed setup 71s Get:1 http://ftpmaster.internal/ubuntu noble-proposed InRelease [117 kB] 72s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/multiverse Sources [55.4 kB] 72s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main Sources [497 kB] 72s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/universe Sources [3984 kB] 72s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/restricted Sources [8504 B] 72s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 Packages [717 kB] 72s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 c-n-f Metadata [3144 B] 72s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 Packages [43.0 kB] 72s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/restricted arm64 c-n-f Metadata [116 B] 72s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 Packages [4303 kB] 72s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 c-n-f Metadata [8528 B] 72s Get:12 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 Packages [71.0 kB] 72s Get:13 http://ftpmaster.internal/ubuntu noble-proposed/multiverse arm64 c-n-f Metadata [116 B] 74s Fetched 9808 kB in 2s (5333 kB/s) 75s Reading package lists... 78s Reading package lists... 78s Building dependency tree... 78s Reading state information... 79s Calculating upgrade... 79s The following packages will be REMOVED: 79s libssl3 79s The following NEW packages will be installed: 79s libssl3t64 79s The following packages have been kept back: 79s curl 79s The following packages will be upgraded: 79s openssl 79s 1 upgraded, 1 newly installed, 1 to remove and 1 not upgraded. 79s Need to get 2777 kB of archives. 79s After this operation, 139 kB of additional disk space will be used. 79s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 openssl arm64 3.0.13-0ubuntu2 [985 kB] 80s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libssl3t64 arm64 3.0.13-0ubuntu2 [1793 kB] 81s Fetched 2777 kB in 1s (2198 kB/s) 81s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74816 files and directories currently installed.) 81s Preparing to unpack .../openssl_3.0.13-0ubuntu2_arm64.deb ... 81s Unpacking openssl (3.0.13-0ubuntu2) over (3.0.10-1ubuntu4) ... 82s dpkg: libssl3:arm64: dependency problems, but removing anyway as you requested: 82s wget depends on libssl3 (>= 3.0.0). 82s u-boot-tools depends on libssl3 (>= 3.0.0). 82s tnftp depends on libssl3 (>= 3.0.0). 82s tcpdump depends on libssl3 (>= 3.0.0). 82s systemd-resolved depends on libssl3 (>= 3.0.0). 82s systemd depends on libssl3 (>= 3.0.0). 82s sudo depends on libssl3 (>= 3.0.0). 82s sbsigntool depends on libssl3 (>= 3.0.0). 82s rsync depends on libssl3 (>= 3.0.0). 82s python3-cryptography depends on libssl3 (>= 3.0.0). 82s openssh-server depends on libssl3 (>= 3.0.10). 82s openssh-client depends on libssl3 (>= 3.0.10). 82s mtd-utils depends on libssl3 (>= 3.0.0). 82s mokutil depends on libssl3 (>= 3.0.0). 82s linux-headers-6.8.0-11-generic depends on libssl3 (>= 3.0.0). 82s libsystemd-shared:arm64 depends on libssl3 (>= 3.0.0). 82s libssh-4:arm64 depends on libssl3 (>= 3.0.0). 82s libsasl2-modules:arm64 depends on libssl3 (>= 3.0.0). 82s libsasl2-2:arm64 depends on libssl3 (>= 3.0.0). 82s libpython3.12-minimal:arm64 depends on libssl3 (>= 3.0.0). 82s libnvme1 depends on libssl3 (>= 3.0.0). 82s libkrb5-3:arm64 depends on libssl3 (>= 3.0.0). 82s libkmod2:arm64 depends on libssl3 (>= 3.0.0). 82s libfido2-1:arm64 depends on libssl3 (>= 3.0.0). 82s libcurl4:arm64 depends on libssl3 (>= 3.0.0). 82s libcryptsetup12:arm64 depends on libssl3 (>= 3.0.0). 82s kmod depends on libssl3 (>= 3.0.0). 82s dhcpcd-base depends on libssl3 (>= 3.0.0). 82s bind9-libs:arm64 depends on libssl3 (>= 3.0.0). 82s 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74816 files and directories currently installed.) 82s Removing libssl3:arm64 (3.0.10-1ubuntu4) ... 82s Selecting previously unselected package libssl3t64:arm64. 82s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74805 files and directories currently installed.) 82s Preparing to unpack .../libssl3t64_3.0.13-0ubuntu2_arm64.deb ... 82s Unpacking libssl3t64:arm64 (3.0.13-0ubuntu2) ... 82s Setting up libssl3t64:arm64 (3.0.13-0ubuntu2) ... 82s Setting up openssl (3.0.13-0ubuntu2) ... 82s Processing triggers for man-db (2.12.0-3) ... 83s Processing triggers for libc-bin (2.39-0ubuntu6) ... 83s Reading package lists... 83s Building dependency tree... 83s Reading state information... 84s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 84s Hit:1 http://ftpmaster.internal/ubuntu noble InRelease 84s Hit:2 http://ftpmaster.internal/ubuntu noble-updates InRelease 85s Hit:3 http://ftpmaster.internal/ubuntu noble-security InRelease 85s Hit:4 http://ftpmaster.internal/ubuntu noble-proposed InRelease 86s Reading package lists... 86s Reading package lists... 87s Building dependency tree... 87s Reading state information... 88s Calculating upgrade... 89s The following packages have been kept back: 89s curl 90s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 90s Reading package lists... 91s Building dependency tree... 91s Reading state information... 93s 0 upgraded, 0 newly installed, 0 to remove and 1 not upgraded. 96s autopkgtest [02:35:45]: testbed running kernel: Linux 6.8.0-11-generic #11-Ubuntu SMP PREEMPT_DYNAMIC Wed Feb 14 02:53:31 UTC 2024 96s autopkgtest [02:35:45]: @@@@@@@@@@@@@@@@@@@@ apt-source ataqv 99s Get:1 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (dsc) [2348 B] 99s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (tar) [4068 kB] 99s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/universe ataqv 1.3.1+ds-2build2 (diff) [9548 B] 100s gpgv: Signature made Fri Mar 22 15:29:42 2024 UTC 100s gpgv: using RSA key 4FB588A84C2DDE79A74C77876FA458DD1DB03F71 100s gpgv: issuer "juliank@ubuntu.com" 100s gpgv: Can't check signature: No public key 100s dpkg-source: warning: cannot verify inline signature for ./ataqv_1.3.1+ds-2build2.dsc: no acceptable signature found 100s autopkgtest [02:35:49]: testing package ataqv version 1.3.1+ds-2build2 100s autopkgtest [02:35:49]: build not needed 101s autopkgtest [02:35:50]: test run-unit-test: preparing testbed 103s Reading package lists... 103s Building dependency tree... 103s Reading state information... 104s Starting pkgProblemResolver with broken count: 0 104s Starting 2 pkgProblemResolver with broken count: 0 104s Done 105s The following additional packages will be installed: 105s ataqv curl fonts-font-awesome libboost-chrono1.83.0t64 105s libboost-filesystem1.83.0 libboost-iostreams1.83.0 libcurl3t64-gnutls 105s libcurl4t64 libdeflate0 libgnutls30t64 libhogweed6t64 libhts3t64 105s libhtscodecs2 libjs-d3-format libjs-jquery libjs-jquery-datatables 105s libjs-jquery-datatables-extensions libnettle8t64 libpsl5t64 node-commander 105s node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord 105s node-d3-collection node-d3-color node-d3-contour node-d3-dispatch 105s node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force 105s node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate 105s node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random 105s node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape 105s node-d3-time node-d3-time-format node-d3-timer node-d3-transition 105s node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw 105s node-safe-buffer 105s Suggested packages: 105s picard-tools samtools macs gnutls-bin libjs-html5shiv 105s Recommended packages: 105s javascript-common 105s The following packages will be REMOVED: 105s libcurl3-gnutls libcurl4 libgnutls30 libhogweed6 libnettle8 libpsl5 105s The following NEW packages will be installed: 105s ataqv autopkgtest-satdep fonts-font-awesome libboost-chrono1.83.0t64 105s libboost-filesystem1.83.0 libboost-iostreams1.83.0 libcurl3t64-gnutls 105s libcurl4t64 libdeflate0 libgnutls30t64 libhogweed6t64 libhts3t64 105s libhtscodecs2 libjs-d3-format libjs-jquery libjs-jquery-datatables 105s libjs-jquery-datatables-extensions libnettle8t64 libpsl5t64 node-commander 105s node-d3 node-d3-array node-d3-axis node-d3-brush node-d3-chord 105s node-d3-collection node-d3-color node-d3-contour node-d3-dispatch 105s node-d3-drag node-d3-dsv node-d3-ease node-d3-fetch node-d3-force 105s node-d3-format node-d3-geo node-d3-hierarchy node-d3-interpolate 105s node-d3-path node-d3-polygon node-d3-quadtree node-d3-queue node-d3-random 105s node-d3-scale node-d3-scale-chromatic node-d3-selection node-d3-shape 105s node-d3-time node-d3-time-format node-d3-timer node-d3-transition 105s node-d3-voronoi node-d3-zoom node-iconv-lite node-normalize.css node-rw 105s node-safe-buffer 105s The following packages will be upgraded: 105s curl 105s 1 upgraded, 57 newly installed, 6 to remove and 0 not upgraded. 105s Need to get 10.1 MB/10.1 MB of archives. 105s After this operation, 27.7 MB of additional disk space will be used. 105s Get:1 /tmp/autopkgtest.kxlDY0/1-autopkgtest-satdep.deb autopkgtest-satdep arm64 0 [700 B] 105s Get:2 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libnettle8t64 arm64 3.9.1-2.2 [192 kB] 106s Get:3 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libhogweed6t64 arm64 3.9.1-2.2 [199 kB] 106s Get:4 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libgnutls30t64 arm64 3.8.3-1.1ubuntu2 [1042 kB] 106s Get:5 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libcurl4t64 arm64 8.5.0-2ubuntu8 [332 kB] 106s Get:6 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 curl arm64 8.5.0-2ubuntu8 [222 kB] 106s Get:7 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libpsl5t64 arm64 0.21.2-1.1 [57.4 kB] 106s Get:8 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libcurl3t64-gnutls arm64 8.5.0-2ubuntu8 [327 kB] 106s Get:9 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libboost-chrono1.83.0t64 arm64 1.83.0-2.1ubuntu2 [244 kB] 106s Get:10 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libboost-filesystem1.83.0 arm64 1.83.0-2.1ubuntu2 [281 kB] 106s Get:11 http://ftpmaster.internal/ubuntu noble-proposed/main arm64 libboost-iostreams1.83.0 arm64 1.83.0-2.1ubuntu2 [258 kB] 106s Get:12 http://ftpmaster.internal/ubuntu noble/main arm64 libdeflate0 arm64 1.19-1 [43.4 kB] 106s Get:13 http://ftpmaster.internal/ubuntu noble/universe arm64 libhtscodecs2 arm64 1.6.0-1 [78.1 kB] 106s Get:14 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 libhts3t64 arm64 1.19+ds-1.1build2 [429 kB] 107s Get:15 http://ftpmaster.internal/ubuntu noble/main arm64 libjs-jquery all 3.6.1+dfsg+~3.5.14-1 [328 kB] 107s Get:16 http://ftpmaster.internal/ubuntu noble/universe arm64 libjs-jquery-datatables all 1.11.5+dfsg-2 [146 kB] 107s Get:17 http://ftpmaster.internal/ubuntu noble/universe arm64 libjs-jquery-datatables-extensions all 0.0+git20150910.28fd64e+dfsg-5 [648 kB] 107s Get:18 http://ftpmaster.internal/ubuntu noble/main arm64 fonts-font-awesome all 5.0.10+really4.7.0~dfsg-4.1 [516 kB] 107s Get:19 http://ftpmaster.internal/ubuntu noble/universe arm64 node-normalize.css all 8.0.1-5 [10.8 kB] 107s Get:20 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-array all 3.2.0+~cs5.0.6-2 [45.1 kB] 107s Get:21 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-axis all 1.0.12+~1.0.16-1 [14.1 kB] 107s Get:22 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-dispatch all 1.0.6+~1.0.9-1 [9774 B] 107s Get:23 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-selection all 1.4.1+~1.4.3-1 [42.8 kB] 107s Get:24 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-drag all 1.2.5+~1.2.5-1 [19.1 kB] 107s Get:25 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-color all 1.4.1+~1.4.2-1 [19.9 kB] 107s Get:26 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-interpolate all 1.4.0+~1.4.2-1 [24.0 kB] 107s Get:27 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-ease all 1.0.7+~1.0.11-1 [12.5 kB] 107s Get:28 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-timer all 1.0.10+~1.0.10-1 [10.6 kB] 107s Get:29 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-transition all 1.3.2+~1.3.2-1 [28.7 kB] 107s Get:30 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-brush all 1.1.6+~1.1.5-1 [181 kB] 107s Get:31 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-path all 1.0.9+~1.0.9-1 [10.5 kB] 107s Get:32 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-chord all 1.0.6+~1.0.11-1 [14.2 kB] 107s Get:33 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-collection all 1.0.7+~1.0.10-1 [17.2 kB] 107s Get:34 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-contour all 1.3.2+~1.3.3-1 [17.7 kB] 107s Get:35 http://ftpmaster.internal/ubuntu noble/universe arm64 node-safe-buffer all 5.2.1+~cs2.1.2-3 [15.8 kB] 107s Get:36 http://ftpmaster.internal/ubuntu noble/universe arm64 node-iconv-lite all 0.6.3-3 [158 kB] 107s Get:37 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-queue all 3.0.7-13 [10.2 kB] 107s Get:38 http://ftpmaster.internal/ubuntu noble/universe arm64 node-rw all 1.3.3-5 [7570 B] 107s Get:39 http://ftpmaster.internal/ubuntu noble/universe arm64 node-commander all 9.4.1-1 [50.6 kB] 107s Get:40 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-dsv all 1.2.0+~1.2.3-1 [17.7 kB] 107s Get:41 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-fetch all 1.2.0+~1.2.2-1 [10.1 kB] 107s Get:42 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-quadtree all 1.0.7+~1.0.9-1 [16.6 kB] 107s Get:43 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-force all 2.1.1+~2.1.4-1 [30.9 kB] 107s Get:44 http://ftpmaster.internal/ubuntu noble/universe arm64 libjs-d3-format all 1:1.4.5+~1.4.2-2 [18.2 kB] 107s Get:45 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-format all 1:1.4.5+~1.4.2-2 [11.1 kB] 107s Get:46 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-geo all 1.12.1+~1.12.4-1 [67.3 kB] 107s Get:47 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-hierarchy all 1.1.9+~1.1.8-1 [35.1 kB] 107s Get:48 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-polygon all 1.0.6+~1.0.8-1 [8744 B] 107s Get:49 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-random all 1.1.2+~1.1.3-1 [9140 B] 107s Get:50 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-time all 1.1.0+~1.1.1-1 [19.2 kB] 107s Get:51 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-time-format all 2.3.0+~2.3.1-1 [23.8 kB] 107s Get:52 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-scale all 2.2.2+~2.2.6-1 [43.4 kB] 107s Get:53 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-scale-chromatic all 1.5.0+~1.5.1-1 [23.5 kB] 107s Get:54 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-shape all 1.3.7+~1.3.8-1 [56.0 kB] 107s Get:55 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-voronoi all 1.1.4+~1.1.9-1 [20.5 kB] 107s Get:56 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3-zoom all 1.8.3+~1.8.4-1 [27.2 kB] 107s Get:57 http://ftpmaster.internal/ubuntu noble/universe arm64 node-d3 all 5.16.0+~cs5.28.10-1 [194 kB] 107s Get:58 http://ftpmaster.internal/ubuntu noble-proposed/universe arm64 ataqv arm64 1.3.1+ds-2build2 [3369 kB] 109s Fetched 10.1 MB in 3s (3960 kB/s) 109s dpkg: libhogweed6:arm64: dependency problems, but removing anyway as you requested: 109s librtmp1:arm64 depends on libhogweed6. 109s libjcat1:arm64 depends on libhogweed6. 109s libgnutls30:arm64 depends on libhogweed6 (>= 3.6). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74818 files and directories currently installed.) 109s Removing libhogweed6:arm64 (3.9.1-2) ... 109s dpkg: libnettle8:arm64: dependency problems, but removing anyway as you requested: 109s librtmp1:arm64 depends on libnettle8. 109s libgnutls30:arm64 depends on libnettle8 (>= 3.9~). 109s libcurl3-gnutls:arm64 depends on libnettle8. 109s libarchive13:arm64 depends on libnettle8. 109s 109s Removing libnettle8:arm64 (3.9.1-2) ... 109s Selecting previously unselected package libnettle8t64:arm64. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74806 files and directories currently installed.) 109s Preparing to unpack .../libnettle8t64_3.9.1-2.2_arm64.deb ... 109s Unpacking libnettle8t64:arm64 (3.9.1-2.2) ... 109s Selecting previously unselected package libhogweed6t64:arm64. 109s Preparing to unpack .../libhogweed6t64_3.9.1-2.2_arm64.deb ... 109s Unpacking libhogweed6t64:arm64 (3.9.1-2.2) ... 109s dpkg: libgnutls30:arm64: dependency problems, but removing anyway as you requested: 109s u-boot-tools depends on libgnutls30 (>= 3.7.3). 109s librtmp1:arm64 depends on libgnutls30 (>= 3.7.2). 109s libldap2:arm64 depends on libgnutls30 (>= 3.8.2). 109s libjcat1:arm64 depends on libgnutls30 (>= 3.7.3). 109s libcurl3-gnutls:arm64 depends on libgnutls30 (>= 3.8.2). 109s fwupd depends on libgnutls30 (>= 3.7.3). 109s dirmngr depends on libgnutls30 (>= 3.8.1). 109s apt depends on libgnutls30 (>= 3.8.1). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74820 files and directories currently installed.) 109s Removing libgnutls30:arm64 (3.8.3-1ubuntu1) ... 109s Selecting previously unselected package libgnutls30t64:arm64. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74811 files and directories currently installed.) 109s Preparing to unpack .../libgnutls30t64_3.8.3-1.1ubuntu2_arm64.deb ... 109s Unpacking libgnutls30t64:arm64 (3.8.3-1.1ubuntu2) ... 109s dpkg: libcurl4:arm64: dependency problems, but removing anyway as you requested: 109s curl depends on libcurl4 (= 8.5.0-2ubuntu2). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74839 files and directories currently installed.) 109s Removing libcurl4:arm64 (8.5.0-2ubuntu2) ... 109s Selecting previously unselected package libcurl4t64:arm64. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74834 files and directories currently installed.) 109s Preparing to unpack .../libcurl4t64_8.5.0-2ubuntu8_arm64.deb ... 109s Unpacking libcurl4t64:arm64 (8.5.0-2ubuntu8) ... 109s Preparing to unpack .../curl_8.5.0-2ubuntu8_arm64.deb ... 109s Unpacking curl (8.5.0-2ubuntu8) over (8.5.0-2ubuntu2) ... 109s dpkg: libpsl5:arm64: dependency problems, but removing anyway as you requested: 109s wget depends on libpsl5 (>= 0.16.0). 109s libcurl3-gnutls:arm64 depends on libpsl5 (>= 0.16.0). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74840 files and directories currently installed.) 109s Removing libpsl5:arm64 (0.21.2-1build1) ... 109s Selecting previously unselected package libpsl5t64:arm64. 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74835 files and directories currently installed.) 109s Preparing to unpack .../libpsl5t64_0.21.2-1.1_arm64.deb ... 109s Unpacking libpsl5t64:arm64 (0.21.2-1.1) ... 109s dpkg: libcurl3-gnutls:arm64: dependency problems, but removing anyway as you requested: 109s libfwupd2:arm64 depends on libcurl3-gnutls (>= 7.63.0). 109s fwupd depends on libcurl3-gnutls (>= 7.63.0). 109s 109s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74841 files and directories currently installed.) 109s Removing libcurl3-gnutls:arm64 (8.5.0-2ubuntu2) ... 110s Selecting previously unselected package libcurl3t64-gnutls:arm64. 110s (Reading database ... (Reading database ... 5% (Reading database ... 10% (Reading database ... 15% (Reading database ... 20% (Reading database ... 25% (Reading database ... 30% (Reading database ... 35% (Reading database ... 40% (Reading database ... 45% (Reading database ... 50% (Reading database ... 55% (Reading database ... 60% (Reading database ... 65% (Reading database ... 70% (Reading database ... 75% (Reading database ... 80% (Reading database ... 85% (Reading database ... 90% (Reading database ... 95% (Reading database ... 100% (Reading database ... 74834 files and directories currently installed.) 110s Preparing to unpack .../00-libcurl3t64-gnutls_8.5.0-2ubuntu8_arm64.deb ... 110s Unpacking libcurl3t64-gnutls:arm64 (8.5.0-2ubuntu8) ... 110s Selecting previously unselected package libboost-chrono1.83.0t64:arm64. 110s Preparing to unpack .../01-libboost-chrono1.83.0t64_1.83.0-2.1ubuntu2_arm64.deb ... 110s Unpacking libboost-chrono1.83.0t64:arm64 (1.83.0-2.1ubuntu2) ... 110s Selecting previously unselected package libboost-filesystem1.83.0:arm64. 110s Preparing to unpack .../02-libboost-filesystem1.83.0_1.83.0-2.1ubuntu2_arm64.deb ... 110s Unpacking libboost-filesystem1.83.0:arm64 (1.83.0-2.1ubuntu2) ... 110s Selecting previously unselected package libboost-iostreams1.83.0:arm64. 110s Preparing to unpack .../03-libboost-iostreams1.83.0_1.83.0-2.1ubuntu2_arm64.deb ... 110s Unpacking libboost-iostreams1.83.0:arm64 (1.83.0-2.1ubuntu2) ... 110s Selecting previously unselected package libdeflate0:arm64. 110s Preparing to unpack .../04-libdeflate0_1.19-1_arm64.deb ... 110s Unpacking libdeflate0:arm64 (1.19-1) ... 110s Selecting previously unselected package libhtscodecs2:arm64. 110s Preparing to unpack .../05-libhtscodecs2_1.6.0-1_arm64.deb ... 110s Unpacking libhtscodecs2:arm64 (1.6.0-1) ... 110s Selecting previously unselected package libhts3t64:arm64. 110s Preparing to unpack .../06-libhts3t64_1.19+ds-1.1build2_arm64.deb ... 110s Unpacking libhts3t64:arm64 (1.19+ds-1.1build2) ... 110s Selecting previously unselected package libjs-jquery. 110s Preparing to unpack .../07-libjs-jquery_3.6.1+dfsg+~3.5.14-1_all.deb ... 110s Unpacking libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 110s Selecting previously unselected package libjs-jquery-datatables. 110s Preparing to unpack .../08-libjs-jquery-datatables_1.11.5+dfsg-2_all.deb ... 110s Unpacking libjs-jquery-datatables (1.11.5+dfsg-2) ... 110s Selecting previously unselected package libjs-jquery-datatables-extensions. 110s Preparing to unpack .../09-libjs-jquery-datatables-extensions_0.0+git20150910.28fd64e+dfsg-5_all.deb ... 110s Unpacking libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 110s Selecting previously unselected package fonts-font-awesome. 110s Preparing to unpack .../10-fonts-font-awesome_5.0.10+really4.7.0~dfsg-4.1_all.deb ... 110s Unpacking fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 110s Selecting previously unselected package node-normalize.css. 110s Preparing to unpack .../11-node-normalize.css_8.0.1-5_all.deb ... 110s Unpacking node-normalize.css (8.0.1-5) ... 110s Selecting previously unselected package node-d3-array. 110s Preparing to unpack .../12-node-d3-array_3.2.0+~cs5.0.6-2_all.deb ... 110s Unpacking node-d3-array (3.2.0+~cs5.0.6-2) ... 110s Selecting previously unselected package node-d3-axis. 110s Preparing to unpack .../13-node-d3-axis_1.0.12+~1.0.16-1_all.deb ... 110s Unpacking node-d3-axis (1.0.12+~1.0.16-1) ... 110s Selecting previously unselected package node-d3-dispatch. 110s Preparing to unpack .../14-node-d3-dispatch_1.0.6+~1.0.9-1_all.deb ... 110s Unpacking node-d3-dispatch (1.0.6+~1.0.9-1) ... 110s Selecting previously unselected package node-d3-selection. 110s Preparing to unpack .../15-node-d3-selection_1.4.1+~1.4.3-1_all.deb ... 110s Unpacking node-d3-selection (1.4.1+~1.4.3-1) ... 110s Selecting previously unselected package node-d3-drag. 110s Preparing to unpack .../16-node-d3-drag_1.2.5+~1.2.5-1_all.deb ... 110s Unpacking node-d3-drag (1.2.5+~1.2.5-1) ... 110s Selecting previously unselected package node-d3-color. 110s Preparing to unpack .../17-node-d3-color_1.4.1+~1.4.2-1_all.deb ... 110s Unpacking node-d3-color (1.4.1+~1.4.2-1) ... 110s Selecting previously unselected package node-d3-interpolate. 110s Preparing to unpack .../18-node-d3-interpolate_1.4.0+~1.4.2-1_all.deb ... 110s Unpacking node-d3-interpolate (1.4.0+~1.4.2-1) ... 110s Selecting previously unselected package node-d3-ease. 110s Preparing to unpack .../19-node-d3-ease_1.0.7+~1.0.11-1_all.deb ... 110s Unpacking node-d3-ease (1.0.7+~1.0.11-1) ... 110s Selecting previously unselected package node-d3-timer. 110s Preparing to unpack .../20-node-d3-timer_1.0.10+~1.0.10-1_all.deb ... 110s Unpacking node-d3-timer (1.0.10+~1.0.10-1) ... 110s Selecting previously unselected package node-d3-transition. 110s Preparing to unpack .../21-node-d3-transition_1.3.2+~1.3.2-1_all.deb ... 110s Unpacking node-d3-transition (1.3.2+~1.3.2-1) ... 110s Selecting previously unselected package node-d3-brush. 110s Preparing to unpack .../22-node-d3-brush_1.1.6+~1.1.5-1_all.deb ... 110s Unpacking node-d3-brush (1.1.6+~1.1.5-1) ... 111s Selecting previously unselected package node-d3-path. 111s Preparing to unpack .../23-node-d3-path_1.0.9+~1.0.9-1_all.deb ... 111s Unpacking node-d3-path (1.0.9+~1.0.9-1) ... 111s Selecting previously unselected package node-d3-chord. 111s Preparing to unpack .../24-node-d3-chord_1.0.6+~1.0.11-1_all.deb ... 111s Unpacking node-d3-chord (1.0.6+~1.0.11-1) ... 111s Selecting previously unselected package node-d3-collection. 111s Preparing to unpack .../25-node-d3-collection_1.0.7+~1.0.10-1_all.deb ... 111s Unpacking node-d3-collection (1.0.7+~1.0.10-1) ... 111s Selecting previously unselected package node-d3-contour. 111s Preparing to unpack .../26-node-d3-contour_1.3.2+~1.3.3-1_all.deb ... 111s Unpacking node-d3-contour (1.3.2+~1.3.3-1) ... 111s Selecting previously unselected package node-safe-buffer. 111s Preparing to unpack .../27-node-safe-buffer_5.2.1+~cs2.1.2-3_all.deb ... 111s Unpacking node-safe-buffer (5.2.1+~cs2.1.2-3) ... 111s Selecting previously unselected package node-iconv-lite. 111s Preparing to unpack .../28-node-iconv-lite_0.6.3-3_all.deb ... 111s Unpacking node-iconv-lite (0.6.3-3) ... 111s Selecting previously unselected package node-d3-queue. 111s Preparing to unpack .../29-node-d3-queue_3.0.7-13_all.deb ... 111s Unpacking node-d3-queue (3.0.7-13) ... 111s Selecting previously unselected package node-rw. 111s Preparing to unpack .../30-node-rw_1.3.3-5_all.deb ... 111s Unpacking node-rw (1.3.3-5) ... 111s Selecting previously unselected package node-commander. 111s Preparing to unpack .../31-node-commander_9.4.1-1_all.deb ... 111s Unpacking node-commander (9.4.1-1) ... 111s Selecting previously unselected package node-d3-dsv. 111s Preparing to unpack .../32-node-d3-dsv_1.2.0+~1.2.3-1_all.deb ... 111s Unpacking node-d3-dsv (1.2.0+~1.2.3-1) ... 111s Selecting previously unselected package node-d3-fetch. 111s Preparing to unpack .../33-node-d3-fetch_1.2.0+~1.2.2-1_all.deb ... 111s Unpacking node-d3-fetch (1.2.0+~1.2.2-1) ... 111s Selecting previously unselected package node-d3-quadtree. 111s Preparing to unpack .../34-node-d3-quadtree_1.0.7+~1.0.9-1_all.deb ... 111s Unpacking node-d3-quadtree (1.0.7+~1.0.9-1) ... 111s Selecting previously unselected package node-d3-force. 111s Preparing to unpack .../35-node-d3-force_2.1.1+~2.1.4-1_all.deb ... 111s Unpacking node-d3-force (2.1.1+~2.1.4-1) ... 111s Selecting previously unselected package libjs-d3-format. 111s Preparing to unpack .../36-libjs-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 111s Unpacking libjs-d3-format (1:1.4.5+~1.4.2-2) ... 111s Selecting previously unselected package node-d3-format. 111s Preparing to unpack .../37-node-d3-format_1%3a1.4.5+~1.4.2-2_all.deb ... 111s Unpacking node-d3-format (1:1.4.5+~1.4.2-2) ... 111s Selecting previously unselected package node-d3-geo. 111s Preparing to unpack .../38-node-d3-geo_1.12.1+~1.12.4-1_all.deb ... 111s Unpacking node-d3-geo (1.12.1+~1.12.4-1) ... 111s Selecting previously unselected package node-d3-hierarchy. 111s Preparing to unpack .../39-node-d3-hierarchy_1.1.9+~1.1.8-1_all.deb ... 111s Unpacking node-d3-hierarchy (1.1.9+~1.1.8-1) ... 111s Selecting previously unselected package node-d3-polygon. 111s Preparing to unpack .../40-node-d3-polygon_1.0.6+~1.0.8-1_all.deb ... 111s Unpacking node-d3-polygon (1.0.6+~1.0.8-1) ... 111s Selecting previously unselected package node-d3-random. 111s Preparing to unpack .../41-node-d3-random_1.1.2+~1.1.3-1_all.deb ... 111s Unpacking node-d3-random (1.1.2+~1.1.3-1) ... 111s Selecting previously unselected package node-d3-time. 111s Preparing to unpack .../42-node-d3-time_1.1.0+~1.1.1-1_all.deb ... 111s Unpacking node-d3-time (1.1.0+~1.1.1-1) ... 111s Selecting previously unselected package node-d3-time-format. 111s Preparing to unpack .../43-node-d3-time-format_2.3.0+~2.3.1-1_all.deb ... 111s Unpacking node-d3-time-format (2.3.0+~2.3.1-1) ... 111s Selecting previously unselected package node-d3-scale. 111s Preparing to unpack .../44-node-d3-scale_2.2.2+~2.2.6-1_all.deb ... 111s Unpacking node-d3-scale (2.2.2+~2.2.6-1) ... 111s Selecting previously unselected package node-d3-scale-chromatic. 111s Preparing to unpack .../45-node-d3-scale-chromatic_1.5.0+~1.5.1-1_all.deb ... 111s Unpacking node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 111s Selecting previously unselected package node-d3-shape. 111s Preparing to unpack .../46-node-d3-shape_1.3.7+~1.3.8-1_all.deb ... 111s Unpacking node-d3-shape (1.3.7+~1.3.8-1) ... 111s Selecting previously unselected package node-d3-voronoi. 111s Preparing to unpack .../47-node-d3-voronoi_1.1.4+~1.1.9-1_all.deb ... 111s Unpacking node-d3-voronoi (1.1.4+~1.1.9-1) ... 112s Selecting previously unselected package node-d3-zoom. 112s Preparing to unpack .../48-node-d3-zoom_1.8.3+~1.8.4-1_all.deb ... 112s Unpacking node-d3-zoom (1.8.3+~1.8.4-1) ... 112s Selecting previously unselected package node-d3. 112s Preparing to unpack .../49-node-d3_5.16.0+~cs5.28.10-1_all.deb ... 112s Unpacking node-d3 (5.16.0+~cs5.28.10-1) ... 112s Selecting previously unselected package ataqv. 112s Preparing to unpack .../50-ataqv_1.3.1+ds-2build2_arm64.deb ... 112s Unpacking ataqv (1.3.1+ds-2build2) ... 112s Selecting previously unselected package autopkgtest-satdep. 112s Preparing to unpack .../51-1-autopkgtest-satdep.deb ... 112s Unpacking autopkgtest-satdep (0) ... 112s Setting up libhtscodecs2:arm64 (1.6.0-1) ... 112s Setting up node-d3-timer (1.0.10+~1.0.10-1) ... 112s Setting up node-d3-color (1.4.1+~1.4.2-1) ... 112s Setting up node-d3-interpolate (1.4.0+~1.4.2-1) ... 112s Setting up node-d3-queue (3.0.7-13) ... 112s Setting up node-d3-hierarchy (1.1.9+~1.1.8-1) ... 112s Setting up node-d3-ease (1.0.7+~1.0.11-1) ... 112s Setting up node-d3-scale-chromatic (1.5.0+~1.5.1-1) ... 112s Setting up libpsl5t64:arm64 (0.21.2-1.1) ... 112s Setting up libdeflate0:arm64 (1.19-1) ... 112s Setting up node-d3-selection (1.4.1+~1.4.3-1) ... 112s Setting up node-d3-axis (1.0.12+~1.0.16-1) ... 112s Setting up libboost-filesystem1.83.0:arm64 (1.83.0-2.1ubuntu2) ... 112s Setting up node-d3-path (1.0.9+~1.0.9-1) ... 112s Setting up libnettle8t64:arm64 (3.9.1-2.2) ... 112s Setting up node-safe-buffer (5.2.1+~cs2.1.2-3) ... 112s Setting up node-rw (1.3.3-5) ... 112s Setting up node-d3-polygon (1.0.6+~1.0.8-1) ... 112s Setting up node-d3-quadtree (1.0.7+~1.0.9-1) ... 112s Setting up libboost-chrono1.83.0t64:arm64 (1.83.0-2.1ubuntu2) ... 112s Setting up libboost-iostreams1.83.0:arm64 (1.83.0-2.1ubuntu2) ... 112s Setting up node-d3-collection (1.0.7+~1.0.10-1) ... 112s Setting up node-d3-voronoi (1.1.4+~1.1.9-1) ... 112s Setting up node-d3-dispatch (1.0.6+~1.0.9-1) ... 112s Setting up node-d3-time (1.1.0+~1.1.1-1) ... 112s Setting up node-commander (9.4.1-1) ... 112s Setting up node-d3-array (3.2.0+~cs5.0.6-2) ... 112s Setting up libhogweed6t64:arm64 (3.9.1-2.2) ... 112s Setting up libjs-d3-format (1:1.4.5+~1.4.2-2) ... 112s Setting up libjs-jquery (3.6.1+dfsg+~3.5.14-1) ... 112s Setting up node-d3-geo (1.12.1+~1.12.4-1) ... 112s Setting up node-normalize.css (8.0.1-5) ... 112s Setting up node-d3-transition (1.3.2+~1.3.2-1) ... 112s Setting up fonts-font-awesome (5.0.10+really4.7.0~dfsg-4.1) ... 112s Setting up node-d3-random (1.1.2+~1.1.3-1) ... 112s Setting up libjs-jquery-datatables-extensions (0.0+git20150910.28fd64e+dfsg-5) ... 112s Setting up libgnutls30t64:arm64 (3.8.3-1.1ubuntu2) ... 112s Setting up node-d3-format (1:1.4.5+~1.4.2-2) ... 112s Setting up libcurl4t64:arm64 (8.5.0-2ubuntu8) ... 112s Setting up node-d3-time-format (2.3.0+~2.3.1-1) ... 112s Setting up node-d3-chord (1.0.6+~1.0.11-1) ... 112s Setting up libcurl3t64-gnutls:arm64 (8.5.0-2ubuntu8) ... 112s Setting up node-d3-shape (1.3.7+~1.3.8-1) ... 112s Setting up libjs-jquery-datatables (1.11.5+dfsg-2) ... 112s Setting up node-d3-drag (1.2.5+~1.2.5-1) ... 112s Setting up node-iconv-lite (0.6.3-3) ... 112s Setting up node-d3-scale (2.2.2+~2.2.6-1) ... 112s Setting up node-d3-force (2.1.1+~2.1.4-1) ... 112s Setting up node-d3-contour (1.3.2+~1.3.3-1) ... 112s Setting up node-d3-brush (1.1.6+~1.1.5-1) ... 112s Setting up libhts3t64:arm64 (1.19+ds-1.1build2) ... 112s Setting up curl (8.5.0-2ubuntu8) ... 112s Setting up node-d3-dsv (1.2.0+~1.2.3-1) ... 112s Setting up node-d3-zoom (1.8.3+~1.8.4-1) ... 112s Setting up node-d3-fetch (1.2.0+~1.2.2-1) ... 112s Setting up node-d3 (5.16.0+~cs5.28.10-1) ... 112s Setting up ataqv (1.3.1+ds-2build2) ... 112s Setting up autopkgtest-satdep (0) ... 112s Processing triggers for man-db (2.12.0-3) ... 112s Processing triggers for libc-bin (2.39-0ubuntu6) ... 119s (Reading database ... 76506 files and directories currently installed.) 119s Removing autopkgtest-satdep (0) ... 119s autopkgtest [02:36:08]: test run-unit-test: [----------------------- 121s Reading human autosomal references from autosomal_references.gz. 121s Autosomal references for human: 121s I 121s II 121s III 121s Reading human autosomal references from autosomal_references.gz. 121s Autosomal references for human: 121s I 121s II 121s III 121s Reading human autosomal references from autosomal_references.gz. 121s Autosomal references for human: 121s I 121s II 121s III 122s Read 411 excluded regions from exclude.dac.bed.gz. 122s Read 1649 excluded regions from exclude.duke.bed.gz. 122s Loading TSS file 'hg19.tss.refseq.bed.gz'. 122s Excluding TSS [chr11 10530722 10530723 MTRNR2L8 0 -] which overlaps excluded region [chr11 10529403 10531969 Low_mappability_island 1000 .] 123s Excluding TSS [chr12 118573688 118573689 PEBP1 0 +] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 123s Excluding TSS [chr14 105196180 105196181 ADSSL1 0 +] which overlaps excluded region [chr14 105195912 105196275 TAR1 1000 .] 123s Excluding TSS [chr17 22022436 22022437 MTRNR2L1 0 +] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 123s Excluding TSS [chr20 55934877 55934878 MTRNR2L3 0 -] which overlaps excluded region [chr20 55932703 55936114 chrM 1000 .] 123s Excluding TSS [chr5 79946853 79946854 MTRNR2L2 0 -] which overlaps excluded region [chr5 79945807 79948223 Low_mappability_island 1000 .] 123s Excluding TSS [chr6 62284007 62284008 MTRNR2L9 0 +] which overlaps excluded region [chr6 62283966 62284581 Low_mappability_island 1000 .] 123s Excluding TSS [chr7 57207570 57207571 ZNF479 0 -] which overlaps excluded region [chr7 57205319 57210318 BSR/Beta 1000 .] 123s Excluding TSS [chr7 63688851 63688852 ZNF679 0 +] which overlaps excluded region [chr7 63686197 63693336 BSR/Beta 1000 .] 123s Excluding TSS [chr7 142374130 142374131 MTRNR2L6 0 +] which overlaps excluded region [chr7 142372972 142375638 Low_mappability_island 1000 .] 124s Excluding TSS [chrX 55208943 55208944 MTRNR2L10 0 -] which overlaps excluded region [chrX 55204685 55210460 chrM 1000 .] 124s Excluding TSS [chrY 25130409 25130410 BPY2B 0 +] which overlaps excluded region [chrY 25122419 25160800 BSR/Beta 1000 .] 124s Excluding TSS [chrY 26764150 26764151 BPY2B 0 +] which overlaps excluded region [chrY 26756160 26794538 BSR/Beta 1000 .] 124s Excluding TSS [chrY 27198250 27198251 BPY2B 0 -] which overlaps excluded region [chrY 27167859 27206241 BSR/Beta 1000 .] 124s chr1 feature count: 2687 124s chr2 feature count: 1715 124s chr3 feature count: 1490 124s chr4 feature count: 1004 124s chr5 feature count: 1132 124s chr6 feature count: 1368 124s chr7 feature count: 1169 124s chr8 feature count: 913 124s chr9 feature count: 1025 124s chr10 feature count: 1039 124s chr11 feature count: 1642 124s chr12 feature count: 1350 124s chr13 feature count: 433 124s chr14 feature count: 785 124s chr15 feature count: 812 124s chr16 feature count: 1106 124s chr17 feature count: 1528 124s chr18 feature count: 398 124s chr19 feature count: 1785 124s chr20 feature count: 694 124s chr21 feature count: 321 124s chr22 feature count: 593 124s Loaded 24989 TSS in 1.33232 seconds. (18756 TSS/second). 124s 124s Collecting metrics from test.bam. 124s 124s Logging problematic reads to SRR891275.problems. 124s 124s Loading peaks for read group SRR891275 from test.peaks.gz. 124s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 124s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 124s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 124s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 124s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 124s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 124s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 124s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 126s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 126s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 126s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 126s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 126s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 126s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 126s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 126s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 126s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 126s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 126s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 126s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 126s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 126s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 126s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 127s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 127s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 127s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 127s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 127s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 127s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 127s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 128s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 128s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 128s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 128s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 128s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 128s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 128s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 128s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 128s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 128s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 128s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 128s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 128s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 128s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 128s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 128s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 128s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 128s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 128s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 128s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 128s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 129s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 129s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 129s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 129s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 129s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 129s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 129s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 129s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 129s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 129s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 129s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 129s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 129s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 129s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 129s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 129s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 129s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 129s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 129s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 129s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 129s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 130s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 130s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 130s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 130s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 130s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 130s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 130s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 130s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 130s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 130s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 130s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 130s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 130s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 130s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 130s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 130s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 130s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 130s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 130s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 130s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 131s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 131s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 131s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 131s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 131s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 131s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 131s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 131s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 131s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 132s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 132s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 132s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 132s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 132s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 132s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 132s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 133s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 133s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 133s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 133s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 133s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 133s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 133s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 133s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 133s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 134s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 134s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 134s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 134s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 134s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 134s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 134s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 134s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 134s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 134s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 134s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 134s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 134s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 134s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 134s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 134s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 134s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 134s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 134s chr1 peak count: 3667 134s chr2 peak count: 3154 134s chr3 peak count: 2528 134s chr4 peak count: 1814 134s chr5 peak count: 2042 134s chr6 peak count: 2483 134s chr7 peak count: 1999 134s chr8 peak count: 1647 134s chr9 peak count: 1475 134s chr10 peak count: 1815 134s chr11 peak count: 1878 134s chr12 peak count: 2078 134s chr13 peak count: 1026 134s chr14 peak count: 1275 134s chr15 peak count: 1140 134s chr16 peak count: 1211 134s chr17 peak count: 1664 134s chr18 peak count: 772 134s chr19 peak count: 1595 134s chr20 peak count: 864 134s chr21 peak count: 487 134s chr22 peak count: 662 134s Loaded 37276 peaks in 10.6071 seconds. (3514.27 peaks/second). 134s 134s Logging problematic reads to SRR891278.problems. 134s 134s Loading peaks for read group SRR891278 from test.peaks.gz. 134s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000 .] 134s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000 .] 134s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000 .] 135s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 135s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 135s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000 .] 135s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000 .] 135s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000 .] 136s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 136s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000 .] 136s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000 .] 136s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000 .] 136s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 136s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000 .] 136s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000 .] 137s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000 .] 137s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000 .] 137s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 137s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 137s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000 .] 137s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000 .] 137s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000 .] 137s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000 .] 137s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 137s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000 .] 137s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 137s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000 .] 138s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000 .] 138s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000 .] 138s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000 .] 138s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000 .] 138s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000 .] 138s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 138s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 138s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000 .] 138s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 138s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 138s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 138s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 138s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000 .] 138s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000 .] 138s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 138s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000 .] 138s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000 .] 139s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000 .] 139s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000 .] 139s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000 .] 139s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000 .] 139s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000 .] 139s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 139s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000 .] 139s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000 .] 139s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000 .] 139s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 139s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000 .] 139s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 139s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 139s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 139s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000 .] 139s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000 .] 139s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000 .] 139s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 139s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 139s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000 .] 139s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000 .] 139s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000 .] 139s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 139s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000 .] 140s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000 .] 140s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000 .] 140s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000 .] 140s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000 .] 140s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000 .] 141s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 141s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 141s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 141s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 141s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000 .] 141s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000 .] 141s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000 .] 141s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 141s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000 .] 141s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000 .] 141s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000 .] 141s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000 .] 141s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000 .] 141s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 141s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 141s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000 .] 141s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000 .] 141s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000 .] 141s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000 .] 141s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000 .] 142s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000 .] 142s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 142s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 142s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 142s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000 .] 142s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 142s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000 .] 142s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000 .] 142s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000 .] 142s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000 .] 142s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000 .] 142s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 142s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000 .] 142s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 142s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000 .] 143s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000 .] 144s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000 .] 144s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000 .] 144s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000 .] 144s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000 .] 144s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 144s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000 .] 144s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 144s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000 .] 144s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000 .] 144s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000 .] 144s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 144s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 144s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 144s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000 .] 144s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 144s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000 .] 144s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000 .] 144s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000 .] 144s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 144s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000 .] 144s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000 .] 144s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 144s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000 .] 144s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000 .] 144s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000 .] 144s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000 .] 144s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000 .] 145s chr1 peak count: 3667 145s chr2 peak count: 3154 145s chr3 peak count: 2528 145s chr4 peak count: 1814 145s chr5 peak count: 2042 145s chr6 peak count: 2483 145s chr7 peak count: 1999 145s chr8 peak count: 1647 145s chr9 peak count: 1475 145s chr10 peak count: 1815 145s chr11 peak count: 1878 145s chr12 peak count: 2078 145s chr13 peak count: 1026 145s chr14 peak count: 1275 145s chr15 peak count: 1140 145s chr16 peak count: 1211 145s chr17 peak count: 1664 145s chr18 peak count: 772 145s chr19 peak count: 1595 145s chr20 peak count: 864 145s chr21 peak count: 487 145s chr22 peak count: 662 145s Loaded 37276 peaks in 10.5071 seconds. (3547.71 peaks/second). 145s 145s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 145s New maximum proper pair fragment length: 53 from [SRR891275.421 1187 chr1 569924 15 50M = 569927 53 TGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACACACC CCCFFFFFGHHHHIGIJIJIEHIGIIIJJGIJJJJGGGJJJJJGIIJJFI XA:Z:chrM,+9376,50M,1; MD:Z:50 NM:i:0 AS:i:50 XS:i:47 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 67 from [SRR891275.1617 99 chr1 2059335 60 50M = 2059352 67 CACCTTAGCTCTGGACACGAATTTGCGGTCATTGCTGTTCTTGTGTCTCT ???DB?D8C:CD42C<<*?DB<9?BBBD?9DD4 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 112 from [SRR891275.176 99 chr1 2419720 60 50M = 2419782 112 ATCCCTGGGACTGTAGGTGGGAAGGGCATTGCAAGGCACAGGGGCGGGGA @BCFFDEDDHHHHHIJICGHI=GHIGIJJJJJIJIJIGHFHIJBHHDB87 MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 145s New maximum proper pair fragment length: 216 from [SRR891275.1770 163 chr1 18154381 60 50M = 18154547 216 CAACTGTTTTGCTTACTCTGACTAATACAGAGAAGGGAGCCACAATATAC C@CFFFDFGHHHHJJJJJJJJJJJJJIEIIHIJJJIGIJIJJJCHHIJJJ MD:Z:50 NM:i:0 AS:i:50 XS:i:21 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 145s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 145s 5: 439 (84.423%) 145s 10: 439 (84.423%) 145s 15: 438 (84.231%) 145s 20: 436 (83.846%) 145s 25: 435 (83.654%) 145s 30: 420 (80.769%) 145s 145s Peak Metrics 145s ------------ 145s Peak count: 37276 145s 145s High quality autosomal alignments that overlapped peaks: 23 (11.500% of all high quality autosomal alignments) 145s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 145s Top peak: 2 (1.000% of all high quality autosomal alignments) 145s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 145s Top 100 peaks: 23 (11.500% of all high quality autosomal alignments) 145s Top 1000 peaks: 23 (11.500% of all high quality autosomal alignments) 145s Top 10,000 peaks: 23 (11.500% of all high quality autosomal alignments) 145s 145s Read Group 145s ========== 145s ID: SRR891278 145s Library: SRR891278 145s Sample: GSM1155967 145s Description: a library of brutal tests? 145s 145s Sequencing center: 145s Sequencing date: 145s Sequencing platform: ILLUMINA 145s Platform model: 145s Platform unit: 145s Flow order: 145s Key sequence: 145s Predicted median insert size: 145s Programs: 145s 145s Metrics 145s ------- 145s 145s Read Mapping Metrics 145s -------------------- 145s Total reads: 520 145s Total problems: 90 (17.308%) 145s Properly paired and mapped reads: 430 (82.692%) 145s Secondary reads: 10 (1.923%) 145s Supplementary reads: 0 (0.000%) 145s Duplicate reads: 158 (30.385% of all reads) 145s 145s Quality Indicators 145s ------------------ 145s Short to mononucleosomal ratio: 2.357 145s High quality, nonduplicate, properly paired, uniquely mapped autosomal alignments: 200 145s as a percentage of autosomal reads: 91.743% 145s as a percentage of all reads: 38.462% 145s TSS enrichment: 3.687 145s 145s Paired Read Metrics 145s ------------------- 145s Paired reads: 520 (100.000%) 145s Paired and mapped reads: 440 (84.615%) 145s FR reads: 430 (82.692308%) 145s First of pair: 259 (49.808%) 145s Second of pair: 261 (50.192%) 145s Forward reads: 261 (50.192%) 145s Reverse reads: 259 (49.808%) 145s Forward mate reads: 260 (50.000%) 145s Reverse mate reads: 260 (50.000%) 145s 145s Unmapped Read Metrics 145s --------------------- 145s Unmapped reads: 8 (1.538%) 145s Unmapped mate reads: 4 (0.769%) 145s Reads not passing quality controls: 0 (0.000%) 145s Unpaired reads: 0 (0.000%) 145s Reads with zero mapping quality: 49 (9.423%) 145s 145s Aberrant Mapping Metrics 145s ------------------------ 145s RF reads: 6 (1.153846%) 145s FF reads: 4 (0.769231%) 145s RR reads: 9 (1.730769%) 145s Reads that paired and mapped but... 145s on different chromosomes: 8 (1.538%) 145s probably too far from their mates: 2 (0.385%) (longest proper fragment seems to be 649) 145s just not properly: 0 (0.000%) 145s 145s Autosomal/Mitochondrial Metrics 145s ------------------------------- 145s Total autosomal reads: 218 (41.923% of all reads) 145s Total mitochondrial reads: 192 (36.923% of all reads) 145s Duplicate autosomal reads: 17 (7.798% of all autosomal reads) 145s Duplicate mitochondrial reads: 92 (47.917% of all mitochondrial reads) 145s 145s 145s Mapping Quality 145s --------------- 145s Mean MAPQ: 48.044 145s Median MAPQ: 60.000 145s Reads with MAPQ >=... 145s 5: 449 (86.346%) 145s 10: 445 (85.577%) 145s 15: 443 (85.192%) 145s 20: 442 (85.000%) 145s 25: 442 (85.000%) 145s 30: 417 (80.192%) 145s 145s Peak Metrics 145s ------------ 145s Peak count: 37276 145s 145s High quality autosomal alignments that overlapped peaks: 92 (46.000% of all high quality autosomal alignments) 145s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 145s Top peak: 2 (1.000% of all high quality autosomal alignments) 145s Top 10 peaks: 20 (10.000% of all high quality autosomal alignments) 145s Top 100 peaks: 92 (46.000% of all high quality autosomal alignments) 145s Top 1000 peaks: 92 (46.000% of all high quality autosomal alignments) 145s Top 10,000 peaks: 92 (46.000% of all high quality autosomal alignments) 145s 145s 145s [E::hts_open_format] Failed to open file "missing_alignment_file.bam" : No such file or directory 145s Read 411 excluded regions from exclude.dac.bed.gz. 145s Read 1649 excluded regions from exclude.duke.bed.gz. 145s Collecting metrics from test.bam. 145s 145s Logging problematic reads to Test collector.problems. 145s 145s Loading peaks for read group Test collector from test.peaks.gz. 145s Excluding peak [chr1 569780 570073 both.broad_peak_1] which overlaps excluded region [chr1 564449 570371 High_Mappability_island 1000.000 .] 145s Excluding peak [chr1 5727305 5727512 both.broad_peak_97] which overlaps excluded region [chr1 5725866 5736651 Low_mappability_island 1000.000 .] 145s Excluding peak [chr1 16840415 16841121 both.broad_peak_297] which overlaps excluded region [chr1 16839923 16841396 Low_mappability_island 1000.000 .] 146s Excluding peak [chr1 121354253 121354849 both.broad_peak_1896] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 146s Excluding peak [chr1 121478396 121478755 both.broad_peak_1897] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 146s Excluding peak [chr1 121484326 121485516 both.broad_peak_1898] which overlaps excluded region [chr1 121351474 121487059 centromeric_repeat 1000.000 .] 146s Excluding peak [chr1 142538265 142538603 both.broad_peak_1899] which overlaps excluded region [chr1 142535434 142543081 Satellite_repeat 1000.000 .] 146s Excluding peak [chr1 148928074 148928756 both.broad_peak_1971] which overlaps excluded region [chr1 148927799 148928362 TAR1 1000.000 .] 147s Excluding peak [chr10 38804202 38804431 both.broad_peak_4296] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 147s Excluding peak [chr10 38817221 38818020 both.broad_peak_4297] which overlaps excluded region [chr10 38772277 38819357 Satellite_repeat 1000.000 .] 147s Excluding peak [chr10 38872037 38872278 both.broad_peak_4298] which overlaps excluded region [chr10 38868892 38889025 Satellite_repeat 1000.000 .] 147s Excluding peak [chr10 42355450 42355650 both.broad_peak_4299] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42358135 42358433 both.broad_peak_4300] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42364634 42365245 both.broad_peak_4301] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42379790 42380383 both.broad_peak_4302] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42384574 42385679 both.broad_peak_4303] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42392602 42392861 both.broad_peak_4304] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42396775 42396995 both.broad_peak_4305] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42398498 42400769 both.broad_peak_4306] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42404317 42404537 both.broad_peak_4307] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42408166 42408438 both.broad_peak_4308] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42442445 42442676 both.broad_peak_4309] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42527244 42528189 both.broad_peak_4310] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42529217 42530048 both.broad_peak_4311] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42534598 42534872 both.broad_peak_4312] which overlaps excluded region [chr10 42354835 42548642 centromeric_repeat 1000.000 .] 147s Excluding peak [chr10 42596780 42597198 both.broad_peak_4313] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 147s Excluding peak [chr10 42599471 42600289 both.broad_peak_4314] which overlaps excluded region [chr10 42596676 42602082 Satellite_repeat 1000.000 .] 147s Excluding peak [chr10 42817448 42818278 both.broad_peak_4315] which overlaps excluded region [chr10 42790522 42818398 Satellite_repeat 1000.000 .] 148s Excluding peak [chr11 189746 190314 both.broad_peak_5511] which overlaps excluded region [chr11 189419 190691 TAR1 1000.000 .] 148s Excluding peak [chr11 50731852 50732074 both.broad_peak_6138] which overlaps excluded region [chr11 50318471 50784078 centromeric_repeat 1000.000 .] 148s Excluding peak [chr11 51572059 51572261 both.broad_peak_6139] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 148s Excluding peak [chr11 51579362 51580694 both.broad_peak_6140] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 148s Excluding peak [chr11 51591018 51591457 both.broad_peak_6141] which overlaps excluded region [chr11 51567242 51594226 centromeric_repeat 1000.000 .] 148s Excluding peak [chr11 55006615 55007430 both.broad_peak_6142] which overlaps excluded region [chr11 54694046 55027975 centromeric_repeat 1000.000 .] 148s Excluding peak [chr11 73221686 73221937 both.broad_peak_6590] which overlaps excluded region [chr11 73221660 73221946 Low_mappability_island 1000.000 .] 148s Excluding peak [chr12 94193 94658 both.broad_peak_7396] which overlaps excluded region [chr12 94147 95158 TAR1 1000.000 .] 148s Excluding peak [chr12 34841382 34841617 both.broad_peak_7957] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 148s Excluding peak [chr12 34846246 34846543 both.broad_peak_7958] which overlaps excluded region [chr12 34432130 34857010 centromeric_repeat 1000.000 .] 148s Excluding peak [chr12 38008155 38008894 both.broad_peak_7959] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 148s Excluding peak [chr12 38023173 38023373 both.broad_peak_7960] which overlaps excluded region [chr12 37989447 38441828 centromeric_repeat 1000.000 .] 149s Excluding peak [chr12 118573678 118574095 both.broad_peak_9235] which overlaps excluded region [chr12 118573638 118573695 LSU-rRNA_Hsa 1000.000 .] 149s Excluding peak [chr12 127650467 127651165 both.broad_peak_9421] which overlaps excluded region [chr12 127650407 127651075 LSU-rRNA_Hsa 1000.000 .] 149s Excluding peak [chr14 32953483 32953821 both.broad_peak_10712] which overlaps excluded region [chr14 32953263 32954381 Low_mappability_island 1000.000 .] 149s Excluding peak [chr15 80444564 80445859 both.broad_peak_12630] which overlaps excluded region [chr15 80445513 80445569 (GAGTG)n 1000.000 .] 149s Excluding peak [chr16 60436 61192 both.broad_peak_12924] which overlaps excluded region [chr16 60058 61142 TAR1 1000.000 .] 149s Excluding peak [chr16 33866265 33866524 both.broad_peak_13513] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 149s Excluding peak [chr16 33918664 33919304 both.broad_peak_13514] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 149s Excluding peak [chr16 34009313 34009561 both.broad_peak_13515] which overlaps excluded region [chr16 33864355 34023306 centromeric_repeat 1000.000 .] 149s Excluding peak [chr16 46386270 46386795 both.broad_peak_13516] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 149s Excluding peak [chr16 46391235 46392140 both.broad_peak_13517] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 149s Excluding peak [chr16 46403548 46403849 both.broad_peak_13518] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 149s Excluding peak [chr16 46416804 46417405 both.broad_peak_13519] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 149s Excluding peak [chr16 46427429 46427991 both.broad_peak_13520] which overlaps excluded region [chr16 46385718 46456668 Satellite_repeat 1000.000 .] 150s Excluding peak [chr17 22020593 22020916 both.broad_peak_14569] which overlaps excluded region [chr17 22018524 22032049 Low_mappability_island 1000.000 .] 150s Excluding peak [chr17 22252084 22253296 both.broad_peak_14570] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 150s Excluding peak [chr17 22261278 22261740 both.broad_peak_14571] which overlaps excluded region [chr17 22221073 22263006 centromeric_repeat 1000.000 .] 150s Excluding peak [chr17 25264883 25265249 both.broad_peak_14572] which overlaps excluded region [chr17 25263010 25268059 Satellite_repeat 1000.000 .] 150s Excluding peak [chr17 41381728 41382265 both.broad_peak_14950] which overlaps excluded region [chr17 41381502 41382591 High_Mappability_island 1000.000 .] 150s Excluding peak [chr17 41465631 41466936 both.broad_peak_14957] which overlaps excluded region [chr17 41465562 41467288 High_Mappability_island 1000.000 .] 150s Excluding peak [chr17 51183057 51183341 both.broad_peak_15172] which overlaps excluded region [chr17 51183038 51183763 Low_mappability_island 1000.000 .] 150s Excluding peak [chr17 58602907 58603721 both.broad_peak_15290] which overlaps excluded region [chr17 58603715 58603738 (GAGTG)n 1000.000 .] 150s Excluding peak [chr18 111564 112042 both.broad_peak_15816] which overlaps excluded region [chr18 105658 112233 Satellite_repeat 1000.000 .] 150s Excluding peak [chr18 18512827 18513193 both.broad_peak_16011] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 150s Excluding peak [chr18 18516045 18520399 both.broad_peak_16012] which overlaps excluded region [chr18 18510894 18520356 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 21776802 21777550 both.broad_peak_17342] which overlaps excluded region [chr19 21776132 21780768 BSR/Beta 1000.000 .] 150s Excluding peak [chr19 24169382 24170027 both.broad_peak_17364] which overlaps excluded region [chr19 24156856 24171961 BSR/Beta 1000.000 .] 150s Excluding peak [chr19 24474565 24474765 both.broad_peak_17369] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 24526069 24526320 both.broad_peak_17370] which overlaps excluded region [chr19 24385474 24633168 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 27731880 27733339 both.broad_peak_17371] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 27738359 27738668 both.broad_peak_17372] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 27756701 27756901 both.broad_peak_17373] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 27801311 27801531 both.broad_peak_17374] which overlaps excluded region [chr19 27730611 28262682 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 37784325 37784692 both.broad_peak_17536] which overlaps excluded region [chr19 37759473 37797722 centromeric_repeat 1000.000 .] 150s Excluding peak [chr19 42069917 42070450 both.broad_peak_17680] which overlaps excluded region [chr19 42069989 42071891 LSU-rRNA_Hsa 1000.000 .] 151s Excluding peak [chr2 89848588 89848836 both.broad_peak_19338] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 151s Excluding peak [chr2 89872032 89872646 both.broad_peak_19339] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 151s Excluding peak [chr2 89878336 89879257 both.broad_peak_19340] which overlaps excluded region [chr2 89830421 89880514 Satellite_repeat 1000.000 .] 151s Excluding peak [chr2 90449580 90449808 both.broad_peak_19342] which overlaps excluded region [chr2 90443001 90545431 Low_mappability_island 1000.000 .] 151s Excluding peak [chr2 91847848 91848177 both.broad_peak_19344] which overlaps excluded region [chr2 91847957 91848503 TAR1 1000.000 .] 151s Excluding peak [chr2 92272876 92273767 both.broad_peak_19345] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92281197 92281779 both.broad_peak_19346] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92284237 92284462 both.broad_peak_19347] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92290435 92291262 both.broad_peak_19348] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92296588 92297023 both.broad_peak_19349] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92305535 92305892 both.broad_peak_19350] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 92317234 92317870 both.broad_peak_19351] which overlaps excluded region [chr2 92267428 92326280 centromeric_repeat 1000.000 .] 151s Excluding peak [chr2 114361072 114362020 both.broad_peak_19697] which overlaps excluded region [chr2 114361054 114362417 TAR1 1000.000 .] 151s Excluding peak [chr2 132559385 132560425 both.broad_peak_19833] which overlaps excluded region [chr2 132560214 132560696 TAR1 1000.000 .] 151s Excluding peak [chr2 132996509 132996755 both.broad_peak_19834] which overlaps excluded region [chr2 132994855 133007983 ALR/Alpha 1000.000 .] 151s Excluding peak [chr2 149639210 149639450 both.broad_peak_19986] which overlaps excluded region [chr2 149639207 149639515 Low_mappability_island 1000.000 .] 151s Excluding peak [chr2 162135291 162136055 both.broad_peak_20150] which overlaps excluded region [chr2 162135000 162139241 Low_mappability_island 1000.000 .] 152s Excluding peak [chr20 26269111 26270030 both.broad_peak_21666] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 26278258 26278484 both.broad_peak_21667] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 26289332 26290609 both.broad_peak_21668] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 26305634 26305887 both.broad_peak_21669] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 26317322 26318676 both.broad_peak_21670] which overlaps excluded region [chr20 26257032 26320267 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 29512475 29512675 both.broad_peak_21671] which overlaps excluded region [chr20 29511127 29514978 ALR/Alpha 1000.000 .] 152s Excluding peak [chr20 29517798 29518922 both.broad_peak_21672] which overlaps excluded region [chr20 29517710 29521147 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 29813756 29813985 both.broad_peak_21678] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 29831826 29832026 both.broad_peak_21679] which overlaps excluded region [chr20 29803876 29833334 centromeric_repeat 1000.000 .] 152s Excluding peak [chr20 62917250 62917592 both.broad_peak_22240] which overlaps excluded region [chr20 62916702 62918053 telomeric_repeat 1000.000 .] 152s Excluding peak [chr21 9825749 9827187 both.broad_peak_22241] which overlaps excluded region [chr21 9825451 9827612 High_Mappability_island 1000.000 .] 152s Excluding peak [chr21 10773372 10773572 both.broad_peak_22242] which overlaps excluded region [chr21 10697886 10860890 centromeric_repeat 1000.000 .] 152s Excluding peak [chr21 11186125 11187338 both.broad_peak_22243] which overlaps excluded region [chr21 11186054 11188131 Satellite_repeat 1000.000 .] 152s Excluding peak [chr22 18878342 18878659 both.broad_peak_22759] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 152s Excluding peak [chr22 18879876 18880128 both.broad_peak_22760] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 152s Excluding peak [chr22 18883583 18883799 both.broad_peak_22761] which overlaps excluded region [chr22 18876789 18884510 Satellite_repeat 1000.000 .] 152s Excluding peak [chr22 22652231 22653042 both.broad_peak_22847] which overlaps excluded region [chr22 22652105 22652554 TAR1 1000.000 .] 152s Excluding peak [chr3 25508907 25509133 both.broad_peak_23723] which overlaps excluded region [chr3 25508897 25509131 Low_mappability_island 1000.000 .] 152s Excluding peak [chr3 73159761 73160669 both.broad_peak_24512] which overlaps excluded region [chr3 73159606 73161131 snRNA 1000.000 .] 152s Excluding peak [chr3 96336804 96337073 both.broad_peak_24578] which overlaps excluded region [chr3 96335934 96337436 Low_mappability_island 1000.000 .] 153s Excluding peak [chr3 196625608 196625808 both.broad_peak_25903] which overlaps excluded region [chr3 196625514 196625860 Satellite_repeat 1000.000 .] 153s Excluding peak [chr4 49094768 49094968 both.broad_peak_26437] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 49107449 49107766 both.broad_peak_26438] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 49122928 49123231 both.broad_peak_26439] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 49151102 49151911 both.broad_peak_26440] which overlaps excluded region [chr4 49085372 49342114 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 49645060 49645303 both.broad_peak_26441] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 49659456 49659760 both.broad_peak_26442] which overlaps excluded region [chr4 49488472 49662085 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 56194226 56194485 both.broad_peak_26481] which overlaps excluded region [chr4 56194229 56194584 Low_mappability_island 1000.000 .] 153s Excluding peak [chr4 68264592 68266730 both.broad_peak_26530] which overlaps excluded region [chr4 68264186 68266830 centromeric_repeat 1000.000 .] 153s Excluding peak [chr4 191032545 191032745 both.broad_peak_27751] which overlaps excluded region [chr4 191026302 191044344 telomeric_repeat 1000.000 .] 153s Excluding peak [chr5 46364115 46364315 both.broad_peak_28116] which overlaps excluded region [chr5 45908253 46411114 centromeric_repeat 1000.000 .] 153s Excluding peak [chr5 49450550 49450756 both.broad_peak_28117] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 153s Excluding peak [chr5 49547478 49547699 both.broad_peak_28118] which overlaps excluded region [chr5 49405493 49554574 centromeric_repeat 1000.000 .] 154s Excluding peak [chr5 134259765 134260404 both.broad_peak_29117] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 154s Excluding peak [chr5 134262625 134262877 both.broad_peak_29118] which overlaps excluded region [chr5 134258949 134264271 Low_mappability_island 1000.000 .] 154s Excluding peak [chr6 58776533 58779369 both.broad_peak_30874] which overlaps excluded region [chr6 58745955 58780547 centromeric_repeat 1000.000 .] 155s Excluding peak [chr7 43878412 43878832 both.broad_peak_32927] which overlaps excluded region [chr7 43878355 43878530 TAR1 1000.000 .] 155s Excluding peak [chr7 45291476 45291676 both.broad_peak_32976] which overlaps excluded region [chr7 45291517 45291740 Low_mappability_island 1000.000 .] 155s Excluding peak [chr7 57549361 57549585 both.broad_peak_33054] which overlaps excluded region [chr7 57544726 57556913 Satellite_repeat 1000.000 .] 155s Excluding peak [chr7 57957789 57957996 both.broad_peak_33055] which overlaps excluded region [chr7 57939184 58055539 centromeric_repeat 1000.000 .] 155s Excluding peak [chr7 61968705 61969761 both.broad_peak_33056] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 155s Excluding peak [chr7 61986136 61986336 both.broad_peak_33057] which overlaps excluded region [chr7 61054285 62454680 centromeric_repeat 1000.000 .] 155s Excluding peak [chr7 64099785 64100002 both.broad_peak_33067] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 155s Excluding peak [chr7 64100838 64101105 both.broad_peak_33068] which overlaps excluded region [chr7 64090864 64105357 BSR/Beta 1000.000 .] 155s Excluding peak [chr7 100550706 100551292 both.broad_peak_33481] which overlaps excluded region [chr7 100550640 100551321 Low_mappability_island 1000.000 .] 155s Excluding peak [chr8 43092778 43097038 both.broad_peak_34830] which overlaps excluded region [chr8 43092737 43097573 Satellite_repeat 1000.000 .] 155s Excluding peak [chr8 43779474 43779699 both.broad_peak_34831] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 155s Excluding peak [chr8 43794100 43794746 both.broad_peak_34832] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 155s Excluding peak [chr8 43820539 43820739 both.broad_peak_34833] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 155s Excluding peak [chr8 43821992 43822192 both.broad_peak_34834] which overlaps excluded region [chr8 43399486 43843604 centromeric_repeat 1000.000 .] 155s Excluding peak [chr8 46845309 46845549 both.broad_peak_34835] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 155s Excluding peak [chr8 46852362 46852861 both.broad_peak_34836] which overlaps excluded region [chr8 46838215 47457541 centromeric_repeat 1000.000 .] 156s Excluding peak [chr8 100507997 100508253 both.broad_peak_35355] which overlaps excluded region [chr8 100508010 100508287 Low_mappability_island 1000.000 .] 156s Excluding peak [chr9 45356920 45357350 both.broad_peak_36413] which overlaps excluded region [chr9 45355954 45357644 telomeric_repeat 1000.000 .] 156s Excluding peak [chr9 45439723 45439970 both.broad_peak_36414] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 156s Excluding peak [chr9 45441747 45442443 both.broad_peak_36415] which overlaps excluded region [chr9 45435109 45443517 centromeric_repeat 1000.000 .] 156s Excluding peak [chr9 66494045 66494608 both.broad_peak_36419] which overlaps excluded region [chr9 66494170 66494805 TAR1 1000.000 .] 156s Excluding peak [chr9 66824178 66824684 both.broad_peak_36421] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 156s Excluding peak [chr9 66833083 66833633 both.broad_peak_36422] which overlaps excluded region [chr9 66767710 66864329 centromeric_repeat 1000.000 .] 156s Excluding peak [chr9 67339988 67340844 both.broad_peak_36425] which overlaps excluded region [chr9 67340080 67340661 TAR1 1000.000 .] 156s Excluding peak [chr9 68377361 68377574 both.broad_peak_36426] which overlaps excluded region [chr9 68376841 68377466 TAR1 1000.000 .] 156s Excluding peak [chr9 68412991 68414393 both.broad_peak_36427] which overlaps excluded region [chr9 68410775 68435115 Low_mappability_island 1000.000 .] 156s Excluding peak [chr9 70648541 70648768 both.broad_peak_36436] which overlaps excluded region [chr9 70648394 70648886 TAR1 1000.000 .] 156s chr1 peak count: 3667 156s chr2 peak count: 3154 156s chr3 peak count: 2528 156s chr4 peak count: 1814 156s chr5 peak count: 2042 156s chr6 peak count: 2483 156s chr7 peak count: 1999 156s chr8 peak count: 1647 156s chr9 peak count: 1475 156s chr10 peak count: 1815 156s chr11 peak count: 1878 156s chr12 peak count: 2078 156s chr13 peak count: 1026 156s chr14 peak count: 1275 156s chr15 peak count: 1140 156s chr16 peak count: 1211 156s chr17 peak count: 1664 156s chr18 peak count: 772 156s chr19 peak count: 1595 156s chr20 peak count: 864 156s chr21 peak count: 487 156s chr22 peak count: 662 156s Loaded 37276 peaks in 10.736 seconds. (3471.963 peaks/second). 156s 156s New maximum proper pair fragment length: 42 from [SRR891275.608 1123 chr1 569907 57 42M = 569907 42 CACTAACCATATACCAATGATGGCGCGATGTAACACGAGAAA @@@FFFEFFDHFBHIJIEFHJIGGF:CFGEDF?FFHEG@FGG XA:Z:chrM,+9359,42M,1; MD:Z:42 NM:i:0 AS:i:42 XS:i:37 RG:Z:SRR891275 PG:Z:MarkDuplicates] 156s New maximum proper pair fragment length: 330 from [SRR891278.50 1123 chr1 569913 27 50M = 570193 330 NCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGC #1=DDFFFHHGHHJJJJIJJJGEGHIGGIIIJJJJIIFGGIJHIIJICHH XA:Z:chrM,+9365,50M,2; MD:Z:0C49 NM:i:1 AS:i:49 XS:i:44 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 156s New maximum proper pair fragment length: 361 from [SRR891278.227 99 chr1 17047555 60 50M = 17047866 361 GACTCCCTCAAGGGCAGCTGAGAGGGAGGACTCAGGGCACTGGGGAAAGT @CCFFFFFHGHHHJGEHIIJGGJIIJDIIGGEHIIJJBFGGHGEHHIJFC XA:Z:chr1,+144886802,48M2S,2; MD:Z:50 NM:i:0 AS:i:50 XS:i:42 RG:Z:SRR891278 PG:Z:MarkDuplicates-4FB7F45F] 156s New maximum proper pair fragment length: 562 from [SRR891275.385 163 chr1 43042844 60 50M = 43043356 562 AACCTACAGGAAAAGCTGGTTCAGGAGAAATCTAAAGTTGCTGATGCAGA CCCFFFFFHGGHGJJJJFIEHHHJJGIIJIIJJJJJIHGIJIJGIIJIII MD:Z:50 NM:i:0 AS:i:50 XS:i:0 RG:Z:SRR891275 PG:Z:MarkDuplicates] 156s New maximum proper pair fragment length: 609 from [SRR891275.714 99 chr1 79875808 60 50M = 79876367 609 GGCCCAGCCAAGTTGACACATAAAATAAACTTTCACAATATTGCAGGCAG @@@DDDFFFHAH=... 156s 5: 888 (85.385%) 156s 10: 884 (85.000%) 156s 15: 881 (84.712%) 156s 20: 878 (84.423%) 156s 25: 877 (84.327%) 156s 30: 837 (80.481%) 156s 156s Peak Metrics 156s ------------ 156s Peak count: 37276 156s 156s High quality autosomal alignments that overlapped peaks: 115 (28.750% of all high quality autosomal alignments) 156s Number of high quality autosomal alignments overlapping the top 10,000 peaks: 156s Top peak: 2 (0.500% of all high quality autosomal alignments) 156s Top 10 peaks: 20 (5.000% of all high quality autosomal alignments) 156s Top 100 peaks: 115 (28.750% of all high quality autosomal alignments) 156s Top 1000 peaks: 115 (28.750% of all high quality autosomal alignments) 156s Top 10,000 peaks: 115 (28.750% of all high quality autosomal alignments) 156s 156s 157s Read 411 excluded regions from exclude.dac.bed.gz. 157s Read 1649 excluded regions from exclude.duke.bed.gz. 157s Collecting metrics from test.bam. 157s 157s Logging problematic reads to Test collector.problems. 157s 157s Loading peaks for read group Test collector from notthere.peaks.gz. 157s Read 411 excluded regions from exclude.dac.bed.gz. 157s Read 1649 excluded regions from exclude.duke.bed.gz. 157s Loading TSS file 'notthere.bed.gz'. 157s [E::sam_format1_append] Corrupted aux data for read SRR891268.122333488 157s =============================================================================== 157s All tests passed (241 assertions in 54 test cases) 157s 158s autopkgtest [02:36:47]: test run-unit-test: -----------------------] 158s run-unit-test PASS 158s autopkgtest [02:36:47]: test run-unit-test: - - - - - - - - - - results - - - - - - - - - - 159s autopkgtest [02:36:48]: @@@@@@@@@@@@@@@@@@@@ summary 159s run-unit-test PASS 163s Creating nova instance adt-noble-arm64-ataqv-20240327-023409-juju-7f2275-prod-proposed-migration-environment-3-d16ec69c-7dc4-4687-b63e-98e0528e1c35 from image adt/ubuntu-noble-arm64-server-20240327.img (UUID 4cac5f13-6ada-4e25-827f-1de2aa2ec4b4)...